Previous Contig 005028:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF003B08Sequence416005028 (25)gb:AY086277_15713302e-45Arabidopsis thaliana clone 23276 mRNA, complete sequence.644005028 (25)gb:AC104707_17377567e-85Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1118_F06, complete s
JMFF003H22Sequence297005028 (25)gb:AY086277_15713301e-22Arabidopsis thaliana clone 23276 mRNA, complete sequence.778005028 (25)gb:AC104707_17377565e-82Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1118_F06, complete s
JMFF004C05Sequence546005028 (25)gb:AY086277_15713306e-72Arabidopsis thaliana clone 23276 mRNA, complete sequence.734005028 (25)gb:AC104707_17377563e-63Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1118_F06, complete s
JMFF014C22Sequence475005028 (25)gb:AC104707_17377562e-69Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1118_F06, complete s436005028 (25)gb:AC104707_17377563e-52Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1118_F06, complete s
JMFF016P14Sequence543005028 (25)gb:AY086277_15713303e-73Arabidopsis thaliana clone 23276 mRNA, complete sequence.815005028 (25)gb:AC104707_17377568e-70Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1118_F06, complete s
JMFF019H12Sequence542005028 (25)gb:AY086277_15713309e-73Arabidopsis thaliana clone 23276 mRNA, complete sequence.815005028 (25)gb:AC104707_17377562e-93Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1118_F06, complete s
JMFF027N12Sequence345005028 (25)gb:AY086277_15713306e-32Arabidopsis thaliana clone 23276 mRNA, complete sequence.728005028 (25)gb:AC104707_17377563e-79Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1118_F06, complete s
JMFF028M12Sequence426005028 (25)gb:AY086277_15713303e-46Arabidopsis thaliana clone 23276 mRNA, complete sequence.
JMFF030E19Sequence173005028 (25)732005028 (25)gb:AC104707_17377563e-63Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1118_F06, complete s
JMFF044L08Sequence617005028 (25)gb:AC104707_1737756e-100Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1118_F06, complete s
JMFN004F23Sequence453005028 (25)gb:AY086277_15713302e-59Arabidopsis thaliana clone 23276 mRNA, complete sequence.
JMSF008M20Sequence328005028 (25)gb:AY086277_15713304e-28Arabidopsis thaliana clone 23276 mRNA, complete sequence.768005028 (25)gb:AC104707_1737756e-117Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1118_F06, complete s
JMSF038J11Sequence645005028 (25)gb:AB025633_15165919e-91Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MQM1.>gb:AY070073_15667948005028 (25)gb:AC104707_1737756e-126Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1118_F06, complete s
JMSF048D02Sequence705005028 (25)gb:AB025633_1516591e-104Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MQM1.>gb:AY070073_15667698005028 (25)gb:AC104707_17377561e-78Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1118_F06, complete s

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF048D02- ATTTGCATCA
rJMFF004C05- ATGATTTGCATCA
rJMFF030E19- ATTTGCATCA
rJMFF016P14- ATTTGCATCA
                      ____________________________________________________________
consensus ATGATTTGCATCA
 
. : . : . : . : . : . :
rJMSF048D02- AAAGTACAGATTTGTGAACAGACAATAAACATAAGAGCATATGACAACAAATCTCTCTTA
rJMFF004C05- AAAGTACAGATTTGTGAACAGACAATAAACATAAGAGCATATGACAACAAATCTCTCTTA
rJMFF030E19- AAAGTACAGATTTGTGAACAGACAATAAACATAAGAGCATATGACAACAAATCTCTCTTA
rJMFF016P14- AAAGTACAGATTTGTGAACAGACAATAAACATAAGAGCATGTGACAACAAATCTCTCTTA
rJMFF003H22- GAGCATATGACAACAAATCTCTCTTA
rJMSF038J11- GATTTGTGAACAGACAATAAACATAAGAGCATATGACAACAAATCTCTCTTA
                      ____________________________________________________________
consensus AAAGTACAGATTTGTGAACAGACAATAAACATAAGAGCATATGACAACAAATCTCTCTTA
 
. : . : . : . : . : . :
rJMSF048D02- AATCACTTCAAAGTTACAATAACACCAAGGACAAACTGGTCAACATTGTCTCTGTTTCAC
rJMFF004C05- AATCACTTCAAAGTTACAATAACACCAAGGACAAACTGGTCAACATTGTCTCTGTTTCAC
rJMFF030E19- AATCACTTCAAAGTTACAATAACACCAAGGACAAACTGGTCAACATTGTCTCTGTTTCAC
rJMFF016P14- AATCACTTCAAAGTTACAATAACACCAAGGACAAACTGGTCAACATTGTCTCTGTTTCAC
rJMFF019H12- AATCACTTCAAAGTTACAATAACACCAAGGACAAACTGGTCAACATTGTCTCTGTTTCAC
rJMFF027N12- AAGTTACAATAACACCAAGGACAAACTGGTCAACATTGTCTCTGTTTCAC
rJMFF014C22- AATCACTTCAAAGTTACAATAACACCAAGGACAAACTGGTCAACATTGTCTCTGTTTCAC
rJMFF003H22- AATCACTTCAAAGTTACAATAACACCAAGGACAAACTGGTCAACATTGTCTCTGTTTCAC
rJMSF008M20- GTTTCAC
rJMFF003B08- GTTACAATAACACCAAGGACAAACTGGTCAACATTGTCTCTGTTTCAC
rJMSF038J11- AATCACTTCAAAGTTACAATAACACCAAGGACAAACTGGTCAACATTGTCTCTGTTTCAC
                      ____________________________________________________________
consensus AATCACTTCAAAGTTACAATAACACCAAGGACAAACTGGTCAACATTGTCTCTGTTTCAC
 
. : . : . : . : . : . :
rJMSF048D02- CATCTCAAATAACAATGTGTAGAGTTTTTTTAGCAAGAATTCTAGAAGACAACTGTATCC
rJMFF004C05- CATCTCAAATAACAATGTGTAGAGTTTTTTTAGCAAGAATTCTAGAAGACAACTGTATCC
rJMFF030E19- CATCTCAAATAACAATGTGTAGAG-TTTTTTAGCAAGAATTCTAGAAGACAACTGTATCC
rJMFF016P14- CATCTCAAATAACAATGTGTAGAGTTTTTTTAGCAAGAATTCTAGAAGACAACTGTATCC
rJMFF019H12- CATCTCAAATAACAATGTGTAGAGTTTTTTTAGCAAGAATTCTAGAAGACAACTGTATCC
rJMFF027N12- CATCTCAAATAACAATGTGTAGAGTTTTTTTAGCAAGAATTCTAGAAGACAACTGTATCC
rJMFF014C22- CATCTCAAATAACAATGTGTAGAGTTTTTTTAGCAAGAANTCTAGAAGACAACTGTATCC
rJMFF003H22- CATCTCAAATAACAATGTGTAGAGTTTTTTTAGCAAGAATTCTAGAAGACAACTGTATCC
rJMSF008M20- CATCTCAAATAACAATGTGTAGAGTTTTTTTAGCAAGAATTCTAGAAGACAACTGTATCC
rJMFF003B08- CATCTCAAATAACAATGTGTAGAGTTTTTTTAGCAAGAATTCTAGAAGACAACTGTATCC
rJMSF038J11- CATCTCAAATAACAATGTGTAGAGTTTTTTTAGCAAGAATTCTAGAAGACAACTGTATCC
                      ____________________________________________________________
consensus CATCTCAAATAACAATGTGTAGAGTTTTTTTAGCAAGAATTCTAGAAGACAACTGTATCC
 
. : . : . : . : . : . :
rJMSF048D02- AGCATAGTTCCCAGTGTCTGAACAATGTTTGATGACACCAAATTTGACACATGTTCTTCG
rJMFF004C05- AGCATAGTTCCCAGTGTCTGAACAATGTTTGATGACATCAAATTTGACACATGTTCTTCG
rJMFF030E19- AGCATAGTTCCCAGTGTCTGAACAATGTTTGATGACATCAAATTTGACACATGTTCTTCG
rJMFF016P14- AGCATAGTTCCCAGTGTCTGAACAATGTTTGATGACATCAAATTTGACACATGTTCTTCG
rJMFF019H12- AGCATAGTTCCCAGTGTCTGAACAATGTTTGATGACATCAAATTTGACACATGTTCTTCG
rJMFF027N12- AGCATAGTTCCCAGTGTCTGAACAATGTTTGATGACATCAAATTTGACACATGTTCTTCG
rJMFF014C22- AGCATAGTTCCCAGTGTCTGAACAATGTTTGATGACATCAAATTTGACACATGTTCTTCG
rJMFF003H22- AGCATAGTTCCCAGTGTCTGAACAATGTTTGATGACATCAAATTTGACACATGTTCTTCG
rJMSF008M20- AGCATAGTTCCCAGTGTCTGAACAATGTTTGATGACATCAAATTTGACACATGTTCTTCG
rJMFF003B08- AGCATAGTTCCCAGTGTCTGAACAATGTTTGATGACATCAAATTTGACACATGTTCTTCG
rJMSF038J11- AGCATAGTTCCCAGTGTCTGAACAATGTTTGATGACATCAAATTTGACACATGTTCTTCG
                      ____________________________________________________________
consensus AGCATAGTTCCCAGTGTCTGAACAATGTTTGATGACATCAAATTTGACACATGTTCTTCG
 
. : . : . : . : . : . :
rJMSF048D02- AGATGCTTCTTGGCGTCTTGCCTTCCCACATTTGCAATGGCCAGCTTCTCTGGTGGCAAC
rJMFF004C05- AGATGCTTCTTGGCGTCTTGCCTTCCCACATTTGCAATGGCCAGCTTCTCTGGTGGCAAC
rJMFF030E19- AGATGCTTCTTGGCGTCTTGCCTTCCCACATTTGCAATGGCCAGCTTCTCTGGTGGCAAC
rJMFF016P14- AGATGCTTCTTGGCGTCTTGCCTTCCCACATTTGCAATGGCCAGCTTCTCTGGTGGCAAC
rJMFF019H12- AGATGCTTCTTGGCGTCTTGCCTTCCCACATTTGCAATGGCCAGCTTCTCTGGTGGCAAC
rJMFF027N12- AGATGCTTCTTGGCGTCTTGCCTTCCCACATTTGCAATGGCCAGCTTCTCTGGTGGCAAC
rJMFF014C22- AGATGCTTCTTGGCGTCTTGCCTTCCCACATTTGCAATGGCCAGCTTCTCTGGTGGCAAC
rJMFF003H22- AGATGCTTCTTGGCGTCTTGCCTTCCCACATTTGCAATGGCCAGCTTCTCTGGTGGCAAC
JMFF014C22+ TTGCCTTCCCACATTTGCAATGGCCAGCTTCTCTGGTGGCAAC
rJMSF008M20- AGATGCTTCTTGGCGTCTTGCCTTCCCACATTTGCAATGGCCAGCTTCTCTGGTGGCAAC
rJMFF003B08- AGATGCTTCTTGGCGTCTTGCCTTCCCACATTTGCAATGGCCAGCTTCTCTGGTGGCAAC
rJMSF038J11- AGATGCTTCTTGGCGTCTTGCCTTCCCACATTTGCAATGGCCAGCTTCTCTGGTGGCAAC
                      ____________________________________________________________
consensus AGATGCTTCTTGGCGTCTTGCCTTCCCACATTTGCAATGGCCAGCTTCTCTGGTGGCAAC
 
. : . : . : . : . : . :
rJMSF048D02- TCATCCTCTTCCTGGACTGCTTTATTATATTTGATAGCAAGATTTAGCATTTCCTGGACT
rJMFF004C05- TCATCCTCTTCCTGGACTGCTTTATTATATTTGATAGCAAGATTTAGCATTTCCTGGACT
rJMFF030E19- TCATCCTCTTCCTGGACTGCTTTATTATATTTGATAGCAAGATTTAGCATTTCCTGGACT
rJMFF016P14- TCATCCTCTTCCTGGACTGCTTTATTATATTTGATAGCAAGATTTAGCATTTCCTGGACT
rJMFF019H12- TCATCCTCTTCCTGGACTGCTTTATTATATTTGATAGCAAGATTTAGCATTTCCTGGACT
rJMFF027N12- TCATCCTCTTCCTGGACTGCTTTATTATATTTGATAGCAAGATTTAGCATTTCCTGGACT
rJMFF014C22- TCATCCTCTTCCTGGACTGCTTTATTATATTTGATAGCAAGATTTAGCATTTCCTGGACT
rJMFF003H22- TCATCCTCTTCCTGGACTGCTTTATTATATTTGATAGCAAGATTTAGCATTTCCTGGACT
JMFF014C22+ TCATCCTCTTCCTGGACTGCTTTATTATATTTGATAGCAAGATTTAGCATTTCCTGGACT
rJMSF008M20- TCATCCTCTTCCTGGACTGCTTTATTATATTTGATAGCAAGATTTAGCATTTCCTGGACT
rJMFF003B08- TCATCCTCTTCCTGGACTGCTTTATTATATTTGATAGCAAGATTTAGCATTTCCTGGACT
JMFF044L08+ CTGGACTGCTTTATTATATNTGATAGCAAGATTTAGCATTTCCTGGACT
rJMSF038J11- TCATCCTCTTCCTGGACTGCTTTATTATATTTGATAGCAAGATTTAGCATTTCCTGGACT
                      ____________________________________________________________
consensus TCATCCTCTTCCTGGACTGCTTTATTATATTTGATAGCAAGATTTAGCATTTCCTGGACT
 
. : . : . : . : . : . :
rJMSF048D02- GTCTCCTCATTGGTTTTGGAGTGGGCATCAAATCGCTGGAGTGTCAATCCATCTGTCCAT
rJMFF004C05- GTCTCCTCATTGGTTTTGGAGTGGGCATCAAATCGCTGGAGTGTCAATCCATCTGTCCAT
rJMFF030E19- GTCTCCTCATTGGTTTTGGAGTGGGCATCAAATCGCTGGAGTGTCAATCCATCTGTCCAT
rJMFF016P14- GTCTCCTCATTGGTTTTGGAGTGGGCATCAAATCGCTGGAGTGTCAATCCATCTGTCCAT
rJMFF019H12- GTCTCCTCATTGGTTTTGGAGTGGGCATCAAATCGCTGGAGTGTCAATCCATCTGTCCAT
rJMFF027N12- GTCTCCTCATTGGTTTTGGAGTGGGCATCAAATCGCTGGAGTGTCAATCCATCTGTCCAT
rJMFF014C22- GTCTCCTCATTGGTTTTGGAGTGGGCATCAAATCGCTGGAGTGTCAATCCATCTGTCCAT
rJMFF003H22- GTCTCCTCATTGGTTTTGGAGTGGGCATCAAATCGCTGGAGTGTCAATCCATCTGTCCAT
JMFF014C22+ GTCTCCTCATTGGTTTTGGAGTGGGCATCAAATCGCTGGAGTGTCAATCCATCTGTCCAT
rJMSF008M20- GTCTCCTCATTGGTTTTGGAGTGGGCATCAAATCGCTGGAGTGTCAATCCATCTGTCCAT
rJMFF003B08- GTCTCCTCATTGGTTTTGGAGTGGGCATCAAATCGCTGGAGTGTCAATCCATCTGTCCAT
JMFF044L08+ GTCTCCTCATTGGTTTTGGAGTGGGCATCAAATCGCTGGAGTGTCAATCCATCTGTCCAT
rJMSF038J11- GTCTCCTCATTGGTTTTGGAGTGGGCATCAAATCGCTGGAGTGTCAATCCATCTGTCCAT
                      ____________________________________________________________
consensus GTCTCCTCATTGGTTTTGGAGTGGGCATCAAATCGCTGGAGTGTCAATCCATCTGTCCAT
 
. : . : . : . : . : . :
rJMSF048D02- TTCTTCTTATGGAGATTCAGTAACATCTTCTCTTCAAGTTCATTCTTTCTATAATTGATT
rJMFF004C05- TTCTTCTTATGGAGATTCAGTAACATCTTCTCTTCAAGTTCATTCTTTCTATAATTGATT
rJMFF030E19- TTCTTCTTATGGAGATTCAGTAACATCTTCTCTTCAAGTTCATTCTTTCTATAATTGATT
rJMFF016P14- TTCTTCTTATGGAGATTCAGTAACATCTTCTCTTCAAGTTCATTCTTTCTATAATTGATT
rJMFF019H12- TTCTTCTTATGGAGATTCAGTAACATCTTCTCTTCAAGTTCATTCTTTCTATAATTGATT
rJMFF027N12- TTCTTCTTATGGAGATTCAGTAACATCTTCTCTTCAAGTTCATTCTTTCTATAATTGATT
rJMFF014C22- TTCTTCTTATGGAGATTCACTAACATCTTCTCTTCAAGNTCATTCTTTCTATAATTGATT
rJMFF003H22- TTCTTCTTATGGAGATTCAGTAACATCTTCTCTTCAAGTTCATTCTTTCTATAATTGATT
JMFF014C22+ TTCTTCTTATGGAGATTCAGTAACATCTTCTCTTCAAGTTCATTCTTTCTATAATTGATT
rJMSF008M20- TTCTTCTTATGGAGATTCAGTAACATCTTCTCTTCAAGTTCATTCTTTCTATAATTGATT
rJMFF003B08- TTCTTCTTATGGAGATTCAGTAACATCTTCTCTTCAAGTTCATTCTTTCTATAATTGATT
JMFF044L08+ TTCTTCTTATGGAGATTCAGTAACATCTTCTCTTCAAGTTCATTCTTTCTATAATTGATT
rJMSF038J11- TTCTTCTTATGGAGATTCAGTAACATCTTCTCTTCAAGTTCATTCTTTCTATAATTGATT
                      ____________________________________________________________
consensus TTCTTCTTATGGAGATTCAGTAACATCTTCTCTTCAAGTTCATTCTTTCTATAATTGATT
 
. : . : . : . : . : . :
rJMSF048D02- GCTATGGAGTAATAGTGCCTGTTCAGACCATGGATCAATGCCTGAATGGATGG-TTTGTT
rJMFF004C05- GCTATGGAGTAATAGTGCCTGTTCAGACCATGGATCAATGCCTGAATGGATGG-TTTGTT
rJMFF030E19- GCTATGGAGTAATAGTGCCTGTTCAGACCATGGATCAATGCCTGAATGGATGG-TTTGTT
rJMFF016P14- GCTATGGAGTAATAGTGCCTGTTCAGACCATGGATCAATGCCTGAATGGATGGTTTTGTT
rJMFF019H12- GCTATGGAGTAATAGTGCCTGTTCAGACCATGGATCAATGCCTGAATGGATGG-TTTGTT
rJMFF027N12- GCTATGGAGTAATAGTGCCTGTTCAGACCATGGATCAATGCCTGAATGGATGG-TTTGTT
rJMFF014C22- GCTATGGAG
rJMFF003H22- GCTATGGAGTAATAGTGCCTGTTCAGACCATGGATCAATGCCTGAATGGATGG-TTTGTT
JMFF014C22+ GCTATGGAGTAATAGTGCCTGTTCAGACCATGGATCAATGCCTGAATGGATGG-TTTGTT
rJMSF008M20- GCTATGGAGTAATAGTGCCTGTTCAGACCATGGATCAATGCCTGAATGGATGG-TTTGTT
rJMFF003B08- GCTATGGAGTAATAGTGCCTGTTCAGACCATGGATCAATGCCTGAATGGATGG-TTTGTT
JMFF044L08+ GCTATGGAGTAATAGTGCCTGTTCAGACCATGGATCAATGCCTGAATGGATGG-TTTGTT
rJMSF038J11- GCTATGGAGTAATAGTGCCTGTTCAGACCATGGATCAATGCCTGAATGGATGG-TTTGTT
JMSF048D02+ TGGAGTAATAGTGCCTGTTCAGACCATGGATCAATGCCTGAATGGATGG-TTTGTT
                      ____________________________________________________________
consensus GCTATGGAGTAATAGTGCCTGTTCAGACCATGGATCAATGCCTGAATGGATGG-TTTGTT
 
. : . : . : . : . : . :
rJMSF048D02- TAGATGTCCCAAGTTAGATGTTGTCTGCCGTGGCTCTTGGCCAAGCATCAT--GGTTTGG
rJMFF004C05- TAGATGTCCCAAGTTAGATGTTGTCTGCCGTGGCTCTTGGCCAAGCATCAT-GGGTTTGG
rJMFF030E19- TAGATGTCCCAAGTTAGATGTTGTCTGCCGTGGCTCTTGGCCAAGCATCAT-GGGTTTGG
rJMFF016P14- TAGATGTCCCAAGTTAGATGTTGTCTGCCGTGGCTCTTGGCCAAGCATCATGGGGTTTGG
rJMFF019H12- TAGATGTCCCAAGTTAGATGTTGTCTGCCGTGGCTCTTGGCCAAGCATCAT-GGGTTTGG
rJMFF027N12- TAGATGTCCCAAGTTAGATGTTGTCTGCCGTGGCTCTTGGCCAAGCATCAT-GGGTTTGG
rJMFF003H22- TAGATGTCCCAAGTTAGATGTTGTCTGCCGTGGCTCTTGGCCAAGCATCAT-GGGTTTGG
JMFF014C22+ TAGATGTCCCAAGTTAGATGTTGTCTGCCGTGGCTCTTGGCCAAGCATCAT--GGTTTGG
rJMSF008M20- TAGATGTCCCAAGTTAGATGTTGTCTGCCGTGGCTCTTGGCCAAGCATCAT--GGTTTGG
rJMFF003B08- TAGATGTCCCAAGTTAGATGTTGTCTGCCGTGGCTCTTGGCCAAGCATCAT--GGTTTGG
JMFF044L08+ TAGATGTCCCAAGTTAGATGTTGTCTGCCGTGGCTCTTGGCCAAGCATCAT--GGTTTGG
rJMSF038J11- TAGATGTCCCAAGTTAGATGTTGTCTGCCGTGGCTCTTGGCCAAGCATCAT--GGTTTGG
JMSF048D02+ TAGATGTCCCAAGTTAGATGTTGTCTGCCGTGGCTCTTGGCCAAGCATCAT--GGTTTGG
JMSF038J11+ CAAGTTAGATGTTGTCTGCCGTGGCTCTTGGCCAAGCATCAT--GGTTTGG
                      ____________________________________________________________
consensus TAGATGTCCCAAGTTAGATGTTGTCTGCCGTGGCTCTTGGCCAAGCATCAT--GGTTTGG
 
. : . : . : . : . : . :
rJMSF048D02- GGGTTGATCAAACGAAAGGCATCAATCACCACCTTTCCTTTAACACTTTGGATCGGATCC
rJMFF004C05- GGGTTGATCAAACGAAAGGCATCAATCACCACCTTTCCTTTAACACTTTGGATCGGATCC
rJMFF030E19- GGGTTGATCAAACGAAAGGCATCAATCACCACCTTTCCTTTAACACTTTGGATCGGATCC
rJMFF016P14- GGGTTGATCAAACGAAAGGCATCAATCACCACCTTTCCTTTAACACTTTGGATCGGATCC
rJMFF019H12- GGGTTGATCAAACGAAAGGCATCAATCACCACCTTTCCTTTAACACTTTGGATCGGATCC
rJMFF027N12- GGGTTGATCAAACGAAAGGCATCAATCACCACCTTTCCTTTAACACTTTGGATCGGATCC
rJMFF003H22- GGGTTGATCAAACGAAAGGCATCAATCACCACCTTTCCTTTAACACTTTGGATCGGATCC
JMFF014C22+ GGGTTGATCAAACGAAAGGCATCAATCACCACCTTTCCTTTAACACTTTGGATCGGATCC
rJMSF008M20- GGGTTGATCAAACGAAAGGCATCAATCACCACCTTTCCTTTAACACTTTGGATCGGATCC
rJMFF003B08- GGGTTGATCAAACGAAAGGCATCAATCACCACCTTTCCTTTAACACTTTGGATCGGATCC
JMFF044L08+ GGGTTGATCAAACGAAAGGCATCAATCACCACCTTTCCTTTAACACTTTGGATCGGATCC
rJMSF038J11- GGGTTGATCAAACGAAAGGCATCAATCACCACCTTTCCTTTAACACTTTGGATCGGATCC
JMFF016P14+ TGGATCGGATCC
JMSF048D02+ GGGTTGATCAAACGAAAGGCATCAATCACCACCTTTCCTTTAACACTTTGGATCGGATCC
JMFF019H12+ CGGATCC
JMFF004C05+ GGATCGGATCC
JMSF038J11+ GGGTTGATCAAACGAAAGGCATCAATCACCACCTTTCCTTTAACACTTTGGATCGGATCC
                      ____________________________________________________________
consensus GGGTTGATCAAACGAAAGGCATCAATCACCACCTTTCCTTTAACACTTTGGATCGGATCC
 
. : . : . : . : . : . :
rJMSF048D02- ACCACCACTGCAACCGCTCTTTGATTAA
rJMFF004C05- ACCACCACTGCAACCGCTCTTTGATTAAGAGCTTCCAAACTCTGCTGGAGTATTGATGTC
rJMFF030E19- ACCACCACTGCAACCGCTCTTTGATTAAGAGCTTCAAAACTCTGCTGGAGTATTGATGTC
rJMFF016P14- ACCACCACTGCAACCGCTCTTTGATTAAGAGCTTCAAAACTCTGCTGNANTATTGATGTC
rJMFF019H12- ACCACCACTGCAACCGCTCTTTGATTAAGAGCTTCAAAACTCTGCTGAAGTATTGATGTC
rJMFF027N12- ACCACCACTGCAACCGCTCTTTGATTAAGAGCTTCAAAACTCTGCTGGAGTATTGATGTC
rJMFF003H22- ACCACCACTGCAACCGCTCTTTGATTAAGAGCTTCAAAACTCTGCTGAAGTATTGATGTC
JMFF014C22+ ACCACCACTGCAACCGCTCTTTGATTAAGAGCTTCAAAACTCTGCTG-AGTATTGATGTC
rJMSF008M20- ACCACCACTGCAACCGCTCTTTGATTAAGAGCTTCAAAACTCTGCTG-AGTATTGATGTC
rJMFF003B08- ACCACCACTGCAACCGCTCTTTGATTAANAGCTTCAAAACTCTGCTG-AGTATTGATGTC
JMFF044L08+ ACCACCACTGCAACCGCTCTTTGATTAAGAGCTTCAAAACTCTGCTG-AGTATTGATGTC
rJMSF038J11- ACCACCACTGCAACCGCTCTTTGATTAAGAGCTTCAAAACTCTGCTG-AGTATTGATGTC
JMFF016P14+ ACCACCACTGCAACCGCTCTTTGATTAAGAGCTTCAAAACTCTGCTG-AGTATTGATGTC
JMSF048D02+ ACCACCACTGCAACCGCTCTTTGATTAAGAGCTTCAAAACTCTGCTG-AGTATTGATGTC
JMFF019H12+ ACCACCACTGCAACCGCTCTTTGATTAAGAGCTTCAAAACTCTGCTG-AGTATTGATGTC
JMFF004C05+ ACCACCANTGCAACCGCTCTTTGATTAAGAGCTTCAAAACTCTGNTG-AGTATTGATGTC
JMSF038J11+ ACCACCACTGCAACCGCTCTTTGATTAAGAGCTTCAAAACTCTGCTG-AGTATTGATGTC
                      ____________________________________________________________
consensus ACCACCACTGCAACCGCTCTTTGATTAAGAGCTTCAAAACTCTGCTG-AGTATTGATGTC
 
. : . : . : . : . : . :
rJMFF004C05- CAC
rJMFF030E19- CACAC
rJMFF016P14- CACACCCGAAAGCCAACAGCCGAAACCAGGATGTGAATGATACCAACCAACAACCATCTC
rJMFF019H12- CACACCCGAAAGCCAACAGCCGAAACCAGGATGTGAATGATACCAACCAACAACCATCTC
rJMFF027N12- CACACCCGAAAGCCAACAGCCGAAACCAGGATGTGAATGATACCAACCAACAACCATCTC
rJMFF003H22- CACACCCGAAAGCCAACAGCCGAAACCAGGATGTGAATGATACCAACCAACAACCATCTC
JMFF014C22+ CACACC
rJMSF008M20- CACACCCGAAAGCCAACAGCCGAAACCAGGATGTGAATGATACCAACCAACAACCATCTC
JMFF044L08+ CACACCCGAAAGCCAACAGCCGAAACCAGGATGTGAATGATACCAACCAACAACCATCTC
rJMSF038J11- CACACCCGAAAGCCAACAGCCGAAACCAGGATGTGAATGATACCAACCAACAACCATCTC
JMFF016P14+ CACACCCGAAAGCCAACAGCCGAAACCAGGATGTGAATGATACCAACCAACAACCATCTC
JMSF048D02+ CACACCCGAAAGCCAACAGCCGAAACCAGGATGTGAATGATACCAACCAACAACCATCTC
JMFF019H12+ CACACCCGAAAGCCAACAGCCGAAACCAGGATGTGAATGATACCAACCAACAACCATCTC
JMFN004F23+ AAAGCCAACAGCCGAAACCAGGATGTGAATGATACCAACCAACAACCATCTC
JMFF028M12+ CAACCATCTC
JMFF004C05+ CACACCCGAAAGCCAACAGCCGAAACCAGGATGTGAATGATACCAACCAACAACCATCTC
JMSF038J11+ CACACCCGAAAGCCAACAGCCGAAACCAGGATGTGAATGATACCAACCAACAACCATCTC
                      ____________________________________________________________
consensus CACACCCGAAAGCCAACAGCCGAAACCAGGATGTGAATGATACCAACCAACAACCATCTC
 
. : . : . : . : . : . :
rJMFF016P14- TGGGCCTGCCAGTTTGCTTGAG
rJMFF019H12- T-GGCCTGCCAGTTTGCTTGAGCATGTCAAGCATATTGGTCTGGAANACATGATCAACAG
rJMFF027N12- T-GGCCTGCCAGTTTGCTTGA
rJMFF003H22- T-GGCCTGCCAGTTTGCTTGAGCATGTCAAGCATA
rJMSF008M20- T-GGCCTGCCAGTTTGCTTGAGCATGTCAAGCATATTGGTCTGGAAGACATGATCAACAG
JMFF044L08+ T-GGCCTGCCAGTTTGCTTGAGCATGTCAAGCATATTGGTCTGGAAGACATGATCAACAG
rJMSF038J11- T-GGCCTGCCAGTTTGCTTGAGCATGTCAAGCATATTGGTCTGGAAGACATGATCAATAG
JMFF016P14+ T-GGCCTGCCAGTTTGCTTGAGCATGTCAAGCATATTGGTCTGGAAGACATGATCAACAG
JMSF048D02+ T-GGCCTGCCAGTTTGCTTGAGCATGTCAAGCATATTGGTCTGGAAGACATGATCAACAG
JMFF019H12+ T-GGCCTGCCAGTTTGCTTGAGCATGTCAAGCATATTGGTCTGGAAGACATGATCAACAG
JMFN004F23+ T-GGCCTGCCAGTTTGCTTGAGCATGTCAAGCATATTGGTCTGGAAGACATGATCAACAG
JMFF028M12+ T-GGCATGCCAGTTTGCTTGAGCATGTCAAGCATATTGGTNTGGAAGACATGATCAACAG
JMFF004C05+ T-GGCCTGCCAGTTTGCTTGAGCATGTCAAGCATATTGGTCTGGAAGACATGATCAACAG
JMFF003B08+ T-GGCCTGCCAGTTTGCTTGAGCANGTCAAGCATATTGGTCTGGAAGACATGATCAACAG
JMSF038J11+ T-GGCCTGCCAGTTTGCTTGAGCATGTCAAGCATATTGGTCTGGAAGACATGATCAATAG
                      ____________________________________________________________
consensus T-GGCCTGCCAGTTTGCTTGAGCATGTCAAGCATATTGGTCTGGAAGACATGATCAACAG
 
. : . : . : . : . : . :
rJMFF019H12- CTTCAACACTCACTCCGGTCCCGCTCTGTGG
rJMSF008M20- CTTCAACACTCACTCCGGTCCCGCTCTG
JMFF044L08+ CTTCAACACTCACTCCGGTCCCGCTCTGTGGCATAGCGAACACATCGACCACGCGGACCG
rJMSF038J11- CTTCAACACTCACTCCGGTCCCGCTCTGTGGCATAGCGAACACATCGACCACGCGGACCG
JMFF016P14+ CTTCAACACTCACTCCGGTCCCGCTCTGTGGCATAGCGAACACATCGACCACGCGGACCG
JMSF048D02+ CTTCAACACTCACTCCGGTCCCGCTCTGTGGCATAGCGAACACATCGACCACGCGGACCG
JMFF019H12+ CTTCAACACTCACTCCGGTCCCGCTCTGTGGCATAGCGAACACATCGACCACGCGGACCG
JMFN004F23+ CTTCAACACTCACTCCGGTCCCGCTCTGTGGCATAGCGAACACATCGACCACGCGGACCG
JMFF028M12+ CTTCAACACTCACTCCGGTCCCGCTCTGTGGCATAGCGAACACATCGACCACGCGGACNG
JMFF004C05+ CTTCAACACTCACTCCGGTCCCGCTCTGTGGCATAGCGAACACATCGACCACGCGGACCG
JMFF027N12+ CTCCGGTCCCGCTCTGTGGCATAGCGAACACATCGACCACGCGGACCG
JMFF003B08+ CTTCAACACTCACTCCGGTCCCGCTCTGTGGCATAGCGAACACATCGACCACGCGGACCG
JMSF038J11+ CTTCAACACTCACTCCGGTCCCGCTCTGTGGCATAGCGAACACATCGACCACGCGGACCG
JMSF008M20+ GCATAGCGAACACATCGACCACGCGGACCG
                      ____________________________________________________________
consensus CTTCAACACTCACTCCGGTCCCGCTCTGTGGCATAGCGAACACATCGACCACGCGGACCG
 
. : . : . : . : . : . :
JMFF044L08+ TGTACTCATCCACAAA-TTCCCCCAACATTAATC
rJMSF038J11- TGTACTCATCCACAAANTTCCCCCNACATCAATCCCATGGACTTCCATCGGAACCCCGGC
JMFF016P14+ TGTACTCATCCACAAA-TTCCCCCAACATCAATCCCAT-GACTTCCATCGGAACCCCGGC
JMSF048D02+ TGTACTCATCCACAAA-TTCCCCCAACATCAATCCCAT-GACTTCCATCGGAACCCCGGC
JMFF019H12+ TGTACTCATCCACAAA-TTCCCCCAACATCAATCCCAT-GACTTCCATCGGAACCCCGGC
JMFN004F23+ TGTACTCATCCACAAA-TTCCCCCAACATCAATCCCAT-GACTTCCATCGGAACCCCGGC
JMFF028M12+ TGTACTCATCCACAAA-TTCCCCCAACATCAATCCCAT-GACTTCCATCGGAACCCCGGC
JMFF004C05+ TGTACTCATCCACAAA-TTCCCCCAACATCAATCCCAT-GACTTCCATCGGAACCCCGGC
JMFF027N12+ TGTACTCATCCACAAA-TTCCCCCAACATCAATCCCAT-GACTTCCATCGGAACCCCGGC
JMFF003H22+ TGTACTCATCCACAAA-TTCCCCCAACATCAATCCCAT-GACTTCCATCGGAACCCCGGC
JMFF003B08+ TGTACTCATCCACAAA-TTCCCCCAACATCAATCCCAT-GACTTCCATCGGAACCCCGGC
JMSF038J11+ TGTACTCATCCACAAA-TTCCCCCAACATCAATCCCAT-GACTTCCATCGGAACCCCGGC
JMSF008M20+ TGTACTCATCCACAAA-TTCCCCCAACATCAATCCCAT-GACTTCCATCGGAACCCCGGC
                      ____________________________________________________________
consensus TGTACTCATCCACAAA-TTCCCCCAACATCAATCCCAT-GACTTCCATCGGAACCCCGGC
 
. : . : . : . : . : . :
rJMSF038J11- T
JMFF016P14+ TCTCCCGTGTTTGAGCATCTTGAGGAGAGCGAGAGAAGAGATGTAGACTTGCTCCGATGA
JMSF048D02+ TCTCCCGTGTTTGAGCATCTTGAGGAGAGCGAGAGAAGAGATGTAGACTTGCTCCGATGA
JMFF019H12+ TCTCCCGTGTTTGAGCATCTTGAGGAGAGCGAGAGAAGAGATGTAGACTTGCTCCGATGA
JMFN004F23+ TCTCCCGTGTTTGAGCATCTTGAGGAGAGCGAGAGAAGAGATGTAGACTTGCTCCGATGA
JMFF028M12+ TCTCCCGTGTTTGAGCATCTTGAGGAGAGCGAGAGAAGAGATGTAGACTTGCTCCGATGA
JMFF004C05+ TCTCCCGTGTTTGAGCATCTTGAGGAGAGCGAGAGAAGAGATGTAGACTTGCTCCGATGA
JMFF027N12+ TCTCCCGTGTTTGAGCATCTTGAGGAGAGCGAGAGAAGAGATGTAGACTTGCTCCGATGA
JMFF003H22+ TCTCCCGTGTTTGAGCATCTTGAGGAGAGCGAGAGAAGAGATGTAGACTTGCTCCGATGA
JMFF003B08+ TCTCCCGTGTTTGAGCATCTTGAGGAGAGCGAGAGAAGAGATGTAGACTTGCTCCGATGA
JMSF038J11+ TCTCCCGTGTTTGAGCATCTTGAGGAGAGCGAGAGAAGAGATGTAGACTTGCTCCGATGA
JMSF008M20+ TCTCCCGTGTTTGAGCATCTTGAGGAGAGCGAGAGAAGAGATGTAGACTTGCTCCGATGA
                      ____________________________________________________________
consensus TCTCCCGTGTTTGAGCATCTTGAGGAGAGCGAGAGAAGAGATGTAGACTTGCTCCGATGA
 
. : . : . : . : . : . :
JMFF016P14+ ATCGAGAGTAGGAGAATCCGGCGGCGGGTGACCTAACGCACCACCGGCTCCGGCGAACAT
JMSF048D02+ ATCGAGAGTAGGAGAATCCGGCGGCGGGTGACCTAACGCACCACCGGCTCCGGCGAACAT
JMFF019H12+ ATCGAGAGTAGGAGAATCCGGCGGCGGGTGACCTAACGCACCACCGGCTCCGGCGAACAT
JMFN004F23+ ATCGAGAGTAGGAGAATCCGGCGGCGGGTGACCTAACGCACCACCGGCTCCGGCGAACAT
JMFF028M12+ ATCGAGAGTAGGAGAATCCGGCGGCGGGTGACCTAACGCACCACCGGCTCCGGCGAACAT
JMFF004C05+ ATCGAGAGTAGGAGAATCCGGCGGCGGGTGACCTAACGCACCACCGGCTCCGGCGAACAT
JMFF027N12+ ATCGAGAGTAGGAGAATCCGGCGGCGGGTGACCTAACGCACCACCGGCTCCGGCGAACAT
JMFF003H22+ ATCGAGAGTAGGAGAATCCGGCGGCGGGTGACCTAACGCACCACCGGCTCCGGCGAACAT
JMFF030E19+ AGTAGGAGAATCCGGCGGCGGGTGACCTAACGCACCACCGGCTCCGGCGAACAT
JMFF003B08+ ATCGAGAGTAGGAGAATCCGGCGGCGGGTGACCTAACGCACCACCGGCTCCGGCGAACAT
JMSF038J11+ ATCGAGAGTAGGAGAATCCGGCGGCGGGTGACCTAACGCACCACCGGCTCCGGCGAACAT
JMSF008M20+ ATCGAGAGTAGGAGAATCCGGCGGCGGGTGACCTAACGCACCACCGGCTCCGGCGAACAT
                      ____________________________________________________________
consensus ATCGAGAGTAGGAGAATCCGGCGGCGGGTGACCTAACGCACCACCGGCTCCGGCGAACAT
 
. : . : . : . : . : . :
JMFF016P14+ ACGCTGCAGCCTTTCCATTCCCGACATGATTGGTTTAAGATTTACTCTCTCTTCCGCTAT
JMSF048D02+ ACGCTGCAGCCTTTCCATTCCCGACATGATTGGTTTAAGATTTACTCTCTCTTCCGCTAT
JMFF019H12+ ACGCTGCAGCCTTTCCATTCCCGACATGATTGGTTTAAGATTTACTCTCTCTTCCGCTAT
JMFN004F23+ ACGCTGCAGCCTTTCCATTCCCGACATGATTGGTTTAAGATTTACTCTCTCTTCCGCTAT
JMFF028M12+ ACGCTGCAGCCTTTCCATTCCCGACATGATTGGTTTAAGATTTACTCTCTCTTCCGCTAT
JMFF004C05+ ACGCTGCAGCCTTTCCATTCCCGACATGATTGGTTTAAGATTTACTCTCTCTTCCGCTAT
JMFF027N12+ ACGCTGCAGCCTTTCCATTCCCGACATGATTGGTTTAAGATTTACTCTCTCTTCCGCTAT
JMFF003H22+ ACGCTGCAGCCTTTCCATTCCCGACATGATTGGTTTAAGATTTACTCTCTCTTCCGCTAT
JMFF030E19+ ACGCTGCAGCCTTTCCATTCCCGACATGATTGGTTTAAGATTTACTCTCTCTTCCGCTAT
JMFF003B08+ ACGCTGCAGCCTTTCCATTCCCGACATGATTGGTTTAAGATTTACTCTCTCTTCCGCTAT
JMSF038J11+ ACGCTGCAGCCTTTCCATTCCCGACATGATTGGTTTAAGATTTACTCTCTCTTCCGCTAT
JMSF008M20+ ACGCTGCAGCCTTTCCATTCCCGACATGATTGGTTTAAGATTTACTCTCTCTTCCGCTAT
                      ____________________________________________________________
consensus ACGCTGCAGCCTTTCCATTCCCGACATGATTGGTTTAAGATTTACTCTCTCTTCCGCTAT
 
. : . : . : . : . : . :
JMFF016P14+ GCTTTAGCCGCTTCGATTTCTTTGGAAACACGACTACTGTGGAATTAAAATCCTC
JMSF048D02+ GCTTTAGCCGCTTCGATTTCTTTGGAAACACGACTACTGTGGAATTAAAATCCTC
JMFF019H12+ GCTTTAGCCGCTTCGATTTCTTTGGAAACACGACTACTGTGGAATTAAAATCCTCACCC
JMFN004F23+ GCTTTAGCCGCTTCGATTTC-TTGGAAACACGACTACTGT
JMFF028M12+ GCTTTAGCCGCTTCGATTTCTTTGGAAACACGACTACTGTGGAATTAAAATCCTCACCC
JMFF004C05+ GCTTTAGCCGCTTCGATTTCTTTGGAAACACGACTACTGTGGAATTAAAATCCTCACCC
JMFF027N12+ GCTTTAGCCGCTTCGATTTCTTTGGAAACACGACTACTGTGGAATTAAAATCCTCACCC
JMFF003H22+ GCTTTAGCCGCTTCGATTTCTTTGGAAACACGACTACTGTGGAATTAAAATCCTCACCC
JMFF030E19+ GCTTTAGCCGCTTCGATTTCTTTGGAAACACGACTACTGTGGAATTAAAATCCTCACCC
JMFF003B08+ GCTTTAGCCGCTTCGATTTCTTTGGAAACACGACTACTGTGGAATTAAAATCCTCACCC
JMSF038J11+ GCTTTAGCCGCTTCGATTTCTTTGGAAACACGACTACTGTGGAATTAAAATCCTCACCC
JMSF008M20+ GCTTTAGCCGCTTCGATTTCTTTGGAAACACGACTACTGTGGAATTAAAATCCTCACCCC
                      ____________________________________________________________
consensus GCTTTAGCCGCTTCGATTTCTTTGGAAACACGACTACTGTGGAATTAAAATCCTCACCCC