Previous Contig 005026:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF023D05Sequence526005026 (11)723013039 (10)
JMFS007A10Sequence614005026 (11)gb:AF370132_17920200.006Arabidopsis thaliana unknown protein (At5g51300) mRNA, complete cds.
JMFS050F01Sequence523005026 (11)gb:AF370132_17920204e-08Arabidopsis thaliana unknown protein (At5g51300) mRNA, complete cds.
JMFS063A11Sequence636005026 (11)gb:AF370132_17920200.007Arabidopsis thaliana unknown protein (At5g51300) mRNA, complete cds.
JMFS126F01Sequence547005026 (11)gb:AF370132_17920200.005Arabidopsis thaliana unknown protein (At5g51300) mRNA, complete cds.
JMSF006P21Sequence321005026 (11)
JMSF008M07Sequence262005026 (11)666013039 (10)
JMSF022G24Sequence654005026 (11)gb:AF370132_17920204e-04Arabidopsis thaliana unknown protein (At5g51300) mRNA, complete cds.760013039 (10)
JMSF031A14Sequence660005026 (11)gb:AF370132_17920200.007Arabidopsis thaliana unknown protein (At5g51300) mRNA, complete cds.751013039 (10)
JMSF036H06Sequence646005026 (11)gb:AF370132_17920200.009Arabidopsis thaliana unknown protein (At5g51300) mRNA, complete cds.736013039 (10)
JMSF040O12Sequence626005026 (11)gb:AF370132_17920200.005Arabidopsis thaliana unknown protein (At5g51300) mRNA, complete cds.782013039 (10)

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF040O12+ TTCCAGTC
JMFS007A10+ TGACTTCCTTTTCCTTCGGTTTCCAGTC
JMSF022G24+ ATCCGCCCACCGTGACTTCCTTTTCCTTCCGGTTCCAGTC
JMSF031A14+ TTCCAGTC
                      ____________________________________________________________
consensus ATCCGCCCACCGTGACTTCCTTTTCCTTCGGTTTCCAGTC
 
. : . : . : . : . : . :
JMSF040O12+ CCTGTNCCGCTCCCATCACCGCCAGTACCAGTGCCATCGTTGCTCGACTCGCTAGGAGGA
JMFS050F01+ A
JMFS007A10+ CCTGTCCCGCTCCCATCACCGCCAGTACCAGTGCCATCGTTGCTCGACTCGCTAGGAGGA
JMSF022G24+ CCTGTCCCGCTCCCATCACCGCCAGTACCAGTGCCATCGTTGCTCGACTCGCTAGGAGGA
JMFS063A11+ TGTCCCGCTCCCATCACCGCCAGTACCAGTGCCATCGTTGCTCGACTCGCTAGGAGGA
JMSF031A14+ CCTGTCCCGCTCCCATCACCGCCAGTACCAGTGCCATCGTTGCTCGACTCGCTAGGAGGA
JMSF036H06+ ATCACCGCCAGTACCAGTGCCATCGTTGCTCGACTCGCTAGGAGGA
                      ____________________________________________________________
consensus CCTGTCCCGCTCCCATCACCGCCAGTACCAGTGCCATCGTTGCTCGACTCGCTAGGAGGA
 
. : . : . : . : . : . :
JMSF040O12+ GGGTCCCACCGGCTCNTGCGACGCCTCNTGCTGGTAGTTTCCTCTTCGCCGCCAGACTGG
JMFS050F01+ GGGTCCCACCGGCTCCTGNGACGCCTCNNGCTGGTAGTTCTCTCTTCGCCGCCAGACTGG
JMFS007A10+ GGGTCCCACCGGCTCCTGCGACGCCTCCTGCTGGTAGTTTCCTCTTCGCCGCCAGACTGG
JMSF022G24+ GGGTCCCACCGGCTCCTGCGACGCCTCCTGCTGGTAGTTTCCTCTTCGCCGCCAGACTGG
JMFS126F01+ TGCGACGCCTCCTGCTGGTAGTTTCCTCTTCGCCGCCAGACTGG
JMFS063A11+ GGGTCCCACCGGCTCCTGCGACGCCTCCTGCTGGTAGTTTCCTCTTCGCCGCCAGACTGG
JMSF031A14+ GGGTCCCACCGGCTCCTGCGACGCCTCCTGCTGGTAGTTTCCTCTTCGCCGCCAGACTGG
JMSF036H06+ GGGTCCCACCGGCTCCTGCGACGCCTCCTGCTGGTAGTTTCCTCTTCGCCGCCAGACTGG
                      ____________________________________________________________
consensus GGGTCCCACCGGCTCCTGCGACGCCTCCTGCTGGTAGTTTCCTCTTCGCCGCCAGACTGG
 
. : . : . : . : . : . :
JMSF040O12+ TCCTTATCGGTACCACTGTGAGTATTCGTGAGCCCGTTCTCCGACAGCAAGGGTTTGCGG
JMFS050F01+ TCCTTATCGGTACCACTGTGAGTATTCGTGAGCCCGTTCTCCGACAGCAAGGGTTTGCGG
JMFS007A10+ TCCTTATCGGTACCACTGTGAGTATTCGTGAGCCCGTTCTCCGACAGCAAGGGTTTGCGG
JMSF022G24+ TCCTTATCGGTACCACTGTGAGTATTCGTGAGCCCGTTCTCCGACAGCAAGGGTTTGCGG
JMFS126F01+ TCCTTATCGGTACCACTGTGAGTATTCGTGAGCCCGTTCTCCGACAGCAAGGGTTTGCGG
JMFS063A11+ TCCTTATCGGTACCACTGTGAGTATTCGTGAGCCCGTTCTCCGACAGCAAGGGTTTGCGG
JMSF031A14+ TCCTTATCGGTACCACTGTGAGTATTCGTGAGCCCGTTCTCCGACAGCAAGGGTTTGCGG
JMFF023D05+ CACTGTGAGTATTCGTGAGCCCGTTCTCCGACAGCAAGGGTTTGCGG
JMSF036H06+ TCCTTATCGGTACCACTGTGAGTATTCGTGAGCCCGTTCTCCGACAGCAAGGGTTTGCGG
                      ____________________________________________________________
consensus TCCTTATCGGTACCACTGTGAGTATTCGTGAGCCCGTTCTCCGACAGCAAGGGTTTGCGG
 
. : . : . : . : . : . :
JMSF040O12+ AGCTCGACCTTCGGAGCGCCATCCTGAGGCGTCGTTTGCTCGNGGTTCTGGGCCGAATTA
JMFS050F01+ AGCTCGACCTTCGGAGCGCCATCCTGAGGCGTCGTTTGCTCGTGGTTCTGGGCCGAATTA
JMFS007A10+ AGCTCGACCTTCGGAGCGCCATCCTGAGGCGTCGTTTGCTCGTGGTTCTGGGCCGAATTA
JMSF022G24+ AGCTCGACCTTCGGAGCGCCATCCTGAGGCGTCGTTTGCTCGTGGTTCTGGGCCGAATTA
JMFS126F01+ AGCTCGACCTTCGGAGCGCCATCCTGAGGCGTCGTTTGCTCGTGGTTCTGGGCCGAATTA
JMFS063A11+ AGCTCGACCTTCGGAGCGCCATCCTGAGGCGTCGTTTGCTCGTGGTTCTGGGCCGAATTA
JMSF031A14+ AGCTCGACCTTCGGAGCGCCATCCTGAGGCGTCGTTTGCTCGTGGTTCTGGGCCGAATTA
JMFF023D05+ AGCTCGACCTTCGGAGCGCCATCCTGAGGCGTCGTTTGCTCGTGGTTCTGGGCCGAATTA
JMSF036H06+ AGCTCGACCTTCGGAGCGCCATCCTGAGGCGTCGTTTGCTCGTGGTTCTGGGCCGAATTA
                      ____________________________________________________________
consensus AGCTCGACCTTCGGAGCGCCATCCTGAGGCGTCGTTTGCTCGTGGTTCTGGGCCGAATTA
 
. : . : . : . : . : . :
JMSF040O12+ TTATCCATCTGCTGCTCGGAGCTGCCGTGAGTGTTGTGNCGATCCGAATCTAGGGTTTTT
JMFS050F01+ TTATCCATCTGCTGCTCGGAGCTGCCGTGAGTGTTGTGGCGATCCGAATCTAGGGTTTTT
JMFS007A10+ TTATCCATCTGCTGCTCGGAGCTGCCGTGAGTGTTGTGGCGATCCGAATCTAGGGTTTTT
JMSF022G24+ TTATCCATCTGCTGCTCGGAGCTGCCGTGAGTGTTGTGGCGATCCGAATCTAGGGTTTTT
JMFS126F01+ TTATCCATCTGCTGCTCGGAGCTGCCGTGAGTGTTGTGGCGATCCGAATCTAGGGTTTTT
JMFS063A11+ TTATCCATCTGCTGCTCGGAGCTGCCGTGAGTGTTGTGGCGATCCGAATCTAGGGTTTTT
JMSF031A14+ TTATCCATCTGCTGCTCGGAGCTGCCGTGAGTGTTGTGGCGATCCGAATCTAGGGTTTTT
JMSF006P21+ TTTT
JMFF023D05+ TTATCCATCTGCTGCTCGGAGCTGCCGTGAGTGTTGTGGCGATCCGAATCTAGGGTTTTT
JMSF036H06+ TTATCCATCTGCTGCTCGGAGCNGCCGTGAGTGTTGTGGCGATCCGAATCTAGGGTTTTT
                      ____________________________________________________________
consensus TTATCCATCTGCTGCTCGGAGCTGCCGTGAGTGTTGTGGCGATCCGAATCTAGGGTTTTT
 
. : . : . : . : . : . :
JMSF040O12+ CCAGGCTGATTTTGCTCCTGAGGATACGCAGCAACAGAGTGCGATTGGGACTGATCTAGG
JMFS050F01+ CCAGGCTGATTTTGCTCCTGAGGATACGCAGCAACAGAGTGCGATTGGGACTGATCTAGG
JMFS007A10+ CCAGGCTGATTTTGCTCCTGAGGATACGCAGCAACAGAGTGCGATTGGGACTGATCTAGG
JMSF022G24+ CCAGGCTGATTTTGCTCCTGAGGATACGCAGCAACAGAGTGCGATTGGGACTGATCTAGG
JMFS126F01+ CCAGGCTGATTTTGCTCCTGAGGATACGCAGCAACAGAGTGCGATTGGGACTGATCTAGG
JMFS063A11+ CCAGGCTGATTTTGCTCCTGAGGATACGCAGCAACAGAGTGCGATTGGGACTGATCTAGG
JMSF031A14+ CCAGGCTGATTTTGCTCCTGAGGATACGCAGCAACAGAGTGCGATTGGGACTGATCTAGG
JMSF006P21+ CCAGGCTGATTTTGCTCCTGAGGATACGCAGCAACAGAGTGCGATTGGGACTGATCTAGG
JMFF023D05+ CCAGGCTGATTTTGCTCCTGAGGATACGCAGCAACAGAGTGCGATTGGGACTGATCTAGG
JMSF036H06+ CCAGGCTGATTTTGCTCCTGAGGATACGCAGCAACAGAGTGCGATTGGGACTGATCTAGG
                      ____________________________________________________________
consensus CCAGGCTGATTTTGCTCCTGAGGATACGCAGCAACAGAGTGCGATTGGGACTGATCTAGG
 
. : . : . : . : . : . :
JMSF040O12+ GTTTGAGAAGGGTTTTGAGGGTACGAATCTGAGTAATTTTGGTAGTATGACGAAGAATCA
JMFS050F01+ GTTTGAGAAGGGTTTTGAGGGTACGAATCTGAGTAATTTTGGTAGTATGATGAAGAATCA
JMFS007A10+ GTTTGAGAAGGGTTTTGAGGGTACGAATCTGAGTAATTTTGGTAGTATGATGAAGAATCA
JMSF022G24+ GTTTGAGAAGGGTTTTGAGGGTACGAATCTGAGTAATTTTGGTAGTATGACGAAGAATCA
JMFS126F01+ GTTTGAGAAGGGTTTTGAGGGTACGAATCTGAGTAATTTTGGTAGTATGATGAAGAATCA
JMFS063A11+ GTTTGAGAAGGGTTTTGAGGGTACGAATCTGAGTAATTTTGGTAGTATGATGAAGAATCA
JMSF031A14+ GTTTGAGAAGGGTTTTGAGGGTACGAATCTGAGTAATTTTGGTAGTATGATGAAGAATCA
JMSF006P21+ GTTTGAGAAGGGTTTTGAGGGTACGAATCTGAGTAATTTTGGTAGTATGATGAAGAATCA
JMFF023D05+ GTTTGAGAAGGGTTTTGAGGGTACGAATCTGAGTAATTTTGGTAGTATGATGAAGAATCA
JMSF036H06+ GTTTGAGAAGGGTTTTGAGGGTACGAATCTGAGTAATTTTGGTAGTATGATGAAGAATCA
JMSF008M07+ TTGGTAGTATGATGAAGAATCA
                      ____________________________________________________________
consensus GTTTGAGAAGGGTTTTGAGGGTACGAATCTGAGTAATTTTGGTAGTATGATGAAGAATCA
 
. : . : . : . : . : . :
JMSF040O12+ GAATAATTCTGAAACGAGGACTGATCGTACGAACCCAGCCCTCGGGACGAATGTTGAGGT
JMFS050F01+ GAATAATTCTGAAACGAGGACTGATCGTACGAACCCAGCCCTCGGGACGAATGTTGAGGT
JMFS007A10+ GAATAATTCTGAAACGAGGACTGATCGTACGAACCCAGCCCTCGGGACGAATGTTGAGGT
JMSF022G24+ GAATAATTCTGAAACGAGGACTGATCGTACGAACCCAGCCCTCGGGACGAATGTTGAGGT
JMFS126F01+ GAATAATTCTGAAACGAGGACTGATCGTACGAACCCAGCCCTCGGGACGAATGTTGAGGT
JMFS063A11+ GAATAATTCTGAAACGAGGACTGATCGTACGAACCCAGCCCTCGGGACGAATGTTGAGGT
JMSF031A14+ GAATAATTCTGAAACGAGGACTGATCGTACGAACCCAGCCCTCGGGACGAATGTTGAGGT
JMSF006P21+ GAATAATTCTGAAACGAGGACTGATCGTACGAACCCAGCCCTCGGGACGAATGTTGAGGT
JMFF023D05+ GAATAATTCTGAAACGAGGACTGATCGTACGAACCCAGCCCTCGGGACGAATGTTGAGGT
JMSF036H06+ GAATAATTCTGAAACGAGGACTGATCGTACGAACCCAGCCCTCGGGACGAATGTTGAGGT
JMSF008M07+ GAATAATTCTGAAACGAGGACTGATCGTACGAACCCAGCCCTCGGGACGAATGTTGAGGT
                      ____________________________________________________________
consensus GAATAATTCTGAAACGAGGACTGATCGTACGAACCCAGCCCTCGGGACGAATGTTGAGGT
 
. : . : . : . : . : . :
JMSF040O12+ TGAGTTTCAGAAGCAGCTCCCGGCTCAGATTGGGAATCCATGTAATTGGACTGAAGCGTA
JMFS050F01+ TGAGTTTCAGAAGCAGCTCCCGGCTCAGATTGGGAATCCATGTAATTGGACTGAAGCGTA
JMFS007A10+ TGAGTTTCAGAAGCAGCTCCCGGCTCAGATTGGGAATCCATGTAATTGGACTGAAGCGTA
JMSF022G24+ TGAGTTTCAGAAGCAGCTCCCGGCTCAGATTGGGAATCCATGTAATTGGACTGAAGCGTA
JMFS126F01+ TGAGTTTCAGAAGCAGCTCCCGGCTCAGATTGGGAATCCATGTAATTGGACTGAAGCGTA
JMFS063A11+ TGAGTTTCAGAAGCAGCTCCCGGCTCAGATTGGGAATCCATGTAATTGGACTGAAGCGTA
JMSF031A14+ TGAGTTTCAGAAGCAGCTCCCGGCTCAGATTGGGAATCCATGTAATTGGACTGAAGCGTA
JMSF006P21+ TGAGTTTCAGAAGCAGCTCCCGGCTCAGATTGGGAATCCATGTAATTGGACTGAAGCGTA
JMFF023D05+ TGAGTTTCAGAAGCAGCTCCCGGCTCAGATTGGGAATCCATGTAATTGGACTGAAGCGTA
JMSF036H06+ TGAGTTTCAGAAGCAGCTCCCGGCTCAGATTGGGAATCCATGTAATTGGACTGAAGCGTA
JMSF008M07+ TGAGTTTCAGAAGCAGCTCCCGGCTCAGATTGGGAATCCATGTAATTGGACTGAAGCGTA
                      ____________________________________________________________
consensus TGAGTTTCAGAAGCAGCTCCCGGCTCAGATTGGGAATCCATGTAATTGGACTGAAGCGTA
 
. : . : . : . : . : . :
JMSF040O12+ TCCATCTTTGGGAGGAGAAAATTCAATGAAACGAGAGGGTGGCGCGCCTCGTCGGGAATG
JMFS050F01+ TCCATCTTTGGGAGGAGAAAATTCAATGAAACGAGAGGGTGG
JMFS007A10+ TCCATCTTTGGGAGGAGAAAATTCAATGAAACGAGAGGGTGGCGCG
JMSF022G24+ TCCATCTTTGGGAGGAGAAAATTCAATGAAACGAGAGGGTGGCGCGCCTCGTCGGGAATG
JMFS126F01+ TCCATCTTTGGGAGGAGAAAATTCAATGAAACGAGAGGGTGGCGCGCCTCGTCGGGAATG
JMFS063A11+ TCCATCTTTGGGAGGAGAAAATTCAATGAAACGAGAGGGTGGCGCGCCTCGTCGGGAATG
JMSF031A14+ TCCATCTTTGGGAGGAGAAAATTCAATGAAACGAGAGGGTGGCGCGCCTCGTCGGGAATG
JMSF006P21+ TCCATCTTTGGGAGGAGAAAATTCAATGAAACGAGAGGGTGGCGCGCCTCGTCGGGAATG
JMFF023D05+ TCCATCTTTGGGAGGAGAAAATTCAATGAAACGAGAGGGTGGCGCGCCTCGTCGGGAATG
JMSF036H06+ TCCATCTTTGGGAGGAGAAAATTCAATGAAACGAGAGGGTGGCGCGCCTCGTCGGGAATG
JMSF008M07+ TCCATCTTTGGGAGGAGAAAATTCAATGAAACGAGAGGGTGGCGCGCCTCGTCGGGAATG
                      ____________________________________________________________
consensus TCCATCTTTGGGAGGAGAAAATTCAATGAAACGAGAGGGTGGCGCGCCTCGTCGGGAATG
 
. : . : . : . : . : . :
JMSF040O12+ AAAGAGATATGGT
JMSF022G24+ AAAGAGATATGGT
JMFS126F01+ AAAGAGATATGGTGGAGGACTGG
JMFS063A11+ AAAGAGATATGGTGGAGGACTGGGTCTGGGGTTACAAG
JMSF031A14+ AAAGAGATATGGTGGAGGACTGGGTCTGGGGTTACAAGTTATTTGT
JMSF006P21+ AAAGAGATATGGT
JMFF023D05+ AAAGAGATATGGTGGAGGACTGGGTCTGGGGTTACAAGTTATTTGTAGAAAGTGAT
JMSF036H06+ AAAGAGATATGGTGGAGGACTGGGTCTGGGGTTACAAGTTATTTGTAGAAAGTGAT
JMSF008M07+ AAAGAGATATGGTGGAGGACTGGGTCTGGGGTTACAAGTTATTTGTAGAAAGTGATTCCA
                      ____________________________________________________________
consensus AAAGAGATATGGTGGAGGACTGGGTCTGGGGTTACAAGTTATTTGTAGAAAGTGATTCCA