Previous Contig 005025:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF008L19Sequence312005025 (3)gb:AY085184_15702634e-06Arabidopsis thaliana clone 13653 mRNA, complete sequence.659005025 (3)gb:ATAC010870_15431853e-51Arabidopsis thaliana chromosome III BAC T13O15 genomic sequence, complete sequen
JMSF020D10Sequence681005025 (3)gb:ATAC010870_15431852e-52Arabidopsis thaliana chromosome III BAC T13O15 genomic sequence, complete sequen769011103 (3)gb:STU02496_17229561e-88Solanum tuberosum Lemhi Russet clone EH5.3 epoxide hydrolase mRNA, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF008L19- ATTACTTCATAGATTTGACTT
                      ____________________________________________________________
consensus ATTACTTCATAGATTTGACTT
 
. : . : . : . : . : . :
rJMSF008L19- CAAAACTAGTGTTGAGGATCTTAGGCCATTTACTCATCACTTCCTGGAGAAGAACTAGAG
JMSF020D10+ CTTAGGCCATTTACTCATCACTTCCTGGAGAAGAACTAGAG
                      ____________________________________________________________
consensus CAAAACTAGTGTTGAGGATCTTAGGCCATTTACTCATCACTTCCTGGAGAAGAACTAGAG
 
. : . : . : . : . : . :
rJMSF008L19- TGCCTTCGTATCGCGATTCCGTTAGAGACAGGTTCCTCTTCTTCACAGCATCCTCAAGCT
JMSF020D10+ TGCCTTCGTATCGCGATTCCGTTAGAGACAGGTTCCTCTTCTTCACAGCATCCTCAAGCT
                      ____________________________________________________________
consensus TGCCTTCGTATCGCGATTCCGTTAGAGACAGGTTCCTCTTCTTCACAGCATCCTCAAGCT
 
. : . : . : . : . : . :
rJMSF008L19- CTTCAATGTTGTCAAATAATCTGTTGGCGAGGTCTGTGAGGGGCTGCTTTTCATTTGCTT
JMSF020D10+ CTTCAATGTTGTCAAATAATCTGTTGGCGAGGTCTGTGAGGGGCTGCTTTTCATTTGCTT
                      ____________________________________________________________
consensus CTTCAATGTTGTCAAATAATCTGTTGGCGAGGTCTGTGAGGGGCTGCTTTTCATTTGCTT
 
. : . : . : . : . : . :
rJMSF008L19- CAGCGGTGGAGATTACCTTGTCGAAATCGAAGTACATGAAGGTAGCCTTGATGCGCAGAT
JMSF020D10+ CAGCGGTGGAGATTACCTTGTCGAAATCGAAGTACATGAAGGTAGCCTTGATGCGCAGAT
                      ____________________________________________________________
consensus CAGCGGTGGAGATTACCTTGTCGAAATCGAAGTACATGAAGGTAGCCTTGATGCGCAGAT
 
. : . : . : . : . : . :
rJMSF008L19- ATCTGAGAACATAGCTCCAAGCATCAGAGCCAATTAGATCCCCCAAAGCCATAAGATCAA
JMSF020D10+ ATCTGAGAACATAGCTCCAAGCATCAGAGCCAATTAGATCCCCCAAAGCCATAAGATCAA
                      ____________________________________________________________
consensus ATCTGAGAACATAGCTCCAAGCATCAGAGCCAATTAGATCCCCCAAAGCCATAAGATCAA
 
. : . : . : . : . : . :
rJMSF008L19- AGGCGCACTTGTTTAGCCTGTACATGCTCCCTTTCGTTCCAATATTCGCAATGTACATCT
JMSF020D10+ AGGCGCACTTGTTTAGCCTGTACATGCTCCCTTTCGTTCCAATATTCGCAATGTACATCT
                      ____________________________________________________________
consensus AGGCGCACTTGTTTAGCCTGTACATGCTCCCTTTCGTTCCAATATTCGCAATGTACATCT
 
. : . : . : . : . : . :
rJMSF008L19- GATTCTTAACAAACGACCGAGTCCCAGTCTCTTTATTCCTGATATCGCTTGTGACGGTAG
JMSF020D10+ GATTCTTAACAAACGACCGAGTCCCAGTCTCTTTATTCCTGATATCGCTTGTGACGGTAG
JMSF008L19+ TTGTGACGGTAG
                      ____________________________________________________________
consensus GATTCTTAACAAACGACCGAGTCCCAGTCTCTTTATTCCTGATATCGCTTGTGACGGTAG
 
. : . : . : . : . : . :
rJMSF008L19- GGATTGGTAAAGGGCCGGTGAGCCAAAAGCCATTATCCTCGGCAAGAGACTTCCCTATGC
JMSF020D10+ GGATTGGTAAAGGGCCGGTGAGCCAAAAGCCATTATCCTCGGCAAGAGACTTCCCTATGC
JMSF008L19+ GGATTGGTAAAGGGCCGGTGAGCCAAAAGCCATTATCCTCGGCAAGAGACTTCCCTATGC
                      ____________________________________________________________
consensus GGATTGGTAAAGGGCCGGTGAGCCAAAAGCCATTATCCTCGGCAAGAGACTTCCCTATGC
 
. : . : . : . : . : . :
rJMSF008L19- CGGAGCTTCCGAAAACTGCGATTGAAGCAAGGCCTACTGCTAATCTTCTTTTGGTGACTT
JMSF020D10+ CGGAGCTTCCGAAAACTGCGATTGAAGCAAGGCCTACTGCTAATCTTCTTTTGGTGACTT
JMSF008L19+ CGGAGCTTCCGAAAACTGCGATTGAAGCAAGGCCTACTGCTAATCTTCTTTTGGTGACTT
                      ____________________________________________________________
consensus CGGAGCTTCCGAAAACTGCGATTGAAGCAAGGCCTACTGCTAATCTTCTTTTGGTGACTT
 
. : . : . : . : . : . :
rJMSF008L19- CTGGTAGTGGTTGGTTTTCTTGAATCTCCGGCGCCTTCTTATCGGCAAAGTGGATCGCCG
JMSF020D10+ CTGGTAGTGGTTGGTTTTCTTGAATCTCCGGCGCCTTCTTATCGGCAAAGTGGATCGCCG
JMSF008L19+ CTGGTAGTGGTTGGTTTTCTTGAATCTCCGGCGCCTTCTTATCGGCAAAGTGGATCGCCG
                      ____________________________________________________________
consensus CTGGTAGTGGTTGGTTTTCTTGAATCTCCGGCGCCTTCTTATCGGCAAAGTGGATCGCCG
 
. : . : . : . : . : . :
rJMSF008L19- CCGCCCTCTTCCGCCTTGCCGTGCCGCCGTGAAGCTTG
JMSF020D10+ CCGCCCTCTTCCGCCTTGCCGTGCCGCCGTGAAGCTTGGGATTGAGGGATAGAGCCTCGA
JMSF008L19+ CCGCCCTCTTCCGCCTTGCCGTGCCGCCGTGAAGCTTGGGATTGAGGGATAGAGCCTCGA
                      ____________________________________________________________
consensus CCGCCCTCTTCCGCCTTGCCGTGCCGCCGTGAAGCTTGGGATTGAGGGATAGAGCCTCGA
 
. : . : . : . : . : . :
JMSF020D10+ GTATGAGGTTGAGATTTGGTATGGCAGCCATGGCTAGCTG
JMSF008L19+ GTATGAGGTTGAGATTTGGTATGGCAGCCATGGCTAGCTGGTTTTCAAACTCTGTATGCC
                      ____________________________________________________________
consensus GTATGAGGTTGAGATTTGGTATGGCAGCCATGGCTAGCTGGTTTTCAAACTCTGTATGCC