Previous Contig 005012:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF001K16Sequence560005012 (52)gb:BT001991_16355942e-15Arabidopsis thaliana expressed protein (At1g56220) mRNA, complete cds.>gb:BT0065692005012 (52)gb:BT001991_16355942e-15Arabidopsis thaliana expressed protein (At1g56220) mRNA, complete cds.>gb:BT0065
JMFF004O19Sequence282005012 (52)250005012 (52)
JMFF005K24Sequence429005012 (52)gb:BT001991_16355949e-16Arabidopsis thaliana expressed protein (At1g56220) mRNA, complete cds.>gb:BT0065692005012 (52)gb:BT001991_16355942e-15Arabidopsis thaliana expressed protein (At1g56220) mRNA, complete cds.>gb:BT0065
JMFF009G14Sequence301005012 (52)gb:BT001991_16355945e-15Arabidopsis thaliana expressed protein (At1g56220) mRNA, complete cds.>gb:BT0065582005012 (52)
JMFF013A09Sequence199005012 (52)gb:BT001991_16355943e-10Arabidopsis thaliana expressed protein (At1g56220) mRNA, complete cds.>gb:BT0065734005012 (52)gb:BT001991_16355943e-15Arabidopsis thaliana expressed protein (At1g56220) mRNA, complete cds.>gb:BT0065
JMFF013I24Sequence450005012 (52)gb:BT001991_16355949e-16Arabidopsis thaliana expressed protein (At1g56220) mRNA, complete cds.>gb:BT0065689005012 (52)gb:BT001991_16355948e-08Arabidopsis thaliana expressed protein (At1g56220) mRNA, complete cds.>gb:BT0065
JMFF015A05Sequence447005012 (52)gb:BT001991_16355949e-16Arabidopsis thaliana expressed protein (At1g56220) mRNA, complete cds.>gb:BT0065690005012 (52)gb:BT001991_16355948e-08Arabidopsis thaliana expressed protein (At1g56220) mRNA, complete cds.>gb:BT0065
JMFF017N14Sequence555005012 (52)gb:BT001991_16355941e-15Arabidopsis thaliana expressed protein (At1g56220) mRNA, complete cds.>gb:BT0065695005012 (52)gb:BT001991_16355943e-15Arabidopsis thaliana expressed protein (At1g56220) mRNA, complete cds.>gb:BT0065
JMFF020G02Sequence391005012 (52)gb:BT001991_16355949e-16Arabidopsis thaliana expressed protein (At1g56220) mRNA, complete cds.>gb:BT0065693005012 (52)gb:BT001991_16355942e-15Arabidopsis thaliana expressed protein (At1g56220) mRNA, complete cds.>gb:BT0065
JMFF020P21Sequence554005012 (52)gb:BT001991_16355941e-15Arabidopsis thaliana expressed protein (At1g56220) mRNA, complete cds.>gb:BT0065704005012 (52)gb:BT001991_16355942e-15Arabidopsis thaliana expressed protein (At1g56220) mRNA, complete cds.>gb:BT0065
JMFF021N20Sequence451005012 (52)gb:BT001991_16355949e-16Arabidopsis thaliana expressed protein (At1g56220) mRNA, complete cds.>gb:BT0065698005012 (52)gb:BT001991_16355942e-15Arabidopsis thaliana expressed protein (At1g56220) mRNA, complete cds.>gb:BT0065
JMFF026J11Sequence451005012 (52)gb:BT001991_16355949e-16Arabidopsis thaliana expressed protein (At1g56220) mRNA, complete cds.>gb:BT0065693005012 (52)gb:BT001991_16355942e-15Arabidopsis thaliana expressed protein (At1g56220) mRNA, complete cds.>gb:BT0065
JMFF033E04Sequence534005012 (52)gb:BT001991_16355941e-15Arabidopsis thaliana expressed protein (At1g56220) mRNA, complete cds.>gb:BT0065692005012 (52)gb:BT001991_16355942e-15Arabidopsis thaliana expressed protein (At1g56220) mRNA, complete cds.>gb:BT0065
JMFF036A11Sequence412005012 (52)gb:AY086244_15712992e-13Arabidopsis thaliana clone 22928 mRNA, complete sequence.607005012 (52)
JMFF039B16Sequence439005012 (52)gb:AY086244_15712996e-20Arabidopsis thaliana clone 22928 mRNA, complete sequence.739005012 (52)gb:BT001991_16355943e-15Arabidopsis thaliana expressed protein (At1g56220) mRNA, complete cds.>gb:BT0065
JMFF041O18Sequence631005012 (52)gb:BT001991_16355942e-15Arabidopsis thaliana expressed protein (At1g56220) mRNA, complete cds.>gb:BT0065618005012 (52)
JMFF044G20Sequence622005012 (52)gb:BT001991_16355942e-15Arabidopsis thaliana expressed protein (At1g56220) mRNA, complete cds.>gb:BT0065659005012 (52)
JMFF045P23Sequence623005012 (52)gb:BT001991_16355942e-15Arabidopsis thaliana expressed protein (At1g56220) mRNA, complete cds.>gb:BT0065516005012 (52)
JMFF049L12Sequence577005012 (52)gb:BT001991_16355942e-15Arabidopsis thaliana expressed protein (At1g56220) mRNA, complete cds.>gb:BT0065630005012 (52)
JMFF050H24Sequence546005012 (52)gb:BT001991_16355944e-15Arabidopsis thaliana expressed protein (At1g56220) mRNA, complete cds.>gb:BT0065301005012 (52)
JMFN002H05Sequence556005012 (52)gb:BT001991_16355941e-15Arabidopsis thaliana expressed protein (At1g56220) mRNA, complete cds.>gb:BT0065
JMFN009I05Sequence619005012 (52)gb:BT001991_16355942e-15Arabidopsis thaliana expressed protein (At1g56220) mRNA, complete cds.>gb:BT0065
JMFN025F04Sequence531005012 (52)gb:AY086244_15712991e-23Arabidopsis thaliana clone 22928 mRNA, complete sequence.
JMFN034M23Sequence584005012 (52)
JMFN037B10Sequence239005012 (52)gb:AF515796_18074864e-09Pisum sativum Drm4 mRNA, complete cds.
JMFN037G15Sequence577005012 (52)
JMSF006E08Sequence379005012 (52)gb:BT001991_16355948e-16Arabidopsis thaliana expressed protein (At1g56220) mRNA, complete cds.>gb:BT0065
JMSF008J15Sequence352005012 (52)gb:BT001991_16355948e-16Arabidopsis thaliana expressed protein (At1g56220) mRNA, complete cds.>gb:BT0065699005012 (52)gb:BT001991_16355942e-15Arabidopsis thaliana expressed protein (At1g56220) mRNA, complete cds.>gb:BT0065
JMSF012F03Sequence227005012 (52)gb:AF515795_18074852e-10Pisum sativum Drm3 mRNA, complete cds.788005012 (52)gb:BT001991_16355943e-15Arabidopsis thaliana expressed protein (At1g56220) mRNA, complete cds.>gb:BT0065
JMSF024D08Sequence651006200 (3)gb:AP003256_18264663e-18Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P046734005012 (52)gb:BT001991_16355943e-15Arabidopsis thaliana expressed protein (At1g56220) mRNA, complete cds.>gb:BT0065

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF044G20- CCTTATGGCGGATCACCCTGGAGAGTTTTTTTTT
                      ____________________________________________________________
consensus CCTTATGGCGGATCACCCTGGAGAGTTTTTTTTT
 
. : . : . : . : . : . :
JMFN034M23- ACACAGTTCTTATTCTTCACTATATGTCAAGCAGTAAACGCAAGGCTA
rJMFF004O19- GTTCTTATTCTTC-CTATATGTCAAGCAGTAAACGCAAGGCTA
JMFF004O19+ ACACAGTTCTTATTCTTCACTATATGTCAAGCAGTAAACGCAAGGCTA
rJMFF044G20- TTTTTTCTTTTTACACAGTTCTTATTCTTCACTATATGTCAAGCAGTAAACGCAAGGCTA
rJMFF015A05- AGTTCTTATTCTTCACTATATGTCAAGCAGTAAACGCAAGGCTA
rJMFF013I24- GTTCTTATTCTTCACTATATGTCAAGCAGTAAACGCAAGGCTA
rJMFF041O18- CGCAAGGCTA
rJMFF049L12- TGTCAAGCAGTAAACGCAAGGCTA
JMFN037G15+ CAAGCAGTAAACGCAAGGCTA
rJMFF050H24- CAAGCAGTAAACGCAAGGGTA
rJMFF013A09- CTATATGTCAAGCAGTAAACGCAAGGCTA
rJMFF039B16- CTATATGTCAAGCAGTAAACGCAAGGCTA
rJMSF012F03- GCAGTTAACGCAAGGCTA
                      ____________________________________________________________
consensus TTTTTTCTTTTTACACAGTTCTTATTCTTCACTATATGTCAAGCAGTAAACGCAAGGCTA
 
. : . : . : . : . : . :
JMFN034M23- CATTGAAACATATAACGTTTTAATACAGAGTAAGGATACATAACAGACTTCATTTTTGTT
rJMFF004O19- CATTGAAACATATAACGTTTTAATACAGAGTAAGGATACATAACAGACTCCATTTTTGTT
JMFF004O19+ CATTGAAACATATAACGTTTTAATACAGAGTAAGGATACATAACAGACTCCATTTTTGTT
rJMFF044G20- CATTGAAACATATAACGTTTTAATACAGAGTAAGGATACATAACAGACTCCATTTTTGTT
rJMFF015A05- CATTGAAACATATAACGTTTTAATACAGAGTAAGGATACATAACAGACTCCATTTTTGTT
rJMFF013I24- CATTGAAACATATAACGTTTTAATACAGAGTAAGGATACATAACAGACTCCATTTTTGTT
rJMFF041O18- CATTGAAACATATAACGTTTTAATACAGAGTAAGGATACATAACAGACTCCATTTTTGTT
rJMFF049L12- CATTGAAACATATAACGTTTTAATACAGAGTAAGGATACATAACAGACTCCATTTTTGTT
rJMFF045P23- GAAACATATAACGTTTTAATACAGAGTAAGGATACATAACAGACTCCATTTTTGTT
JMFN037G15+ CATTGAAACATATAACGTTTTAATACAGAGTAAGGATACATAACAGACTCCATTTTTGTT
rJMFF009G14- ATATAACGTTTTAATACAGAGTAAGGATACATAACAGACTCCATTTTTGTT
rJMFF050H24- CATTGAAACATATAACGTTTTAATACAGAGTAAGGATACATAACAGACTCCATTTTTGGT
rJMFF013A09- CATTGAAACATATAACGTTTTAATACAGAGTAAGGATACATAACAGACTCCATTTTTGTT
rJMFF039B16- CATTGAAACATATAACGTTTTAATACAGAGTAAGGATACATAACAGACTCCATTTTTGTT
rJMFF020G02- TATAACGTTTTAATACAGAGTAAGGATACATAACAGACTCCATTTTTGTT
rJMFF020P21- CATTGAAACATATAACGTTTTAATACAGAGTAAGGATACATAACAGACTCCATTTTTGTT
rJMFF005K24- ACGTTTTAATACAGAGTAAGGATACATAACAGACTCCATTTTTGTT
rJMFF021N20- TATAACGTTTTAATACAGAGTAAGGATACATAACAGACTCCATTTTTGTT
rJMFF033E04- TATAACGTTTTAATACAGAGTAAGGATACATAACAGACTCCATTTTTGTT
rJMFF036A11- GAGTAAGGATACATAACAGACTCCATTTTTGTT
rJMFF001K16- TATAACGTTTTAATACAGAGTAAGGATACATAACAGACTCCATTTTTGTT
rJMFF026J11- TATAACGTTTTAATACAGAGTAAGGATACATAACAGACTCCATTTTTGTT
rJMFF017N14- TATAACGTTTTAATACAGAGTAAGGATACATAACAGACTCCATTTTTGTT
rJMSF012F03- CATTGAAACATATAACGTTTTAATACAGAGTAAGGATACATAACAGACTCCATTTTTGTT
rJMSF024D08- AACAGACTCCATTTTTGTT
                      ____________________________________________________________
consensus CATTGAAACATATAACGTTTTAATACAGAGTAAGGATACATAACAGACTCCATTTTTGTT
 
. : . : . : . : . : . :
JMFN034M23- TTTACAACTTGTACCCACACCTCCGCAGACACACAAACAACACAA-GTAAAACGCAAATT
rJMFF004O19- TTTACAACTTGTACCCACACCTCCGCAGACACACAAACAACACAA-GTAAAACGCAAATT
JMFF004O19+ TTTACAACTTGTACCCACACCTCCGCAGACACACAAACAACACAA-GTAAAACGCAAATT
rJMFF044G20- TTTACAACTTGTACCCACACCTCCGCAGACACACAAACAACACAA-GTAAAACGCAAATT
rJMFF015A05- TTTACAACTTGTACCCACACCTCCGCAGACACACAAACAACACAA-GTAAAACGCAAATT
rJMFF013I24- TTTACAACTTGTACCCACACCTCCGCAGACACACAAACAACACAA-GTAAAACGCAAATT
rJMFF041O18- TTTACAACTTGTACCCACACCTCCGCAGACACACAAACAACACAA-GTAAAACGCAAATT
rJMFF049L12- TTTACAACTTGTACCCACACCTCCGCAGACACACAAACAACACAA-GTAAAACGCAAATT
rJMFF045P23- TTTACAACTTGTACCCACACCTCCGCAGACACACAAACAACACAA-GTAAAACGCAAATT
JMFN037G15+ TTTACAACTTGTACCCACACCTCCGCAGACACACAAACAACACAA-GTAAAACGCAAATT
rJMFF009G14- TTTACAACTTGTACCCACACCTCCGCAGACACACAAACAACACAA-GTAAAACGCAAATT
rJMFF050H24- TTTACAACTTGTACCCACACCTCCGCAGACACACAAACAACACAA-GTAAAACGCAAATT
rJMFF013A09- TTTACAACTTGTACCCACACCTCCGCAGACACACAAACAACACAA-GTAAAACGCAAATT
rJMFF039B16- TTTACAACTTGTACCCACACCTCCGCAGACACACAAACAACACAA-GTAAAACGCAAATT
rJMFF020G02- TTTACAACTTGTACCCACACCTCCGCAGACACACAAACAACACAA-GTAAAACGCAAATT
rJMFF020P21- TTTACAACTTGTACCCACACCTCCGCAGACACACAAACAACACAA-GTAAAACGCAAATT
rJMFF005K24- TTTACAACTTGTACCCACACCTCCGCAGACACACAAACAACACAA-GTAAAACGCAAATT
rJMFF021N20- TTTACAACTTGTACCCACACCTCCGCAGACACACAAACAACACAA-GTAAAACGCAAATT
rJMFF033E04- TTTACAACTTGTACCCACACCTCCGCAGACACACAAACAACACAA-GTAAAACGCAAATT
rJMFF036A11- TTTACAACTTGTACCCACACCTCCGCAGACACACAAACAACACAA-GTAAAACGCAAATT
rJMFF001K16- TTTACAACTTGTACCCACACCTCCGCAGACACACAAACAACACAA-GTAAAACGCAAATT
rJMFF026J11- TTTACAACTTGTACCCACACCTCCGCAGACACACAAACAACACAA-GTAAAACGCAAATT
rJMFF017N14- TTTACAACTTGTACCCACACCTCCGCAGACACACAAACAACACAA-GTAAAACGCAAATT
rJMSF012F03- TTTACAACTTGTACCCACACCTCCGCAGACACACAAACAACACAA-GTAAAACGCAAATT
rJMSF024D08- TTTACAACTTGTACCCACACCTCCGCAGACACACAAACAACACAA-GTAAAACGCAATTT
rJMSF008J15- CACCTCCGCAGACACACAAACAACACAAGGTAAAACGCAAATT
                      ____________________________________________________________
consensus TTTACAACTTGTACCCACACCTCCGCAGACACACAAACAACACAA-GTAAAACGCAAATT
 
. : . : . : . : . : . :
JMFN034M23- ACATAACCTATTTAGTATTTACAGACCTAAAAAACAACAGCCACTTAGCAACACACATTA
rJMFF004O19- ACATAACCTATTTAGTATTTACAGACCTAAAAAACAACAGCCACTTAGCAACACACATTA
JMFF004O19+ ACATAACCTATTTAGTATTTACAGACCTAAAAAACAACAGCCACTTAGCAACACACATTA
rJMFF044G20- ACATAACCTATTTAGTATTTACAGACCTAAAAAACAACAGCCACTTAGCAACACACATTA
rJMFF015A05- ACATAACCTATTTAGTATTTACAGACCTAAAAAACAACAGCCACTTAGCAACACACATTA
rJMFF013I24- ACATAACCTATTTAGTATTTACAGACCTAAAAAACAACAGCCACTTAGCAACACACATTA
rJMFF041O18- ACATAACCTATTTAGTATTTACAGACCTAAAAAACAACAGCCACTTAGCAACACACATTA
rJMFF049L12- ACATAACCTATTTAGTATTTACAGACCTAAAAAACAACAGCCACTTAGCAACACACATTA
rJMFF045P23- ACATAACCTATTTAGTATTTACAGACCTAAAAAACAACAGCCACTTAGCAACACACATTA
JMFN037G15+ ACATAACCTATTTAGTATTTACAGACCTAAAAAACAACAGCCACTTAGCAACACACATTA
rJMFF009G14- ACATAACCTATTTAGTATTTACAGACCTAAAAAACAACAGCCACTTANCAACACACATTA
rJMFF050H24- ACATAACCTATTTAGTATTTACAGACCTAAAAAACAACAGCCACTTAGCAACACACATTA
rJMFF013A09- ACATAACCTATTTAGTATTTACAGACCTAAAAAACAACAGCCACTTAGCAACACACATTA
rJMFF039B16- ACATAACCTATTTAGTATTTACAGACCTAAAAAACAACAGCCACTTAGCAACACACATTA
rJMFF020G02- ACATAACCTATTTAGTATTTACAGACCTAAAAAACAACAGCCACTTAGCAACACACATTA
rJMFF020P21- ACATAACCTATTTAGTATTTACAGACCTAAAAAACAACAGCCACTTAGCAACACACATTA
rJMFF005K24- ACATAACCTATTTAGTATTTACAGACCTAAAAAACAACAGCCACTTAGCAACACACATTA
rJMFF021N20- ACATAACCTATTTAGTATTTACAGACCTAAAAAACAACAGCCACTTAGCAACACACATTA
rJMFF033E04- ACATAACCTATTTAGTATTTACAGACCTAAAAAACAACAGCCACTTAGCAACACACATTA
rJMFF036A11- ACATAACCTATTTAGTATTTACAGACCTAAAAAACAACAGCCACTTAGCAACACACATTA
rJMFF001K16- ACATAACCTATTTAGTATTTACAGACCTAAAAAACAACAGCCACTTAGCAACACACATTA
rJMFF026J11- ACATAACCTATTTAGTATTTACAGACCTAAAAAACAACAGCCACTTAGCAACACACATTA
rJMFF017N14- ACATAACCTATTTAGTATTTACAGACCTAAAAAACAACAGCCACTTAGCAACACACATTA
rJMSF012F03- ACATAACCTATTTAGTATTTACAGACCTAAAAAACAACAGCCACTTAGCAACACACATTA
JMFF041O18+ ACAGACCTAAAAAACAACAGCCACTTAGCAACACACATTA
JMFF045P23+ AAAAAACAACAGCCACTTAGCAACACACATTA
JMFF044G20+ AAAAAACAACAGCCACTTAGCAACACACATTA
rJMSF024D08- ACATAACCTATTTAGTATTTACAGACCTAAAAAACAACAGCCACTTAGCAACACACATTA
JMFN009I05+ TTTACAGACCTAAAAAACAACAGCCACTTAGCAACACACATTA
rJMSF008J15- ACATAACCTATTTAGTATTTACAGACCTAAAAAACAACAGCCACTTAGCAACACACATTA
                      ____________________________________________________________
consensus ACATAACCTATTTAGTATTTACAGACCTAAAAAACAACAGCCACTTAGCAACACACATTA
 
. : . : . : . : . : . :
JMFN034M23- TTCTTAATTAACCACCCAAAAAACATGAACTCTCCACTACATTCAACAAGGTACAGTAAA
rJMFF004O19- TTCTTAATTAACCACCCAAAAAACA
JMFF004O19+ TTCTTAATTAACCACCCAAAAAACA
rJMFF044G20- TTCTTAATTAACCACCCAAAAAACATGAACTCTCCACTACATTCAACAAGGTACAGTAAA
rJMFF015A05- TTCTTAATTAACCACCCAAAAAACATGAACTCTCCACTACATTCAACAAGGTACAGTAAA
rJMFF013I24- TTCTTAATTAACCACCCAAAAAACATGAACTCTCCACTACATTCAACAAGGTACAGTAAA
rJMFF041O18- TTCTTAATTAACCACCCAAAAAACATGAACTCTCCACTACATTCAACAAGGTACAGTAAA
rJMFF049L12- TTCTTAATTAACCACCCAAAAAACATGAACTCTCCACTACATTCAACAAGGTACAGTAAA
rJMFF045P23- TTCTTAATTAACCACCCAAAAAACATGAACTCTCCACTACATTCAACAAGGTACAGTAAA
JMFN037G15+ TTCTTAATTAACCACCCAAAAAACATGAACTCTCCACTACATTCAACAAGGTACAGTAAA
rJMFF009G14- TTCTTAATTAACCACCCAAAAAACATGAACTCTCCACTACATTCAACAAGGTACAGTAAA
rJMFF050H24- TTCTTAATTAACCACCCAAAAAACATGAACTCTCCACTACATTCAACAAGGGACAGTAAA
rJMFF013A09- TTCTTAATTAACCACCCAAAAAACATGAACTCTCCACTACATTCAACAAGGTACAGTAAA
rJMFF039B16- TTCTTAATTAACCACCCAAAAAACATGAACTCTCCACTACATTCAACAAGGTACAGTAAA
rJMFF020G02- TTCTTAATTAACCACCCAAAAAACATGAACTCTCCACTACATTCAACAAGGTACAGTAAA
rJMFF020P21- TTCTTAATTAACCACCCAAAAAACATGAACTCTCCACTACATTCAACAAGGTACAGTAAA
rJMFF005K24- TTCTTAATTAACCACCCAAAAAACATGAACTCTCCACTACATTCAACAAGGTACAGTAAA
rJMFF021N20- TTCTTAATTAACCACCCAAAAAACATGAACTCTCCACTACATTCAACAAGGTACAGTAAA
rJMFF033E04- TTCTTAATTAACCACCCAAAAAACATGAACTCTCCACTACATTCAACAAGGTACAGTAAA
rJMFF036A11- TTCTTAATTAACCACCCAAAAAACATGAACTCTCCACTACATTCAACAAGGTACAGTAAA
rJMFF001K16- TTCTTAATTAACCACCCAAAAAACATGAACTCTCCACTACATTCAACAAGGTACAGTAAA
rJMFF026J11- TTCTTAATTAACCACCCAAAAAACATGAACTCTCCACTACATTCAACAAGGTACAGTAAA
rJMFF017N14- TTCTTAATTAACCACCCAAAAAACATGAACTCTCCACTACATTCAACAAGGTACAGTAAA
rJMSF012F03- TTCTTAATTAACCACCCAAAAAACATGAACTCTCCACTACATTCAACAAGGTACAGTAAA
JMFF041O18+ TTCTTAATTAACCACCCAAAAAACATGAACTCTCCACTACATTCAACAAGGTACAGTAAA
JMFF049L12+ CCCAAAAAACATGAACTCTCCACTACATTCAACAAGGTACAGTAAA
JMFF050H24+ CTCTCCACTACATTCAACAAGGTACAGTAAA
JMFF045P23+ TTCTTAATTAACCACCCAAAAAACATGAACTCTCCACTACATTCAACAAGGTACAGTAAA
JMFN002H05+ CCAAAAAACATGAACTCTCCACTACATTCAACAAGGTACAGTAAA
JMFF044G20+ TTCTTAATTAACCACCCAAAAAACATGAACTCTCCACTACATTCAACAAGGTACAGTAAA
JMFN025F04+ CTACATTCAACAAGGTACAGTAAA
JMFF001K16+ ACTACATTCAACAAGGTACAGTAAA
JMFF020P21+ TTCAACAAGGTACAGTAAA
JMFF017N14+ ATTCAACAAGGTACAGTAAA
rJMSF024D08- TTCTTAATTAACCACCCAAAAAACATGAACTCTCCACTACATTCAACAAGGTACAGTAAA
JMFN009I05+ TTCTTAATTAACCACCCAAAAAACATGAACTCTCCACTACATTCAACAAGGTACAGTAAA
rJMSF008J15- TTCTTAATTAACCACCCAAAAAACATGAACTCTCCACTACATTCAACAAGGTACAGTAAA
                      ____________________________________________________________
consensus TTCTTAATTAACCACCCAAAAAACATGAACTCTCCACTACATTCAACAAGGTACAGTAAA
 
. : . : . : . : . : . :
JMFN034M23- CCTCAAAGAACAAAAAGAGGCCGGCTGCCGGCTGGCCTCATAGCTCACACGTCGTAAGGA
rJMFF044G20- CCTCAGAGAACAAAAAGAGGCCGGCTGCCGGCTGGCCTCATAGCTCACACGTCGTAAGGA
rJMFF015A05- CCTCAGAGAACAAAAAGAGGCCGGCTGCCGGCTGGCCTCATAGCTCACACGTCGTAAGGA
rJMFF013I24- CCTCAGAGAACAAAAAGAGGCCGGCTGCCGGCTGGCCTCATAGCTCACACGTCGTAAGGA
rJMFF041O18- CCTCAGAGAACAAAAAGAGGCCGGCTGCCGGCTGGCCTCATAGCTCACACGTCGTAAGGA
rJMFF049L12- CCTCAGAGAACAAAAAGAGGCCGGCTGCCGGCTGGCCTCATAGCTCACACGTCGTAAGGA
rJMFF045P23- CCTCAAAGAACAAAAAGAGGCCGGCTGCCGGCTGGCCTCATAGCTCACACGTCGTAAGGA
JMFN037G15+ CCTCAGAGAACAAAAAGAGGCCGGCTGCCGGCTGGCCTCATAGCTCACACGTCGTAAGGA
rJMFF009G14- CCTCAGAGAACAAAAAGAGGCCGGCTGCCGGCTGGCCTCATAGCTCACACGTCGTAAGGA
rJMFF050H24- CCTCAGAAAACAAAAAAAAGGCGGCTGCCGGGTGGCCTC
rJMFF013A09- CCTCAGAGAACAAAAAGAGGCCGGCTGCCGGCTGGCCTCATAGCTCACACGTCGTAAGGA
rJMFF039B16- CCTCAGAGAACAAAAAGAGGCCGGCTGCCGGCTGGCCTCATAGCTCACACGTCGTAAGGA
rJMFF020G02- CCTCAGAGAACAAAAAGAGGCCGGCTGCCGGCTGGCCTCATAGCTCACACGTCGTAAGGA
rJMFF020P21- CCTCAGAGAACAAAAAGAGGCCGGCTGCCGGCTGGCCTCATAGCTCACACGTCGTAAGGA
rJMFF005K24- CCTCAGAGAACAAAAAGAGGCCGGCTGCCGGCTGGCCTCATAGCTCACACGTCGTAAGGA
rJMFF021N20- CCTCAGAGAACAAAAAGAGGCCGGCTGCCGGCTGGCCTCATAGCTCACACGTCGTAAGGA
rJMFF033E04- CCTCAGAGAACAAAAAGAGGCCGGCTGCCGGCTGGCCTCATAGCTCACACGTCGTAAGGA
rJMFF036A11- CCTCAGAGAACAAAAAGAGGCCGGCTGCCGGCTGGCCTCATAGCTCACACGTCGTAAGGA
rJMFF001K16- CCTCAGAGAACAAAAAGAGGCCGGCTGCCGGCTGGCCTCATAGCTCACACGTCGTAAGGA
rJMFF026J11- CCTCAGAGAACAAAAAGAGGCCGGCTGCCGGCTGGCCTCATAGCTCACACGTCGTAAGGA
rJMFF017N14- CCTCAGAGAACAAAAAGAGGCCGGCTGCCGGCTGGCCTCATAGCTCACACGTCGTAAGGA
rJMSF012F03- CCTCAGAGAACAAAAAGAGGCCGGCTGCCGGCTGGCCTCATAGCTCACACGTCGTAAGGA
JMFF041O18+ CCTCAGAGAACAAAAAGAGGCCGGCTGCCGGCTGGCCTCATAGCTCACACGTCGTAAGGA
JMFF049L12+ CCTCAGAGAACAAAAAGAGGCCGGCTGCCGGCTGGCCTCATAGCTCACACGTCGTAAGGA
JMFF050H24+ CCTCAGAGAACAAAAAGAGGCCGGCTGCCGGCTGGCCTCATAGCTCACACGTCGTAAGGA
JMFF045P23+ CCTCAGAGAACAAAAAGAGGCCGGCTGCCGGCTGGCCTCATAGCTCACACGTCGTAAGGA
JMFN002H05+ CCTCAGAGAACAAAAAGAGGCCGGCTGCCGGCTGGCCTCATAGCTCACACGTCGTAAGGA
JMFF044G20+ CCTCAGAGAACAAAAAGAGGCCGGCTGCCGGCTGGCCTCATAGCTCACACGTCGTAAGGA
JMFN025F04+ CCTCAGAGAACAAAAAGAGGCCGGCTGCCGGCTGGCCTCATAGCTCACACGTCGTAAGGA
JMFF001K16+ CCTCAGAGAACAAAAAGAGGCCGGCTGCCGGCTGGCCTCATAGCTCACACGTCGTAAGGA
JMFF020P21+ CCTCAGAGAACAAAAAGAGGCCGGCTGCCGGCTGGCCTCATAGCTCACACGTCGTAAGGA
JMFF033E04+ CTCAGAGAACAAAAAGAGGCCGGCTGCCGGCTGGCCTCATAGCTCACACGTCGTAAGGA
JMFF017N14+ CCTCAGAGAACAAAAAGAGGCCGGCTGCCGGCTGGCCTCATAGCTCACACGTCGTAAGGA
rJMSF024D08- CCTCAGAGAACAAAAAGAGGCCGGCTGCCGGCTGGCCTCATAGCTCACACGTCGTAAGGA
JMFN009I05+ CCTCAGAGAACAAAAAGAGGCCGGCTGCCGGCTGGCCTCATAGCTCACACGTCGTAAGGA
rJMSF008J15- CCTCAGAGAACAAAAAGAGGCCGGCTGCCGGCTGGCCTCATAGCTCACACGTCGTAAGGA
                      ____________________________________________________________
consensus CCTCAGAGAACAAAAAGAGGCCGGCTGCCGGCTGGCCTCATAGCTCACACGTCGTAAGGA
 
. : . : . : . : . : . :
JMFN034M23- GGAGGAGCGTTTCTGGGTCCAATCCCTCTAGCATT-CTCGTAGGCGAACGATGCAGACCT
rJMFF044G20- GGAGGAGCGTTTCTGGGTCCAATCCCTCTAGCATT-CTCGTAGGCGAACGATGCAGACCT
rJMFF015A05- GGAGGAGCGTTTCTGGGTCCAATCCCTCTAGCATT-CTCGTAGGCGAACGATGCAGACCT
rJMFF013I24- GGAGGAGCGTTTCTGGGTCCAATCCCTCTAGCATT-CTCGTAGGCGAACGATGCAGACCT
rJMFF041O18- GGGGGAGCGTTTCTGGGTCCAATCCCTCTAGCATT-CTCGTAGGCGAACGATGCAGACCT
rJMFF049L12- GGAGGAGCGTTTCTGGGTCCAATCCCTCTAGCATT-CTCGTAGGCGAACGATGCAGACCT
rJMFF045P23- GGAGGAGCGTTTCTGGGTCCAATCCCTCTAGCATT-CTCGTAGGCGAACGATGCAGACCT
JMFN037G15+ GGAGGAGCGTTTCTGGGTCCAATCCCTCTAGCATT-CTCGTAGGCGAACGATGCAGACCT
rJMFF009G14- GGAGGAGCGTTTCTGGGNCCAATCCCTCTAGCATT-CTCGTAGGCGAACGATGCAGACCT
rJMFF013A09- GGAGGAGCGTTTCTGGGTCCAATCCCTCTAGCATT-CTCGTAGGCGAACGATGCAGACCT
rJMFF039B16- GGAGGAGCGTTTCTGGGTCCAATCCCTCTAGCATT-CTCGTAGGCGAACGATGCAGACCT
rJMFF020G02- GGAGGAGCGTTTCTGGGTCCAATCCCTCTAGCATT-CTCGTAGGCGAACGATGCAGACCT
rJMFF020P21- GGAGGAGCGTTTCTGGGTCCAATCCCTCTAGCATT-CTCGTAGGCGAACGATGCAGACCT
rJMFF005K24- GGAGGAGCGTTTCTGGGTCCAATCCCTCTAGCATT-CTCGTAGGCGAACGATGCAGACCT
rJMFF021N20- GGAGGAGCGTTTCTGGGTCCAATCCCTCTAGCATT-CTCGTAGGCGAACGATGCAGACCT
rJMFF033E04- GGAGGAGCGTTTCTGGGTCCAATCCCTCTAGCATT-CTCGTAGGCGAACGATGCAGACCT
rJMFF036A11- GGAGGAGCGTTTCTGGGTCCAATCCCCCTAGCATT-CTCGTAGGCGAACGATGCAGACCT
rJMFF001K16- GGAGGAGCGTTTCTGGGTCCAATCCCTCTAGCATT-CTCGTAGGCGAACGATGCAGACCT
rJMFF026J11- GGAGGAGCGTTTCTGGGTCCAATCCCTCTAGCATT-CTCGTAGGCGAACGATGCAGACCT
rJMFF017N14- GGAGGAGCGTTTCTGGGTCCAATCCCTCTAGCATTGCTCGTAGGCGAACGATGCAGACCT
rJMSF012F03- GGAGGAGCGTTTCTGGGTCCAATCCCTCTAGCATT-CTCGTAGGCGAACGATGCAGACCT
JMFF041O18+ GGGGGAGCGTTTCTGGGTCCAATCCCTCTAGCATT-CTCGTAGGCGAACGATGCAGACCT
JMFF049L12+ GGAGGAGCGTTTCTGGGTCCAATCCCTCTAGCATT-CTCGTAGGCGAACGATGCAGACCT
JMFF050H24+ GGAGGAGCGTTTCTGGGTCCAATCCCTCTAGCATT-CTCGTAGGCGAACGATGCAGACCT
JMFF045P23+ GGAGGAGCGTTTCTGGGTCCAATCCCTCTAGCATT-CTCGTAGGCGAACGATGCAGACCT
JMFN002H05+ GGAGGAGCGTTTCTGGGTCCAATCCCTCTAGCATT-CTCGTAGGCGAACGATGCAGACCT
JMFF044G20+ GGAGGAGCGTTTCTGGGTCCAATCCCTCTAGCATT-CTCGTAGGCGAACGATGCAGACCT
JMFN025F04+ GGAGGAGCGTTTCTGGGTCCAATCCCTCTAGCATT-CTCGTAGGCGAACGATGCAGACCT
JMFF015A05+ TCTAGCATT-CTCGTAGGCGAACGATGCAGACCT
JMFF005K24+ GGCGAACGATGCAGACCT
JMFF001K16+ GGAGGAGCGTTTCTGGGTCCAATCCCTCTAGCATT-CTCGTAGGCGAACGATGCAGACCT
JMFF020P21+ GGAGGAGCGTTTCTGGGTCCAATCCCTCTAGCATT-CTCGTAGGCGAACGATGCAGACCT
JMFF033E04+ GGAGGAGCGTTTCTGGGTCCAATCCCTCTAGCATT-CTCGTAGGCGAACGATGCAGACCT
JMFF026J11+ CCTCTAGCATT-CTCGTAGGCGAACGATGCAGACCT
JMFF017N14+ GGAGGAGCGTTTCTGGGTCCAATCCCTCTAGCATT-CTCGTAGGCGAACGATGCAGACCT
JMFF021N20+ CCTCTAGCATT-CTCGTAGGCGAACGATGCAGACCT
JMFF039B16+ TCGTAGGCGACCGATGCAGACCT
JMFF013I24+ CTCTAGCATT-CTCGTAGGCGAACGATGCAGACCT
rJMSF024D08- GGAGGAGCGTTTCTGGGTCCAATCCCTCTAGCATT-CTCGTAGGCGAACGATGCAGACCT
JMFN009I05+ GGAGGAGCGTTTCTGGGTCCAATCCCTCTAGCATT-CTCGTAGGCGAACGATGCAGACCT
rJMSF008J15- GGAGGAGCGTTTCTGGGTCCAATCCCTCTAGCATT-CTCGTAGGCGAACGATGCAGACCT
                      ____________________________________________________________
consensus GGAGGAGCGTTTCTGGGTCCAATCCCTCTAGCATT-CTCGTAGGCGAACGATGCAGACCT
 
. : . : . : . : . : . :
JMFN034M23- CCTCCTGAACCGATACGCCTCCCTTCCTCCTGCACCGGAGAAAGGAGATACCGGAGGAGT
rJMFF044G20- CCTCCTGAACCGATACGCCTCCCTTCCTCCTGCACCGGAGAAAGGAGATACCGGAGGAGT
rJMFF015A05- CCTCCTGAACCGATACGCCTCCCTTCCTCCTGCACCGGAGAAAGGAGATACCGGAGGAGT
rJMFF013I24- CCTCCTGAACCGATACGCCTCCCTTCCTCCTGCACCGGAGAAAGGAGATACCGGAGGAGT
rJMFF041O18- CCTCCTGAACCGATACGCCTCCCTTCCTCCTGCACCGGAGAAAGGAGATACCGGAGGAGT
rJMFF049L12- CCTCCTGAACCGATACGCCTCCCTTCCTCCTGCACCGGAGAAAGGAGATACCGGAGGAGT
rJMFF045P23- CCTCCTGAACCGATACGCCTCCCTTCCTCCTGCACCGGAGAAAGGAGATACCGGAGGAGT
JMFN037G15+ CCTCCTGAACCGATACGCCTCCCTTCCTCCTGCACCGGAGAAAGGAGATACCGGAGGAGT
rJMFF009G14- CCTCCTGAACCGATACGCCTCCCTTCCTCCTGCACCGGAGAAAGGAGATACCGGAGGAGT
rJMFF013A09- CCTCCTGAACCGATACGCCTCCCTTCCTCCTGCACCGGAGAAAGGAGATACCGGAGGAGT
rJMFF039B16- CCTCCTGAACCGATACGCCTCCCTTCCTCCTGCACCGGAGAAAGGAGATACCGGAGGAGT
rJMFF020G02- CCTCCTGAACCGATACGCCTCCCTTCCTCCTGCACCGGAGAAAGGAGATACCGGAGGAGT
rJMFF020P21- CCTCCTGAACCGATACGCCTCCCTTCCTCCTGCACCGGAGAAAGGAGATACCGGAGGAGT
rJMFF005K24- CCTCCTGAACCGATACGCCTCCCTTCCTCCTGCACCGGAGAAAGGAGATACCGGAGGAGT
rJMFF021N20- CCTCCTGAACCGATACGCCTCCCTTCCTCCTGCACCGGAGAAAGGAGATACCGGAGGAGT
rJMFF033E04- CCTCCTGAACCGATACGCCTCCCTTCCTCCTGCACCGGAGAAAGGAGATACCGGAGGAGT
rJMFF036A11- CCTCCTGAACCGATACGCCTCCCTTCCTCCTGCACCGGAGAAAGGAGATACCGGAGGAGT
rJMFF001K16- CCTCCTGAACCGATACGCCTCCCTTCCTCCTGCACCGGAGAAAGGAGATACCGGAGGAGT
rJMFF026J11- CCTCCTGAACCGATACGCCTCCCTTCCTCCTGCACCGGAGAAAGGAGATACCGGAGGAGT
rJMFF017N14- CCTCCTGAACCGATACGCCTCCCTTCCTCCTGCACCGGAGAAAGGAGATACCGGAGGAGT
rJMSF012F03- CCTCCTGAACCGATACGCCTCCCTTCCTCCTGCACCGGAGAAAGGAGATACCGGAGGAGT
JMFF041O18+ CCTCCTGAACCGATACGCCTCCCTTCCTCCTGCACCGGAGAAAGGAGATACCGGAGGAGT
JMFF049L12+ CCTCCTGAACCGATACGCCTCCCTTCCTCCTGCACCGGAGAAAGGAGATACCGGAGGAGT
JMFF050H24+ CCTCCTGAACCGATACGCCTCCCTTCCTCCTGC----------------ACCGGAGGAGT
JMFF045P23+ CCTCCTGAACCGATACGCCTCCCTTCCTCCTGCACCGGAGAAAGGAGATACCGGAGGAGT
JMFN002H05+ CCTCCTGAACCGATACGCCTCCCTTCCTCCTGCACCGGAGAAAGGAGATACCGGAGGAGT
JMFF044G20+ CCTCCTGAACCGATACGCCTCCCTTCCTCCTGCACCGGAGAAAGGAGATACCGGAGGAGT
JMFN025F04+ CCTCGTGAACCGATACGCCTCCCTTCCTCCTGCTCCGGAGAAAGGAGATACCGGAGGAGT
JMFF015A05+ CCTCCTGAACCGATACGCCTCCCTTCCTCCTGCACCGGAGAAAGGAGATACCGGAGGAGT
JMFF005K24+ CCTCCTGAACCGATACGCCTCCCTTCCTCCTGCACCGGAGAAAGGAGATACCGGAGGAGT
JMFF001K16+ CCTCCTGAACCGATACGCCTCCCTTCCTCCTGCACCGGAGAAAGGAGATACCGGAGGAGT
JMFF020P21+ CCTCCTGAACCGATACGCCTCCCTTCCTCCTGCACCGGAGAAAGGAGATACCGGAGGAGT
JMFF033E04+ CCTCCTGAACCGATACGCCTCCCTTCCTCCTGCACCGGAGAAAGGAGATACCGGAGGAGT
JMFF026J11+ CCTCCTGAACCGATACGCCTCCCTTCCTCCTGCACCGGAGAAAGGAGATACCGGAGGAGT
JMFF017N14+ CCTCCTGAACCGATACGCCTCCCTTCCTCCTGCACCGGAGAAAGGAGATACCGGAGGAGT
JMFF021N20+ CCTCCTGAACCGATACGCCTCCCTTCCTCCTGCACCGGAGAAAGGAGATACCGGAGGAGT
JMFF039B16+ CCTCCTGAACCGATACGCCTCCCTTCCTCCTGCACCGGAGAAAGGAGATACCGGAGGAGT
JMFF020G02+ CCTCCTGCACCGGAGAAAGGAGATACCGGAGGAGT
JMFF013I24+ CCTCCTGAACCGATACGCCTCCCTTCCTCCTGCACCGGAGAAAGGAGATACCGGAGGAGT
JMFF036A11+ GAACCGATACGCCTCCCTTCCTCCTGCACCGGAGAAAGGAGATACCGGAGGAGT
JMSF006E08+ AGAAAGGAGATACCGGAGGAGT
rJMSF024D08- CCTCCTGAACCGATACGCCTCCCTTCCTCCTGCACCGGAGAAAGGAGATACCGGAGGAGT
JMFN009I05+ CCTCCTGAACCGATACGCCTCCCTTCCTCCTGCACCGGAGAAAGGAGATACCGGAGGAGT
rJMSF008J15- CCTCCTGAACCGATACGCCTCCCTTCCTCCTGCACCGGAGAAAGGAGATACCGGAGGAGT
                      ____________________________________________________________
consensus CCTCCTGAACCGATACGCCTCCCTTCCTCCTGCACCGGAGAAAGGAGATACCGGAGGAGT
 
. : . : . : . : . : . :
JMFN034M23- CGACCCCGCCGGCGACGGGGATGGCGATGCCGGAGGCGAGTCTTTGTTCTGATTACGAGG
rJMFF044G20- CGACCCCGCCGGCGACGGGGATGGCGATGCCGGAGGCGAGTCTTTGTTCTGATTACGAGG
rJMFF015A05- CGACCCCGCCGGCGACGGGGATGGCGATGCCGGAGGCGAGTCTTTGTTCTGATTACGAGG
rJMFF013I24- CGACCCCGCCGGCGACGGGGATGGCGATGCCGGAGGCGAGTCTTTGTTCTGATTACGAGG
rJMFF041O18- CGACCCCGCCGGCGACGGGGATGGCGATGCCGGAGGCGAGTCTTTGTTCTGATTACGAGG
rJMFF049L12- CGACCCCGCCGGCGACGGGGATGGCGATGCCGGAGGCGAGTCTTTGTTCTGATTACGAGG
rJMFF045P23- CGACCCCGCCGGCGACGGGGATGGCGATGCCGGAGGCGAGTCTTTGTTCTGATTACGAGG
JMFN037G15+ CGACCCCGCCGGCGACGGGGATGGCGATGCCGGAGGCGAGTCTTTGTTCTGATTACGAGG
rJMFF009G14- CGACCCCGCCGGCGACGGGGATGGCGATGCCGGAGGCGAGTCTTTGTTCTGATTACGAGG
rJMFF013A09- CGACCCCGCCGGCGACGGGGATGGCGATGCCGGAGGCGAGTCTTTGTTCTGATTACGAGG
rJMFF039B16- CGACCCCGCCGGCGACGGGGATGGCGATGCCGGAGGCGAGTCTTTGTTCTGATTACGAGG
rJMFF020G02- CGACCCCGCCGGCGACGGGGATGGCGATGCCGGAGGCGAGTCTTTGTTCTGATTACGAGG
rJMFF020P21- CGACCCCGCCGGCGACGGGGATGGCGATGCCGGAGGCGAGTCTTTGTTCTGATTACGAGG
rJMFF005K24- CGACCCCGCCGGCGACGGGGATGGCGATGCCGGAGGCGAGTCTTTGTTCTGATTACGAGG
rJMFF021N20- CGACCCCGCCGGCGACGGGGATGGCGATGCCGGAGGCGAGTCTTTGTTCTGATTACGAGG
rJMFF033E04- CGACCCCGCCGGCGACGGGGATGGCGATGCCGGAGGCGAGTCTTTGTTCTGATTACGAGG
rJMFF036A11- CGACCCCGCCGGCGACGGGGATGGCGATGCCGGAGGCGAGTCTTTGTTCTGATTACGAGG
rJMFF001K16- CGACCCCGCCGGCGACGGGGATGGCGATGCCGGAGGCGAGTCTTTGTTCTGATTACGAGG
rJMFF026J11- CGACCCCGCCGGCGACGGGGATGGCGATGCCGGAGGCGAGTCTTTGTTCTGATTACGAGG
rJMFF017N14- CGACCCCGCCGGCGACGGGGATGGCGATGCCGGAGGCGAGTCTTTGTTCTGATTACGAGG
rJMSF012F03- CGACCCCGCCGGCGACGGGGATGGCGATGCCGGAGGCGAGTCTTTGTTCTGATTACGAGG
JMFF041O18+ CGACCCCGCCGGCGACGGGGATGGCGATGCCGGAGGCGAGTCTTTGTTCTGATTACGAGG
JMFF049L12+ CGACCCCGCCGGCGACGGGGATGGCGATGCCGGAGGCGAGTCTTTGTTCTGATTACGAGG
JMFF050H24+ CGACCCCGCCGGCGACGGGGATGGCGATGCCGGAGGCGAGTCTTTGTTCTGATTACGAGG
JMFF045P23+ CGACCCCGCCGGCGACGGGGATGGCGATGCCGGAGGCGAGTCTTTGTTCTGATTACGAGG
JMFN002H05+ CGACCCCGCCGGCGACGGGGATGGCGATGCCGGAGGCGAGTCTTTGTTCTGATTACGAGG
JMFF044G20+ CGACCCCGCCGGCGACGGGGATGGCGATGCCGGAGGCGAGTCTTTGTTCTGATTACGAGG
JMFN025F04+ CGACCCCGCCGGCGACGGGGATGGCGATGCCGGAGGCGAGTCTTTGTTCTGATTACGAGG
JMFF015A05+ CGACCCCGCCGGCGACGGGGATGGCGATGCCGGAGGCGAGTCTTTGTTCTGATTACGAGG
JMFF005K24+ CGACCCCGCCGGCGACGGGGATGGCGATGCCGGAGGCGAGTCTTTGTTCTGATTACGAGG
JMFF001K16+ CGACCCCGCCGGCGACGGGGATGGCGATGCCGGAGGCGAGTCTTTGTTCTGATTACGAGG
JMFF020P21+ CGACCCCGCCGGCGACGGGGATGGCGATGCCGGAGGCGAGTCTTTGTTCTGATTACGAGG
JMFF033E04+ CGACCCCGCCGGCGACGGGGATGGCGATGCCGGAGGCGAGTCTTTGTTCTGATTACGAGG
JMFF026J11+ CGACCCCGCCGGCGACGGGGATGGCGATGCCGGAGGCGAGTCTTTGTTCTGATTACGAGG
JMFF017N14+ CGACCCCGCCGGCGACGGGGATGGCGATGCCGGAGGCGAGTCTTTGTTCTGATTACGAGG
JMFF021N20+ CGACCCCGCCGGCGACGGGGATGGCGATGCCGGAGGCGAGTCTTTGTTCTGATTACGAGG
JMFF039B16+ CGACCCCGCCGGCGACGGGGATGGCGATGCCGGAGGCGAGTCTTTGTTCTGATTACGAGG
JMFF020G02+ CGACCCCGCCGGCGACGGGGATGGCGATGCCGGAGGCGAGTCTTTGTTCTGATTACGAGG
JMFF013I24+ CGACCCCGCCGGCGACGGGGATGGCGATGCCGGAGGCGAGTCTTTGTTCTGATTACGAGG
JMFF036A11+ CGACCCCGCCGGCGACGGGGATGGCGATGCCGGAGGCGAGTCTTTGTTCTGATTACGAGG
JMSF006E08+ CGACCCCGCCGGCGACGGGGATGGCGATGCCGGAGGCGAGTCTTTGTTCTGATTACGAGG
JMFF009G14+ CGAGG
rJMSF024D08- CGACCCCGCCGGCGACGGGGATGGCGATGCCGGAGGCGAGTCTTTGTTCTGATTACGAGG
JMFN009I05+ CGACCCCGCCGGCGACGGGGATGGCGATGCCGGAGGCGAGTCTTTGTTCTGATTACGAGG
rJMSF008J15- CGACCCCGCCGGCGACGGGGATGGCGATGCCGGAGGCGAGTCTTTGTTCTGATTACGAGG
JMSF008J15+ CCGCCGGCGACGGGGATGGCGATGCCGGAGGCGAGTCTTTGTTCTGATTACGAGG
                      ____________________________________________________________
consensus CGACCCCGCCGGCGACGGGGATGGCGATGCCGGAGGCGAGTCTTTGTTCTGATTACGAGG
 
. : . : . : . : . : . :
JMFN034M23- AGACTTTAGTATCATGA
rJMFF044G20- AGACTTTAGTATCATGATACTTCTC-GTCACTTTAATTGCATCGTCACTTGTGTCTACGG
rJMFF015A05- AGACTTTAGTATCATGATACTTCTC-GTCACTTTAATTGCATCGTCACTTGTGTCTACGG
rJMFF013I24- AGACTTTAGTATCATGATACTTCTC-GTCACTTTAATTGCATCGTCACTTGTGTCTACGG
rJMFF041O18- AGACTTTAGTATCATGATACTTCTC-GTCACTTTAATTGCATCGTCACTTGTGTCTACGG
rJMFF049L12- AGACTTTAGTATCATGATACTTCTC-GTCACTTTAATTGCATCGTCACTTGTGTCTACGG
rJMFF045P23- AGACTTTAGTATCATGATACTTCTC-GTCACTTTAATTGCATC
JMFN037G15+ AGACTTTAGTATCATGATACTTCTC-GTCACTTTAATTGCATCGTCACTTGTGTCTACGG
rJMFF009G14- AGACTTTAGTATCATGATACTTCTC-GTCACTTTAATTGCATCGTCACTTGTGTCTACGG
rJMFF013A09- AGACTTTAGTATCATGATACTTCTC-GTCACTTTAATTGCATCGTCACTTGTGTCTACGG
rJMFF039B16- AGACTTTAGTATCATGATACTTCTC-GTCACTTTAATTGCATCGTCACTTGTGTCTACGG
rJMFF020G02- AGACTTTAGTATCATGATACTTCTC-GTCACTTTAATTGCATCGTCACTTGTGTCTACGG
rJMFF020P21- AGACTTTAGTATCATGATACTTCTC-GTCACTTTAATTGCATCGTCACTTGTGTCTACGG
rJMFF005K24- AGACTTTAGTATCATGATACTTCTC-GTCACTTTAATTGCATCGTCACTTGTGTCTACGG
rJMFF021N20- AGACTTTAGTATCATGATACTTCTC-GTCACTTTAATTGCATCGTCACTTGTGTCTACGG
rJMFF033E04- AGACTTTAGTATCATGATACTTCTC-GTCACTTTAATTGCATCGTCACTTGTGTCTACGG
rJMFF036A11- AGACTTTAGTATCATGATACTTCTC-GTCACTTTAATTGCATCGTCACTTGTGTCTACGG
rJMFF001K16- AGACTTTAGTATCATGATACTTCTC-GTCACTTTAATTGCATCGTCACTTGTGTCTACGG
rJMFF026J11- AGACTTTAGTATCATGATACTTCTC-GTCACTTTAATTGCATCGTCACTTGTGTCTACGG
rJMFF017N14- AGACTTTAGTATCATGATACTTCTC-GTCACTTTAATTGCATCGTCACTTGTGTCTACGG
rJMSF012F03- AGACTTTAGTATCATGATACTTCTC-GTCACTTTAATTGCATCGTCACTTGTGTCTACGG
JMFF041O18+ AGACTTTAGTATCATGATACTTCTC-GTCACTTTAATTGCATCGTCACTTGTGTCTACGG
JMFF049L12+ AGACTTTAGTATCATGATACTTCTC-GTCACTTTAATTGCATCGTCACTTGTGTCTACGG
JMFF050H24+ AGACTTTAGTATCATGATACTTCTC-GTCACTTTAATTGCATCGTCACTTGTGTCTACGG
JMFF045P23+ AGACTTTAGTATCATGATACTTCTC-GTCACTTTAATTGCATCGTCACTTGTGTCTACGG
JMFN002H05+ AGACTTTAGTATCATGATACTTCTC-GTCACTTTAATTGCATCGTCACTTGTGTCTACGG
JMFF044G20+ AGACTTTAGTATCATGATACTTCTC-GTCACTTTAATTGCATCGTCACTTGTGTCTACGG
JMFN037B10+ TGATACTTCTCGGTCACTTTAATTGCATCGTCACTTGTGTGTCCGG
JMFN025F04+ AGACTTTAGTATCATGATACTTCTC-GTCACTTTAATTGCATCGTCACTTGTGTCTACGG
JMFF015A05+ AGACTTTAGTATCATGATACTTCTC-GTCACTTTAATTGCATCGTCACTTGTGTCTACGG
JMFF005K24+ AGACTTTAGTATCATGATACTTCTC-GTCACTTTAATTGCATCGTCACTTGTGTCTACGG
JMFF001K16+ AGACTTTAGTATCATGATACTTCTC-GTCACTTTAATTGCATCGTCACTTGTGTCTACGG
JMFF020P21+ AGACTTTAGTATCATGATACTTCTC-GTCACTTTAATTGCATCGTCACTTGTGTCTACGG
JMFF033E04+ AGACTTTAGTATCATGATACTTCTC-GTCACTTTAATTGCATCGTCACTTGTGTCTACGG
JMFF026J11+ AGACTTTAGTATCATGATACTTCTC-GTCACTTTAATTGCATCGTCACTTGTGTCTACGG
JMFF017N14+ AGACTTTAGTATCATGATACTTCTC-GTCACTTTAATTGCATCGTCACTTGTGTCTACGG
JMFF021N20+ AGACTTTAGTATCATGATACTTCTC-GTCACTTTAATTGCATCGTCACTTGTGTCTACGG
JMFF039B16+ AGACTTTAGTATCATGATACTTCTC-GTCACTTTAATTGCATCGTCACTTGTGTCTACGG
JMFF020G02+ AGACTTTAGTATCATGATACTTCTC-GTCACTTTAATTGCATCGTCACTTGTGTCTACGG
JMFF013I24+ AGACTTTAGTATCATGATACTTCTC-GTCACTTTAATTGCATCGTCACTTGTGTCTACGG
JMFF036A11+ AGACTTTAGTATCATGATACTTCTC-GTCACTTTAATTGCATCGTCACTTGTGTCTACGG
JMSF006E08+ AGACTTTAGTATCATGATACTTCTC-GTCACTTTAATTGCATCGTCACTTGTGTCTACGG
JMFF009G14+ AGACTTTAGTATCATGATACTTCTC-GTCACTTTAATTGCATCGTCACTTGTGTCTACGG
rJMSF024D08- AGACTTTAGTATCATGATACTTCTC-GTCACTTTAATTGCATCGTCACTTGTGTCTACGG
JMFN009I05+ AGACTTTAGTATCATGATACTTCTC-GTCACTTTAATTGCATCGTCACTTGTGTCTACGG
rJMSF008J15- AGACTTTAGTATCATGATACTTCTC-GTCACTTTAATTGCATCGTCACTTGTGTCTACGG
JMSF008J15+ AGACTTTAGTATCATGATACTTCTC-GTCACTTTAATTGCATCGTCACTTGTGTCTACGG
                      ____________________________________________________________
consensus AGACTTTAGTATCATGATACTTCTC-GTCACTTTAATTGCATCGTCACTTGTGTCTACGG
 
. : . : . : . : . : . :
rJMFF044G20- TGAGTGATCTCGTATTCGGATTTGGATT
rJMFF015A05- TGAGTGATCTCGTATTCGGATTTGGATTCTGACCCTCTGATTCCTT-GCCGGAATTAGGA
rJMFF013I24- TGAGTGATCTCGTATTCGGATTTGGATTCTGACCCTCTGATTCCTT-GCCGGAATTAGGA
rJMFF041O18- TGAGTGATCTCGTATTCGGATTTGGATTCTGACCCTCTGATTCCTT-GCCGGAATTAGGA
rJMFF049L12- TGAGTGATCTCGTATTCGGATTTGGATTCTGACCCTCTGATTC
JMFN037G15+ TGAGTGATCTCGTATTCGG
rJMFF009G14- TGAGTGATCTCGTATTCGGATTTGGATTCTGACCCTCTGATTCCTT-GCCGGAAT
rJMFF013A09- TGAGTGATCTCGTATTCGGATTTGGATTCTGACCCTCTGATTCCTT-GCCGGAATTAGGA
rJMFF039B16- TGAGTGATCTCGTATTCGGATTTGGATTCTGACCCTCTGATTCCTT-GCCGGAATTAGGA
rJMFF020G02- TGAGTGATCTCGTATTCGGATTTGGATTCTGACCCTCTGATTCCTT-GCCGGAATTAGGA
rJMFF020P21- TGAGTGATCTCGTATTCGGATTTGGATTCTGACCCTCTGATTCCTT-GCCGGAATTAGGA
rJMFF005K24- TGAGTGATCTCGTATTCGGATTTGGATTCTGACCCTCTGATTCCTT-GCCGGAATTAGGA
rJMFF021N20- TGAGTGATCTCGTATTCGGATTTGGATTCTGACCCTCTGATTCCTT-GCCGGAATTAGGA
rJMFF033E04- TGAGTGATCTCGTATTCGGATTTGGATTCTGACCCTCTGATTCCTT-GCCGGAATTAGGA
rJMFF036A11- TGAGTGATCTCGTATTCGGATTTGGATTCTGACCCTCTGATTCCTTAGCCGGAATTAGGA
rJMFF001K16- TGAGTGATCTCGTATTCGGATTTGGATTCTGACCCTCTGATTCCTT-GCCGGAATTAGGA
rJMFF026J11- TGAGTGATCTCGTATTCGGATTTGGATTCTGACCCTCTGATTCCTT-GCCGGAATTAGGA
rJMFF017N14- TGAGTGATCTCGGATTCGGATTTGGATTCTGACCCTCTGATTCCTT-GCCGGAATTAGGA
rJMSF012F03- TGAGTGATCTCGTATTCGGATTTGGATTCTGACTCTCTGATTCCTT-GCCGGAATTAGGA
JMFF041O18+ TGAGTGATCTCGTATTCGGATTTGGATTCTGACCCTCTGATTCCTT-GCCGGAATTAGGA
JMFF049L12+ TGAGTGATCTCGTATTCGGATTTGGATTCTGACCCTCTGATTCCTT-GCCGGAATTAGGA
JMFF050H24+ TGAGTGATCTCGTATTCGGATTTGGATTCTGACCCTCTGATTCCTT-GCCGGAATTAGGA
JMFF045P23+ TGAGTGATCTCGTATTCGGATTTGGATTCTGACCCTCTGATTCCTT-GCCGGAATTAGGA
JMFN002H05+ TGAGTGATCTCGTATTCGGATTTGGATTCTGACCCTCTGATTCCTT-GCCGGAATTAGGA
JMFF044G20+ TGAGTGATCTCGTATTCGGATTTGGATTCTGACCCTCTGATTCCTT-GCCGGAATTAGGA
JMFN037B10+ TGAGTGATCTCGTATTTGGATTAGGAGTGGAACCCTGGTATTCCTT-GCCGGAAGTAGGG
JMFN025F04+ TGAGTGATCTCGTATTCGGATTTGGATTCTGACCCTGTGATTCCTT-GCCGGAATTAGGA
JMFF015A05+ TGAGTGATCTCGTATTCGGATTTGGATTCTGACCCTCTGATTCCTT-GCCGGAATTAGGA
JMFF005K24+ TGAGTGATCTCGTATTCGGATTTGGATTCTGACCCTCTGATTCCTT-GCCGGAATTAGGA
JMFF001K16+ TGAGTGATCTCGTATTCGGATTTGGATTCTGACCCTCTGATTCCTT-GCCGGAATTAGGA
JMFF020P21+ TGAGTGATCTCGTATTCGGATTTGGATTCTGACCCTCTGATTCCTT-GCCGGAATTAGGA
JMFF033E04+ TGAGTGATCTCGTATTCGGATTTGGATTCTGACCCTCTGATTCCTT-GCCGGAATTAGGA
JMFF026J11+ TGAGTGATCTCGTATTCGGATTTGGATTCTGACCCTCTGATTCCTT-GCCGGAATTAGGA
JMFF017N14+ TGAGTGATCTCGTATTCGGATTTGGATTCTGACCCTCTGATTCCTT-GCCGGAATTAGGA
JMFF021N20+ TGAGTGATCTCGTATTCGGATTTGGATTCTGACCCTCTGATTCCTT-GCCGGAATTAGGA
JMFF039B16+ TGAGTGATCTCGTATTCGGATTTGGATTCTGACCCTCTGATTCCTT-GCCGGAATTAGGA
JMFF020G02+ TGAGTGATCTCGTATTCGGATTTGGATTCTGACCCTCTGATTCCTT-GCCGGAATTAGGA
JMFF013I24+ TGAGTGATCTCGTATTCGGATTTGGATTCTGACCCTCTGATTCCTT-GCCGGAATTAGGA
JMFF036A11+ TGAGTGATCTCGTATTCGGATTTGGATTCTGACCCTCTGATTCCTTAGCCGGAATTAGGA
JMSF006E08+ TGAGTGATCTCGTATTCGGATTTGGATTCTGACCCTCTGATTCCTT-GCCGGAATTAGGA
JMFF009G14+ TGAGTGATCTCGTATTCGGATTTGGATTCTGACCCTCTGATTCCTT-GCCGGAATTAGGA
JMFF013A09+ GATTCCTT-GCCGGAANTAGGA
rJMSF024D08- TGAGTGATCTCGTATTCGGATTTGGATTCTGACCCTCTGATTCCTT-GCCGGAATTAGGA
JMFN009I05+ TGAGTGATCTCGTATTCGGATTTGGATTCTGACCCTCTGATTCCTT-GCCGGAATTAGGA
rJMSF008J15- TGAGTGATCTCGTATTCGGATTTGGATTCTGACCCTCTGATTCCTT-GCCGGAATTAGGA
JMSF012F03+ GTATTCGGATTTGGATTCTGACTCTCTGATTCCTT-GCCGGAATTAGGA
JMSF008J15+ TGAGTGATCTCGTATTCGGATTTGGATTCTGACCCTCTGATTCCTT-GCCGGAATTAGGA
                      ____________________________________________________________
consensus TGAGTGATCTCGTATTCGGATTTGGATTCTGACCCTCTGATTCCTT-GCCGGAATTAGGA
 
. : . : . : . : . : . :
rJMFF015A05- CGGAAATTAAAGGTAGAAAACTTCCTTAGCTTCCCGAGACCGTTTTCCGG
rJMFF013I24- CGGAAATTAAAGGTAGAAAACTTCCTTAGCTTCCCGAGACCGTTTTCCGG
rJMFF041O18- CGGAAATTAAAG
rJMFF013A09- CGGAAATTAAAGGTAGAAAACTTCCTTAGCTTCCCGAGACCGTTTTCCGGCGGGGGACCG
rJMFF039B16- CGGAAATTAAAGGTAGAAAACTTCCTTAGCTTCCCGAGACCGTTTTCCGGCGGGGGACCG
rJMFF020G02- CGGAAATTAAAGGTAGAAAACTTCCTTAGCTTCCCGAGACCGTTTTCCGGCGGGGGACCG
rJMFF020P21- CGGAAATTAAAGGTAGAAAACTTCCTTAGCTTCCCGAGACCGTTTTCCGGCGGGGGACCG
rJMFF005K24- CGGAAATTAAAGGTAGAAAACTTCCTTAGCTTCCCGAGACCGTTTTCCGGCGGGGGACCG
rJMFF021N20- CGGAAATTAAAGGTAGAAAACTTCCTTAGCTTCCCGAGACCGTTTTCCGGCGGGGGACCG
rJMFF033E04- CGGAAATTAAAGGTAGAAAACTTCCTTAGCTTCCCGAGACCGTTTTCCGGCGGGGGACCG
rJMFF036A11- CGGAAATTAAAGGTAGAAAACTTCCTTAGCTTCCCGA
rJMFF001K16- CGGAAATTAAAGGTAGAAAACTTCCTTAGCTTCCCGAGACCGTTTTCCGGCGGGGGACCG
rJMFF026J11- CGGAAATTAAAGGTAGAAAACTTCCTTAGCTTCCCGAGACCGTTTTCCGGCGGGGGACCG
rJMFF017N14- CGGAAATTAAAGGTAGAAAACTTCCTTAGCTTCCCGAGACCGTTTTCCGGCGGGGGACCG
rJMSF012F03- CGGAAATTAAAGGTAGAAAACTTCCTTAGCTTCCCGAGACCGTTTTCCGGCGGGGGACCG
JMFF041O18+ CGGAAATTAAAGGTAGAAAACTTCCTTAGCTTCCCGAGACCGTTTTCCGGCGGGGGACCG
JMFF049L12+ CGGAAATTAAAGGTAGAAAACTTCCTTAGCTTCCCGAGACCGTTTTCCGGCGGGGGACCG
JMFF050H24+ CGGAAATTAAAGGTAGAAAACTTCCTTAGCTTCCCGAGACCGTTTTCCGGCGGGGGACCG
JMFF045P23+ CGGAAATTAAAGGTAGAAAACTTCCTTAGCTTCCCGAGACCGTTTTCCGGCGGGGGACCG
JMFN002H05+ CGGAAATTAAAGGTAGAAAACTTCCTTAGCTTCCCGAGACCGTTTTCCGGCGGGGGACCG
JMFF044G20+ CGGAAATTAAAGGTAGAAAACTTCCTTAGCTTCCCGAGACCGTTTTCCGGCGGGGGACCG
JMFN037B10+ CGGAAATTAGAGGTAGAAAACTTCATTAGTTTCCCGAGACCGTTTTCCGGCGGGGGACCG
JMFN025F04+ CGGAAATTAAAGGTAGAAAACTTCCTTAGCTTCCCGAGACCGTTTTCCGGCGGGGGACCG
JMFF015A05+ CGGAAATTAAAGGTAGAAAACTTCCTTAGCTTCCCGAGACCGTTTTCCGGCGGGGGACCG
JMFF005K24+ CGGAAATTAAAGGTAGAAAACTTCCTTAGCTTCCCGAGACCGTTTTCCGGCGGGGGACCG
JMFF001K16+ CGGAAATTAAAGGTAGAAAACTTCCTTAGCTTCCCGAGACCGTTTTCCGGCGGGGGACCG
JMFF020P21+ CGGAAATTAAAGGTAGAAAACTTCCTTAGCTTCCCGAGACCGTTTTCCGGCGGGGGACCG
JMFF033E04+ CGGAAATTAAAGGTAGAAAACTTCCTTAGCTTCCCGAGACCGTTTTCCGGCGGGGGACCG
JMFF026J11+ CGGAAATTAAAGGTAGAAAACTTCCTTAGCTTCCCGAGACCGTTTTCCGGCGGGGGACCG
JMFF017N14+ CGGAAATTAAAGGTAGAAAACTTCCTTAGCTTCCCGAGACCGTTTTCCGGCGGGGGACCG
JMFF021N20+ CGGAAATTAAAGGTAGAAAACTTCCTTAGCTTCCCGAGACCGTTTTCCGGCGGGGGACCG
JMFF039B16+ CGGAAATTAAAGGTAGAAAACTTCCTTAGCTTCCCGAGACCGTTTTCCGGCGGGGGACCG
JMFF020G02+ CGGAAATTAAAGGTAGAAAACTTCCTTAGCTTCCCGAGACCGTTTTCCGGCGGGGGACCG
JMFF013I24+ CGGAAATTAAAGGTAGAAAACTTCCTTAGCTTCCCGAGACCGTTTTCCGGCGGGGGACCG
JMFF036A11+ CGGAAATTAAAGGTAGAAAACTTCCTTAGCTTCCCGAGACCGTTTTCCGGCGGGGGACCG
JMSF006E08+ CGGAAATTAAAGGTAGAAAACTTCCTTAGCTTCCCGAGACCGTTTTCCGGCGGGGGACCG
JMFF009G14+ CGGAAATTAAAGGTAGAAAACTTCCTTAGCTTCCCGAGACCGTTTTCCGGCGGGGGACCG
JMFF013A09+ CGGAAATTAAAGGTAGAAAACTTCCTTAGCTTCCCGAGACCGTTTTCCGGCGGGGGACCG
rJMSF024D08- CGGAAATTAAAGGTAGAAAACTTCCTTAGCTTCCCGAGACCGTTTTCCGGCGGGGGACCG
JMFN009I05+ CGGAAATTAAAGGTAGAAAACTTCCTTAGCTTCCCGAGACCGTTTTCCGGCGGGGGACCG
rJMSF008J15- CGGAAATTAAAGGTAGAAAACTTCCTTAGCTTCCCGAGACCGTTTTCCGGCGGGGGACCG
JMSF012F03+ CGGAAATTAAAGGTAGAAAACTTCCTTAGCTTCCCGAGACCGTTTTCCGGCGGGGGACCG
JMSF008J15+ CGGAAATTAAAGGTAGAAAACTTCCTTAGCTTCCCGAGACCGTTTTCCGGCGGGGGACCG
                      ____________________________________________________________
consensus CGGAAATTAAAGGTAGAAAACTTCCTTAGCTTCCCGAGACCGTTTTCCGGCGGGGGACCG
 
. : . : . : . : . : . :
rJMFF013A09- GCAACGGTGTCGTCCCAGAGCTGATTAAGCAAGCTCATGGCGC
rJMFF039B16- GCAACGGTGTCGTCCCAGAGCTGATTAAGCAAGCTCATGGCGCAATTT
rJMFF020G02- GCAACGGTGTCGTCCCAGAGCTGATTAAGCAAGCTCATGGCGCAATT
rJMFF020P21- GCAACGGTGTCGTCCCAGAGCTGATTAAGCAAGCTCATGGCGCAATTT
rJMFF005K24- GCAACGGTGTCGTCCCAGAGCTGATTAAGCAAGCTCATGGCGCAATTTAG
rJMFF021N20- GCAACGGTGTCGTCCCAGAGCTGATTAAGCAAGCTCATGGCGCAATTTAGGG
rJMFF033E04- GCAACGGTGTCGTCCCAGAGCTGATTAAGCAAGCTCATGGCGCAAT
rJMFF001K16- GCAACGGTGTCGTCCCAGAGCTGATTAAGCAAGCTCATGGCGCAAT
rJMFF026J11- GCAACGGTGTCGTCCCAGAGCTGATTAAGCAAGCTCATGGCGCAAT
rJMFF017N14- GCAACGGTGTCGTCCCAGAGCTGATTAAGCAAGCTCATGGCGCAATTT
rJMSF012F03- GCAACGGTGTCGTCCCAGAGCTGATTAAGCAAGCTCATGGCGCAATTTAGGGAGACG-GC
JMFF041O18+ GCAACGGTGTCGTCCCAGAGCTGATTAAGCAAGCTCATGGCGCAATTTAGGGAGACG-GC
JMFF049L12+ GCAACGGTGTCGTCCCAGAGCTGATTAAGCAAGCTCATGGCGCAATTTAGGGAGACG-GC
JMFF050H24+ GCAACGGTGTCGTCCCAGAGCTGATTAAGCAAGATCATGGCGCAATTTAGGGAGACG-GC
JMFF045P23+ GCAACGGTGTCGTCCCAGAGCTGATTAAGCAAGCTCATGGCGCAATTTAGGGAGACG-GC
JMFN002H05+ GCAACGGTGTCGTCCCAGAGCTGATTAAGCAAGCTCATGGCGCAATTTAGGGAGACG-GC
JMFF044G20+ GCAACGGTGTCGTCCCAGAGCTGATTAAGCAAGCTCATGGCGCAATTTAGGGAGACG-GC
JMFN037B10+ GCAACGGTGTCGTCCCAGAATTGATTAAGCAAGCTCATGGCGCAATTTAGGGAGTCGTGC
JMFN025F04+ GCAACGGTGTCGTCCCAGAGCTGATTAAGCAAGCTCATGGCGCAATTTAGGGAGACG-GC
JMFF015A05+ GCAACGGTGTCGTCCCAGAGCTGATTAAGCAAGCTCATGGCGCAATTTAGGGAGACG-GC
JMFF005K24+ GCAACGGTGTCGTCCCAGAGCTGATTAAGCAAGCTCATGGCGCAATTTAGGGAGACG-GC
JMFF001K16+ GCAACGGTGTCGTCCCAGAGCTGATTAAGCAAGCTCATGGCGCAATTTAGGGAGACG-GC
JMFF020P21+ GCAACGGTGTCGTCCCAGAGCTGATTAAGCAAGCTCATGGCGCAATTTAGGGAGACG-GC
JMFF033E04+ GCAACGGTGTCGTCCCAGAGCTGATTAAGCAAGCTCATGGCGCAATTTAGGGAGACG-GC
JMFF026J11+ GCAACGGTGTCGTCCCAGAGCTGATTAAGCAAGCTCATGGCGCAATTTAGGGAGACG-GC
JMFF017N14+ GCAACGGTGTCGTCCCAGAGCTGATTAAGCAAGCTCATGGCGCAATTTAGGGAGACG-GC
JMFF021N20+ GCAACGGTGTCGTCCCAGAGCTGATTAAGCAAGCTCATGGCGCAATTTAGGGAGACG-GC
JMFF039B16+ GCAACGGTGTCGTCCCAGAGCTGATTAAGCAAGCTCATGGCGCAATTTAGGGAGACG-GC
JMFF020G02+ GCAACGGTGTCGTCCCAGAGCTGATTAAGCAAGCTCATGGCGCAATTTAGGGAGACG-GC
JMFF013I24+ GCAACGGTGTCGTCCCAGAGCTGATTAAGCAAGCTCATGGCGCAATTTAGGGAGACG-GC
JMFF036A11+ GCAACGGTGTCGTCCCAGAGCTGATTAAGCAAGCTCATGGCGCAATTTAGGGAGACG-GC
JMSF006E08+ GCAACGGTGTCGTCCCAGAGCTGATTAAGCAAGCTCATGGCGCAATTTAGGGAGACG-GC
JMFF009G14+ GCANCGGTGTCGTCCCAGAGNTGATTAAGCAAGCTCATGGCGCAATTTAGGGAGACG-GC
JMFF013A09+ GCAACGGTGTCGTCCCAGAGCTGATTAAGCAAGCTCATGGCGCAATTTAGGGAGACG-GC
rJMSF024D08- GCAACGGTGTCGTCCCAGAGCTGATTAAGCAAGCTCATGGCGCAATTTAGGGAGACG-GC
JMFN009I05+ GCAACGGTGTCGTCCCAGAGCTGATTAAGCAAGCTCATGGCGCAATTTAGGGAGACG-GC
rJMSF008J15- GCAACGGTGTCGTCCCAGAGCTGATTAAGCAAGCTCATGGCGCAATTTAGGGAGACG-GC
JMSF012F03+ GCAACGGTGTCGTCCCAGAGCTGATTAAGCAAGCTCATGGCGCAATTTAGGGAGACG-GC
JMSF008J15+ GCAACGGTGTCGTCCCAGAGCTGATTAAGCAAGCTCATGGCGCAATTTAGGGAGACG-GC
                      ____________________________________________________________
consensus GCAACGGTGTCGTCCCAGAGCTGATTAAGCAAGCTCATGGCGCAATTTAGGGAGACG-GC
 
. : . : . : . : . : . :
rJMSF012F03- GCAGGTTAATCAGTGCGTATAACACACAGTACTGAGTTTCCCGGGCGCTCTCTAT
JMFF041O18+ GCAGGTTAATCAGTGCGTATAACACACAGTACTGAGTTTCCCGGGCGCTCTCTAT
JMFF049L12+ GCAGGTTAATCAGTGCGTATAACACACAGTACTGAGTTTCCCGGGCGCTCTCTA
JMFF050H24+ GCAGGTTAATCAGTGCGTATAACACACAGTACTGAGTTTCCCGGGCGCTCTCTAT
JMFF045P23+ GCAGGTTAATCAGTGCGTATAACACACAGTACTGAGTTTCCCGGGCGCTCTCTAT
JMFN002H05+ GCAGGTTAATCAGTGCGTATAACACACAGTACTGA
JMFF044G20+ GCAGGTTAATCAGTGCGTATAACACACAGTACTGAGTTTCCCGGGCGCTCTCT
JMFN037B10+ GCAGGGTAATCAGT
JMFN025F04+ GCAGGTTAATCAGTGCGTATAACACACAGT
JMFF015A05+ GCAGGTTAATCAGTGCGTATAACACACAGTACTGAGTTTCCCGGGCGCTCTC
JMFF005K24+ GCAGGTTAATCAGTGCGTATAACACACAGTACTGAGTTTCCCGGGCGCTCTCT
JMFF001K16+ GCAGGTTAATCAGTGCGTATAACACACAGTACTGAGTTTCCCGGGCGCTCTCTATAG
JMFF020P21+ GCAGGTTAATCAGTGCGTATAACACACAGTACTGAGTTTCCCGGGCGCTCTCTATAGAG
JMFF033E04+ GCAGGTTAATCAGTGCGTATAACACACAGTACTGAGTTTCCCGGGCGCTCTCTATAGAG
JMFF026J11+ GCAGGTTAATCAGTGCGTATAACACACAGTACTGAGTTTCCCGGGCGCTCTCTATAGAG
JMFF017N14+ GCAGGTTAATCAGTGCGTATAACACACAGTACTGAGTTTCCCGGGCGCTCTCTATAGAG
JMFF021N20+ GCAGGTTAATCAGTGCGTATAACACACAGTACTGAGTTTCCCGGGCGCTCTCTATAGAG
JMFF039B16+ GCAGGTTAATCAGTGCGTATAACACACAGTACTGAGTTTCCCGGGCGCTCTCTATAGAG
JMFF020G02+ GCAGGTTAATCAGTGCGTATAACACACAGTACTGAGTTTCCCGGGCGCTCTCTATAGAG
JMFF013I24+ GCAGGTTAATCAGTGCGTATAACACACAGTACTGAGTTTCCCGGGCGCTCTCTATAGAG
JMFF036A11+ GCAGGTTAATCAGTGCGTATAACACACAGTACTGAGTTTCCCGGGCGCTCTCTATAGAG
JMSF006E08+ GCAGGTTAATCAGTGCGTATAACACACAGTACTGAGTTTCCCGGGCGCTCTCTATAGAG
JMFF009G14+ GCAGGTTAATCAGTGNGTATAACACACAGTANTGAGTTTCCCGGGCGCTCTNTATAGAG
JMFF013A09+ GCAGGTTAATCAGTGCGTATAACACACAGTACTGAGTTTCCCGGGCGCTCTCTATAGAG
rJMSF024D08- GCAGGTTAATCAGTGCGTATAACACACAGTACTGAGTTTCCCGGGCGCTCTCTATAGAGC
JMFN009I05+ GCAGGTTAATCAGTGCGTATAACACACAGTACTGAGTTTC
rJMSF008J15- GCAGGTTAATCAGTGCGTATAACACACAGTACTGAGTTTCCGGGGCGCTCTCTATAGAGC
JMSF012F03+ GCAGGTTAATCAGTGCGTATAACACACAGTACTGAGTTTCCCGGGCGCTCTCTATAGAGC
JMSF008J15+ GCAGGTTAATCAGTGCGTATAACACACAGTACTGAGTTTCCGGGGCGCTCTCTATAGAGC
                      ____________________________________________________________
consensus GCAGGTTAATCAGTGCGTATAACACACAGTACTGAGTTTCCCGGGCGCTCTCTATAGAGC