Previous Contig 005003:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF008I16Sequence324005003 (3)708005003 (3)gb:AY072412_15672297e-44Arabidopsis thaliana putative protein (At5g11450) mRNA, complete cds.>gb:AY11470
JMSF049N06Sequence686005003 (3)gb:AY072412_15672296e-56Arabidopsis thaliana putative protein (At5g11450) mRNA, complete cds.>gb:AY11470

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF008I16- AATTGAAGAATACATAGATAGGGAAAAGATAAAGCA
                      ____________________________________________________________
consensus AATTGAAGAATACATAGATAGGGAAAAGATAAAGCA
 
. : . : . : . : . : . :
rJMSF008I16- GCAACTTGCAAACTACCATGTTGGTGTTCGTAGTGATGATGCTCCTGTATTCATCAAAAC
                      ____________________________________________________________
consensus GCAACTTGCAAACTACCATGTTGGTGTTCGTAGTGATGATGCTCCTGTATTCATCAAAAC
 
. : . : . : . : . : . :
rJMSF008I16- CTCAAACTACCCTTACTCTATTCAATTTAAATATCTGAGCCAGATAGACGAAAAAAAATA
                      ____________________________________________________________
consensus CTCAAACTACCCTTACTCTATTCAATTTAAATATCTGAGCCAGATAGACGAAAAAAAATA
 
. : . : . : . : . : . :
rJMSF008I16- CCTCCCCGAATGGTCTTCACATCCAAGATGTTCCACCATTGCAAGAGTTGCTGCTTTCGT
                      ____________________________________________________________
consensus CCTCCCCGAATGGTCTTCACATCCAAGATGTTCCACCATTGCAAGAGTTGCTGCTTTCGT
 
. : . : . : . : . : . :
rJMSF008I16- TCTGGTGCATCACTCGGATATACAATAGCAGGAGCCAAGGAAAAAGGAATATATCATAAA
                      ____________________________________________________________
consensus TCTGGTGCATCACTCGGATATACAATAGCAGGAGCCAAGGAAAAAGGAATATATCATAAA
 
. : . : . : . : . : . :
rJMSF008I16- TCGCATGATCGACCCAAAGTTACATTATATTTGGCAAGTGTAGTTTCCTTTGCTGGCTCC
                      ____________________________________________________________
consensus TCGCATGATCGACCCAAAGTTACATTATATTTGGCAAGTGTAGTTTCCTTTGCTGGCTCC
 
. : . : . : . : . : . :
rJMSF008I16- ATCTCCGCCATCAACATTTAATTTTGTTCCAAGCAACACTGAGAGAGATAATCTCTTCTT
                      ____________________________________________________________
consensus ATCTCCGCCATCAACATTTAATTTTGTTCCAAGCAACACTGAGAGAGATAATCTCTTCTT
 
. : . : . : . : . : . :
rJMSF008I16- CACCAAAATCTCCAAGGATCCTTGTATGGAGGAACATAGTTTTCTGTAGGAGGGAGAAGC
                      ____________________________________________________________
consensus CACCAAAATCTCCAAGGATCCTTGTATGGAGGAACATAGTTTTCTGTAGGAGGGAGAAGC
 
. : . : . : . : . : . :
rJMSF008I16- CGGAAAGAAGCCACGCTCTTTTCTAAGAACGGTCCCATTTGGTCCCATTGCTTGCCAAGT
                      ____________________________________________________________
consensus CGGAAAGAAGCCACGCTCTTTTCTAAGAACGGTCCCATTTGGTCCCATTGCTTGCCAAGT
 
. : . : . : . : . : . :
rJMSF008I16- GCTGATGCACTAAGAGTATACAAGTAACCATCTCGTTCAGCTGTTGAAGCAACGTAGTGG
                      ____________________________________________________________
consensus GCTGATGCACTAAGAGTATACAAGTAACCATCTCGTTCAGCTGTTGAAGCAACGTAGTGG
 
. : . : . : . : . : . :
rJMSF008I16- CGGAAAAGATTCGACTCTAGAGCCGTTTTGGTTGGTGATTTGCGAACAAGGTACTCAAAA
JMSF049N06+ GGTGATTTGCGAACAAGGTACTCAAAA
                      ____________________________________________________________
consensus CGGAAAAGATTCGACTCTAGAGCCGTTTTGGTTGGTGATTTGCGAACAAGGTACTCAAAA
 
. : . : . : . : . : . :
rJMSF008I16- TACCAATATGCATCACCATCAATTTTGGAAGAATGTGCATCAAGAAGTGAACTTTCAGCC
JMSF049N06+ TACCAATATGCATCACCATCAATTTTGGAAGAATGTGCATCAAGAAGTGAACTTTCAGCC
                      ____________________________________________________________
consensus TACCAATATGCATCACCATCAATTTTGGAAGAATGTGCATCAAGAAGTGAACTTTCAGCC
 
. : . : . : . : . : . :
rJMSF008I16- AACCGTTGAGTT
JMSF049N06+ AACCGTTGAGTTGAGGTTACCCGCAAAGCAGATTTATCAGCTAAAACAGAGTCAGCGACA
                      ____________________________________________________________
consensus AACCGTTGAGTTGAGGTTACCCGCAAAGCAGATTTATCAGCTAAAACAGAGTCAGCGACA
 
. : . : . : . : . : . :
JMSF049N06+ TCCTTAGCACTCCAGCTACTTTTCTCTGACTTTAGGAATTGTGAATTGAGTGGACCTATC
                      ____________________________________________________________
consensus TCCTTAGCACTCCAGCTACTTTTCTCTGACTTTAGGAATTGTGAATTGAGTGGACCTATC
 
. : . : . : . : . : . :
JMSF049N06+ GTAACAGAAATAATAAGATTATCAATGATGTCAACTCTTTCAGACACAATGCGGAGGCGT
                      ____________________________________________________________
consensus GTAACAGAAATAATAAGATTATCAATGATGTCAACTCTTTCAGACACAATGCGGAGGCGT
 
. : . : . : . : . : . :
JMSF049N06+ GCATCAGGTGACAGTGGTGCAGCCGATGAATAACGCTCTGGTTTTCTGGATTCAACCCAT
                      ____________________________________________________________
consensus GCATCAGGTGACAGTGGTGCAGCCGATGAATAACGCTCTGGTTTTCTGGATTCAACCCAT
 
. : . : . : . : . : . :
JMSF049N06+ TTGAAGACAAATCCTTTGGAAGGAAGCTCTGTGGGGTATATATAGGAATAAGAATTAGTA
JMSF008I16+ TATATATAGGAATAAGAATTAGTA
                      ____________________________________________________________
consensus TTGAAGACAAATCCTTTGGAAGGAAGCTCTGTGGGGTATATATAGGAATAAGAATTAGTA
 
. : . : . : . : . : . :
JMSF049N06+ TTATCAACAAATGAGGCCATTTTCACATCTTCTTCAGCACTTGAGCTTAAAGATGGGAAA
JMSF008I16+ TTATCAACAAATGAGGCCATTTTCACATCTTCTTCAGCACTTGAGCTTAAAGATGGGAAA
                      ____________________________________________________________
consensus TTATCAACAAATGAGGCCATTTTCACATCTTCTTCAGCACTTGAGCTTAAAGATGGGAAA
 
. : . : . : . : . : . :
JMSF049N06+ ACCAGTGAAAGTGAAGATAAGCCAGTGAACACCAAATCCCTTCTTGAAACCCCATTGTGC
JMSF008I16+ ACCAGTGAAAGTGAAGATAAGCCAGTGAACACCAAATCCCTTCTTGAAACCCCATTGTGC
                      ____________________________________________________________
consensus ACCAGTGAAAGTGAAGATAAGCCAGTGAACACCAAATCCCTTCTTGAAACCCCATTGTGC
 
. : . : . : . : . : . :
JMSF049N06+ TGAGTGGGTTCTCTGCCATTGGTCGAAAACGCCATGATTTTCTCCCATTTTCTTTTCTTT
JMSF008I16+ TGAGTGGGTTCTCTGCCATTGGTCGAAAACGCCATGATTTTCTCCCATTTTCTTTTCTTT
                      ____________________________________________________________
consensus TGAGTGGGTTCTCTGCCATTGGTCGAAAACGCCATGATTTTCTCCCATTTTCTTTTCTTT
 
. : . : . : . : . : . :
JMSF049N06+ GGCGTGGCCAGTGAGCTCTGGTTTTTTAAGATGGGGAAAGAATGATTGGAAGATGTAGGG
JMSF008I16+ GGCGTGGCCAGTGAGCTCTGGTTTTTTAAGATGGGGAAAGAATGATTGGAAGATGTAGGG
                      ____________________________________________________________
consensus GGCGTGGCCAGTGAGCTCTGGTTTTTTAAGATGGGGAAAGAATGATTGGAAGATGTAGGG
 
. : . : . : . : . : . :
JMSF049N06+ AGGGGAGGAGAGGAGAGAAGAAGTATTCTGGCAGCCATGCTTCTTCTTCAGTTCTTCC
JMSF008I16+ AGGGGAGGAGAGGAGAGAAGAAGTATTCTGGCAGCCATGCTTCTTCTTCAGTTCTTCCCC
                      ____________________________________________________________
consensus AGGGGAGGAGAGGAGAGAAGAAGTATTCTGGCAGCCATGCTTCTTCTTCAGTTCTTCCCC