Previous Contig 005000:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF009P09Sequence570005000 (15)gb:BT005530_16384705e-30Arabidopsis thaliana clone U50700 unknown protein (At5g25340) mRNA, complete cds750005000 (15)gb:BT005530_16384703e-20Arabidopsis thaliana clone U50700 unknown protein (At5g25340) mRNA, complete cds
JMFF034M05Sequence539005000 (15)gb:AK117743_18157617e-04Arabidopsis thaliana At4g32270 mRNA for unknown protein, complete cds, clone: RA740005000 (15)gb:BT005530_16384701e-22Arabidopsis thaliana clone U50700 unknown protein (At5g25340) mRNA, complete cds
JMFF039A07Sequence494005000 (15)gb:BT005530_16384701e-29Arabidopsis thaliana clone U50700 unknown protein (At5g25340) mRNA, complete cds690005000 (15)gb:BT005530_16384709e-20Arabidopsis thaliana clone U50700 unknown protein (At5g25340) mRNA, complete cds
JMFF040B22Sequence502005000 (15)gb:AK117743_18157610.032Arabidopsis thaliana At4g32270 mRNA for unknown protein, complete cds, clone: RA737005000 (15)gb:BT005530_16384703e-30Arabidopsis thaliana clone U50700 unknown protein (At5g25340) mRNA, complete cds
JMFF041K05Sequence643005000 (15)gb:BT005530_16384703e-21Arabidopsis thaliana clone U50700 unknown protein (At5g25340) mRNA, complete cds570005000 (15)
JMFF048I23Sequence517005000 (15)gb:BT005530_16384705e-32Arabidopsis thaliana clone U50700 unknown protein (At5g25340) mRNA, complete cds484005000 (15)
JMFS097H07Sequence609005000 (15)gb:BT005530_16384702e-29Arabidopsis thaliana clone U50700 unknown protein (At5g25340) mRNA, complete cds
JMFS098B11Sequence658005000 (15)gb:BT005530_16384702e-29Arabidopsis thaliana clone U50700 unknown protein (At5g25340) mRNA, complete cds
JMSF008I08Sequence305005000 (15)733022269

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF048I23- GGGCAAATTGA
                      ____________________________________________________________
consensus GGGCAAATTGA
 
. : . : . : . : . : . :
rJMFF048I23- ATAACAATTCTCATTGCTTATTGTTTTCTTGACTTTGATTCCCATGTAATCAATAACTAT
rJMFF041K05- ATTCTCATTGTTTATTGTTTTCTTGACTTTGATTCCAATGTAATCAACAATTAT
rJMFF039A07- TTGTTTTCTTGACTTTGATTCCAATGTAATCAACAATTAT
rJMFF034M05- TTGTTTATTGTTTTCTTGACTTTGATTCCAATGTAATCAACAATTAT
rJMFF009P09- TTGTTTATTGTTTTCTTGACTTTGATTCC-ATGTAATCAACAATTAT
                      ____________________________________________________________
consensus ATAACAATTCTCATTGTTTATTGTTTTCTTGACTTTGATTCCAATGTAATCAACAATTAT
 
. : . : . : . : . : . :
rJMFF048I23- TCTTTACAAATATTCCAATTAACCCAAAACCATACTGCAGAATCACTGATGCATATTAGA
rJMFF041K05- TCTTTACAAATATTCTAATGAACCCAAAACCATACTGCAGAATAACTGATGCATATTAGA
rJMFF039A07- TCTTTACAAATATTCTAATGAACCCAAAACCATACTGCAGAATAACTGATGCATATTAGA
rJMFF034M05- TCTTTACAAATATTCTAATGAACCCAAAACCATACTGCAGAATAACTGATGCATATTAGA
rJMFF009P09- TCTTTACAAATATTCTAATGAACCCAAAACCATACTGCAGAATAACTGATGCATATTAGA
rJMFF040B22- ATTAGA
                      ____________________________________________________________
consensus TCTTTACAAATATTCTAATGAACCCAAAACCATACTGCAGAATAACTGATGCATATTAGA
 
. : . : . : . : . : . :
rJMFF048I23- GTTTCAGAAATGTACATGACTAGTTTGAGCAGGCAGCATCAGAATTTAGATGCCAGATTC
rJMFF041K05- GTTTCAGAAATGTACATTACTAGTTTGAGCAGGCAGCGTCAGAATTCAGATGCCAGATTC
rJMFF039A07- GTTTCAGAAATGTACATTACTAGTTTGAGCAGGCAGCGTCAGAATTCAGATGCCAGATTC
rJMFF034M05- GTTTCAGAAATGTACATTACTAGTTTGAGCAGGCAGCGTCAGAATTCAGATGCCAGATTC
rJMFF009P09- GTTTCAGAAATGTACATTACTAGTTTGAGCAGGCAGCGTCAGAATTCAGATGCCAGATTC
rJMFF040B22- GTTTCAGAAATGTACATTACTAGTTTGAGCAGGCAGCGTCAGAATTCAGATGCCAGATTC
                      ____________________________________________________________
consensus GTTTCAGAAATGTACATTACTAGTTTGAGCAGGCAGCGTCAGAATTCAGATGCCAGATTC
 
. : . : . : . : . : . :
rJMFF048I23- TCAAAATCTTCCCAATCTGCCTTCCAAGTCTCGTTCCAATTCAGGTTTAACATCGTCGTG
rJMFF041K05- TCAAAATCTTACCGATATGCCTTCCAAGTCTTGTTACAATTCAGGTTTAACATCGTCGTG
rJMFF039A07- TCAAAATCTTACCGATCTGCCTTCCAAGTCTTGTTACAATTCAGGTTTAACATCGTCGTG
rJMFF034M05- TCAAAATCTTACCGATCTGCCTTCCAAGTCTTGTTACAATTCAGGTTTAACATCGTCGTG
rJMFF009P09- TCAAAATCTTACCGATCTGCCTTCCAAGTCTTGTTACAATTCAGGTTTAACATCGTCGTG
rJMFF040B22- TCAAAATCTTACCGATCTGCCTTCCAAGTCTTGTTACAATTCAGGTTTAACATCGTCGTG
                      ____________________________________________________________
consensus TCAAAATCTTACCGATCTGCCTTCCAAGTCTTGTTACAATTCAGGTTTAACATCGTCGTG
 
. : . : . : . : . : . :
rJMFF048I23- TAACTGTACTTTTCCAGAACTCGCTATGACTCCATCAGCTAGTCTTTTTACATTGCTCTA
rJMFF041K05- TAACTGTACTTTTCCAAAACTTGCTATGACTCCATCAGCTAGTCTTTTTTCATTGCTCTG
rJMFF039A07- TAACTGTACTTTTCCAAAACTTGCTATGACTCCATCAGCTAGTCTTTTTTCATTGCTCTG
rJMFF034M05- TAACTGTACTTTTCCAAAACTTGCTATGACTCCATCAGCTAGTCTTTTTTCATTGCTCTG
rJMFF009P09- TAACTGTACTTTTCCAAAACTTGCTATGACTCCATCAGCTAGTCTTTTTTCATTGCTCTG
rJMFF040B22- TAACTGTACTTTTCCAAAACTTGCTATGACTCCATCAGCTAGTCTTTTTTCATTGCTCTG
                      ____________________________________________________________
consensus TAACTGTACTTTTCCAAAACTTGCTATGACTCCATCAGCTAGTCTTTTTTCATTGCTCTG
 
. : . : . : . : . : . :
rJMFF048I23- TCATCCCTTTCGTGACTCTGATCTAGAAAATCTCCGGTACGAGAACCACTTCC
rJMFF041K05- TCATCCCTTACGTGACTCTGATCTGAAAAATCTGCGGTACGAGAACCACTTCCACATCAT
rJMFF039A07- TCATCCCTTACGTGACTCTGATCTGAAAAATCTGCGGTACGAGAACCACTTCCACATCAT
rJMFF034M05- TCATCCCTTACGTGACTCTGATCTGAAAAATCTGCGGTACGAGAACCACTTCCACATCAT
rJMFF009P09- TCATCCCTTACGTGACTCTGATCTGAAAAATCTGCGGTACGAGAACCACTTCCACATCAT
rJMFF040B22- TCATCCCTTACGTGACTCTGATCTGAAAAATCTGCGGTACGAGAACCACTTCCACATCAT
                      ____________________________________________________________
consensus TCATCCCTTACGTGACTCTGATCTGAAAAATCTGCGGTACGAGAACCACTTCCACATCAT
 
. : . : . : . : . : . :
rJMFF041K05- TGTCAATATCTATGCAATGGTAATCTAGCTTTCCCTGATGATTATTTTCTTCTTTGCATT
rJMFF039A07- TGTCAATATCTATGCAATGGTAATCTAGCTTTCCCTGATGATTATTTTCTTCTTTGCATT
rJMFF034M05- TGTCAATATCTATGCAATGGTAATCTAGCTTTCCCTGATGATTATTTTCTTCTTTGCATT
rJMFF009P09- TGTCAATATCTATGCAATGGTAATCTAGCTTTCCCTGATGATTATTTTCTTCTTTGCATT
rJMFF040B22- TGTCAATATCTATGCAATGGTAATCTAGCTTTCCCTGATGATTATTTTCTTCTTTGCATT
JMFF048I23+ CTTTGCATT
JMFF009P09+ TGTCAATATCTATGCAATGGTAATCTAGCTTTCCCTGATGATTATTTTCTTCTTTGCATT
                      ____________________________________________________________
consensus TGTCAATATCTATGCAATGGTAATCTAGCTTTCCCTGATGATTATTTTCTTCTTTGCATT
 
. : . : . : . : . : . :
rJMFF041K05- CCAGCTGCCTATCTCCGTTGCCTTTAGATTCTCTGGGCTCATCCATATAGGTGTCCTCTC
rJMFF039A07- CCAGCTGCCTATCTCCGTTGCCTTTAGATTCTCTGGGCTCATCCATATAGGTGTCCTCTC
rJMFF034M05- CCAGCTGCCTATCTCCGTTGCCTTTAGATTCTCTGGGCTCATCCATATAGGTGTCCTCTC
rJMFF009P09- CCAGCTGCCTATCTCCGTTGCCTTTAGATTCTCTGGGCTCATCCATATAGGTGTCCTCTC
rJMFF040B22- CCAGCTGCCTATCTCCGTTGCCTTTAGATTCTCTGGGCTCATCCATATAGGTGTCCTCTC
JMFF039A07+ GTTGCCTTTAGATTCTCTGGGCTCATCCATATAGGTGTCCTCTC
JMFF048I23+ CCGGCTGCCTATCTCCGTTGCCTTTAGATTGTCTGGGCTCATCCATACAGGTGTCCTCTC
JMFF009P09+ CCAGCTGCCTATCTCCGTTGCCTTTAGATTCTCTGGGCTCATCCATATAGGTGTCCTCTC
JMFS098B11+ CAGCTGCCTATCTCCGTTGCCTTTAGATTCTCTGGGCTCATCCATATAGGTGTCCTCTC
JMFS097H07+ TAGGTGTCCTCTC
                      ____________________________________________________________
consensus CCAGCTGCCTATCTCCGTTGCCTTTAGATTCTCTGGGCTCATCCATATAGGTGTCCTCTC
 
. : . : . : . : . : . :
rJMFF041K05- TTTCTGATAGCGTTTTTACAGGGTAACTAATGGAGACATGTCGGACAAATTCAAGCTGAT
rJMFF039A07- TTTCTGATAGCGTTTTTACAGGGTAACTAATGGAGACATGTCGGACAAATTCAAGCTGAT
rJMFF034M05- TTTCTGATAGCGTTTTTACAGGGTAACTAATGGAGACATGTCGGACAAATTCAAGCTGAT
rJMFF009P09- TTTCTGATAGCGTTTTTACAGGGTAACTAATGGAGACATGTCGGACAAATTCAAGCTGAT
rJMFF040B22- TTTCTGATAGCGTTTTTACAGGGTAACTAATGGAGACATGTCGGACAAATTCAAGCTGAT
JMFF039A07+ TTTNTGATAGCGTTTTTACAGGGTAACTAATGGAGACATGTCGGACAAATTCAAGCTGAT
JMFF048I23+ TTTCTGATCGTGTTTTTACAGGGTAACTAATGGAGACATGTCGCAAAAATTCAAGCTGAT
JMFF009P09+ TTTCTGATAGCGTTTTTACAGGGTAACTAATGGAGACATGTCGGACAAATTCAAGCTGAT
JMFS098B11+ TTTCTGATAGCGTTTTANCAGGGTAACTAATGGAGACATGTCGGACAAATTCAAGCTGAT
JMFS097H07+ TTTCTGATAGCGTTTTTACAGGGTAACTAATGGAGACATGTCGGACAAATTCAAGCTGAT
                      ____________________________________________________________
consensus TTTCTGATAGCGTTTTTACAGGGTAACTAATGGAGACATGTCGGACAAATTCAAGCTGAT
 
. : . : . : . : . : . :
rJMFF041K05- CACCCTCCTTGATTCCATAATTTCCTAT
rJMFF039A07- CACCCTCCTTGATTCCATAATTTCCTATAGAATCAGAGTCGGTGAGAAGCTTCTGACCAT
rJMFF034M05- CACCCTCCTTGATTCCATAATTTCCTATAGAATCAGAGTCGGTGAGAAGCTTCTGACCAT
rJMFF009P09- CACCCTCCTTGATTCCATAATTTCCTATAGAATCAGAGTCGGTGAGAAGCTTCTGACCAT
rJMFF040B22- CACCCTCCTTGATTCCATAATTTCCTATAGAATCAGAGTCGGTGAGAAGCTTCTGACCAT
JMFF039A07+ CACCCTCCTTGATTCCATAATTTCCTATAGAATCAGAGTCGGTGAGAAGCTTCTGACCAT
JMFF048I23+ CACCTTCCTTGATTCCATAATTTCCTATAGAATCAGAGTCGGTGAGAAGCTTCTGACCAT
JMFF009P09+ CACCCTCCTTGATTCCATAATTTCCTATAGAATCAGAGTCGGTGAGAAGCTTCTGACCAT
JMFS098B11+ CACCCTCCTTGATTCCATAATTTCCTATAGAATCAGAGTCGGTGAGAAGCTTCTGACCAT
JMFS097H07+ CACCCTCCTTGATTCCATAATTTCCTATAGAATCAGAGTCGGTGAGAAGCTTCTGACCAT
JMFF041K05+ AGAATCAGAGTCGGTGAGAAGCTTCTGACCAT
                      ____________________________________________________________
consensus CACCCTCCTTGATTCCATAATTTCCTATAGAATCAGAGTCGGTGAGAAGCTTCTGACCAT
 
. : . : . : . : . : . :
rJMFF039A07- CATAACTCAAGCAAAAATTTCCCCATACATGCGACCATGAGACTGTGCCCGGACCATTCT
rJMFF034M05- CATAACTCAAGCAAAAATTTCCCCATACATGCGACCATGAGACTGTGCCCGGACCATTCT
rJMFF009P09- CATAACTCAAGCAAAAATTTCCCCATACATGCGACCATGAGACTGTGCCCGGACCATTCT
rJMFF040B22- CATAACTCAAGCAAAAATTTCCCCATACATGCGACCATGAGACTGTGCCCGGACCATTCT
JMFF039A07+ CATAACTCAAGCAAAAATTTCCCCATACATGCGACCATGAGACTGTGCCCGGACCATTCT
JMFF048I23+ CATAACTCAAGCAAAAATTTCCCCATACATGCGACCATGAGACTGTGCCCGGACCATTCT
JMFF009P09+ CATAACTCAAGCAAAAATTTCCCCATACATGCGACCATGAGACTGTGCCCGGACCATTCT
JMFS098B11+ CATAACTCAAGCAAAAATTTCCCCATACATGCGACCATGAGACTGTGCCCGGACCATTCT
JMFS097H07+ CATAACTCAAGCAAAAATTTCCCCATACATGCGACCATGAGACTGTGCCCGGACCATTCT
JMFF041K05+ CATAACTCAAGCAAAAATTTCCCCATACATGCGACCATGAGACTGTGCCCGGACCATTCT
                      ____________________________________________________________
consensus CATAACTCAAGCAAAAATTTCCCCATACATGCGACCATGAGACTGTGCCCGGACCATTCT
 
. : . : . : . : . : . :
rJMFF039A07- TGGGCAAATGACGGAACGCCGCCTCCACCCC-TTTTTTCAGG
rJMFF034M05- TGGGCAAATGACGGAACGCCGCCTCCACCCC-TTTTTTCA-GGNTAACCACGGTCCCATT
rJMFF009P09- TGGGCAAATGACGGAACGCCGCCTCCACCCCTTTTTTTCAGGGTTAACCACGGTCCCATT
rJMFF040B22- TGGGCAAATGACGGAACGCCGCCTCCACCCC-TTTTTTCA-GGTTAACCACGGTCCCATT
JMFF039A07+ TGGGCAAATGACGGAACGCCGCCTCCACCCC-TTTTTTCA-GGTTAACCACGGTCCCATT
JMFF048I23+ TGGGCAAATGACGGAACGCCGCCTCCACCCC-TTTTTTCA-GGTTAACCACAGTCCCATT
JMFF009P09+ TGGGCAAATGACGGAACGCCGCCTCCACCCC-TTTTTTCA-GGTTAACCACGGTCCCATT
JMFS098B11+ TGGGCAAATGACGGAACGCCGCCTCCACCCC-TTTTTTCA-GGTTAACCACGGTCCCATT
JMFS097H07+ TGGGCAAATGACGGAACGCCGCCTCCACCCC-TTTTTTCA-GGTTAACCACGGTCCCATT
JMFF041K05+ TGGGCAAATGACGGAACGCCGCCTCCACCCC-TTTTTTCA-GGTTAACCACGGTCCCATT
JMFF040B22+ CCCATT
JMFF034M05+ CC-TTTTTTCA-GGTTAACCACGGTCCCATT
                      ____________________________________________________________
consensus TGGGCAAATGACGGAACGCCGCCTCCACCCC-TTTTTTCA-GGTTAACCACGGTCCCATT
 
. : . : . : . : . : . :
rJMFF034M05- CCTCGCTACATAGATCTCGAAACAAGT
rJMFF009P09- CCTCGCTACATAGATCTCGAAACAAGTGCCGTCCAATTTAA
rJMFF040B22- CCTCGCTACATAGATCTCGAAACAAGTGCCGTCCAATTTAAGAACGGCGAGCCAGATGGC
JMFF039A07+ CCTCGCTACATAGATCTCGAAACAAGTGCCGTCCAATTTAAGAACGGCGAGCCAGATGGC
JMFF048I23+ CCTCGCTACATAGATCTCGAAACAAGTGCCGTCCAATTTAAGAACGGTGAGCCTGATGGG
JMFF009P09+ CCTCGCTACATAGATCTCGAAACAAGTGCCGTCCAATTTAAGAACGGCGAGCCAGATGGC
JMFS098B11+ CCTCGCTACATAGATCTCGAAACAAGTGCCGTCCAATTTAAGAACGGCGAGCCAGATGGC
JMFS097H07+ CCTCGCTACATAGATCTCGAAACAAGTGCCGTCCAATTTAAGAACGGCGAGCCAGATGGC
JMFF041K05+ CCTCGCTACATAGATCTCGAAACAAGTGCCGTCCAATTTAAGAACGGCGAGCCAGATGGC
JMFF040B22+ CCTCGCTACATAGATCTCGAAACAAGTGCCGTCCAATTTAAGAACGGCGAGCCAGATGGC
JMFF034M05+ CCTCGCTACATAGATCTCGAAACAAGTGCCGTCCAATTTAAGAACGGCGAGCCAGATGGC
                      ____________________________________________________________
consensus CCTCGCTACATAGATCTCGAAACAAGTGCCGTCCAATTTAAGAACGGCGAGCCAGATGGC
 
. : . : . : . : . : . :
rJMFF040B22- ATCCTGCGGGCGCTTGTTGTAGAAAACGCTTTTCCTGGGAAATTTGATCGCGCAGCGAGA
JMFF039A07+ ATCCTGCGGGCGCTTGTTGTAGAAAACGCTTTTCCT-GGAAATTTGATCGCGCAGCGAGA
JMFF048I23+ CTCCTGCGGGAGCTTGTTGT---AAACGCTTCTCCT-GGAAATTTTATCGCGCAGCGAGA
JMFF009P09+ ATCCTGCGGGCGCTTGTTGTAGAAAACGCTTTTCCT-GGAAATTTGATCGCGCAGCGAGA
JMFS098B11+ ATCCTGCGGGCGCTTGTTGTAGAAAACGCTTTTCCT-GGAAATTTGATCGCGCAGCGAGA
JMFS097H07+ ATCCTGCGGGCGCTTGTTGTAGAAAACGCTTTTCCT-GGAAATTTGATCGCGCAGCGAGA
JMFF041K05+ ATCCTGCGGGCGCTTGTTGTAGAAAACGCTTTTCCT-GGAAATTTGATCGCGCAGCGAGA
JMFF040B22+ ATCCTGCGGGCGCTTGTTGTAGAAAACGCTTTTCCT-GGAAATTTGATCGCGCAGCGAGA
JMFF034M05+ ATCCTGCGGGCGCTTGTTGTAGAAAACGCTTTTCCT-GGAAATTTGATCGCGCAGCGAGA
                      ____________________________________________________________
consensus ATCCTGCGGGCGCTTGTTGTAGAAAACGCTTTTCCT-GGAAATTTGATCGCGCAGCGAGA
 
. : . : . : . : . : . :
rJMFF040B22- ATGGGACTCCACT
JMFF039A07+ ATGGGACTCCACTGGAGGACAATGAGACCATTGGGCTTTCTTTATAGGCTTTCGCCCCGT
JMFF048I23+ ATGGGACTCCACAGGAAGACAATGAGACCCTTGGGCTTTCTTTATAGGTTTTCGCTCCGT
JMFF009P09+ ATGGGACTCCACTGGAGGACAATGAGACCATTGGGCTTTCTTTATAGGCTTTCGCCCCGT
JMFS098B11+ ATGGGACTCCACTGGAGGACAATGAGACCATTGGGCTTTCTTTATAGGCTTTCGCCCCGT
JMFS097H07+ ATGGGACTCCACTGGAGGACAATGAGACCATTGGGCTTTCTTTATAGGCTTTCGCCCCGT
JMFF041K05+ ATGGGACTCCACTGGAGGACAATGAGACCATTGGGCTTTCTTTATAGGCTTTCGCCCCGT
JMFF040B22+ ATGGGACTCCACTGGAGGACAATGAGACCATTGGGCTTTCTTTATAGGCTTTCGCCCCGT
JMFF034M05+ ATGGGACTCCACTGGAGGACAATGAGACCATTGGGCTTTCTTTATAGGCTTTCGCCCCGT
                      ____________________________________________________________
consensus ATGGGACTCCACTGGAGGACAATGAGACCATTGGGCTTTCTTTATAGGCTTTCGCCCCGT
 
. : . : . : . : . : . :
JMFF039A07+ GAACTTCCATAGTTAAAGACTAGAAAACCACA
JMFF048I23+ GAACTTCCATACTTAAAGACTAGAAAA
JMFF009P09+ GAACTTCCATAGTTAAAGACTAGAAAACCACA
JMFS098B11+ GAACTTCCATAGTTAAAGACTAGAAAACCACAGCCGCCACCGCCTCAACGTTCATCACCA
JMFS097H07+ GAACTTCCATAGTTAAAGACTAGAAAACCACAGCCGCCACCGCCTCAACGTTCATCACCA
JMFF041K05+ GAACTTCCATAGTTAAAGACTAGAAAACCACAGCCGCCACCGCCTCAACGTTCATCACCA
JMFF040B22+ GAACTTCCATAGTTAAAGACTAGAAAACCACAGCCGCCACCGCCTCAACGTTCATCACCA
JMFF034M05+ GAACTTCCATAGTTAAAGACTAGAAAACCACAGCCGCCACCGCCTCAACGTTCATCACCA
                      ____________________________________________________________
consensus GAACTTCCATAGTTAAAGACTAGAAAACCACAGCCGCCACCGCCTCAACGTTCATCACCA
 
. : . : . : . : . : . :
JMFS098B11+ TTTATAAGAACAACATTATTGTTCTCTCTTTTTTTCCTGCTTGAAATAACATAGAGAAAA
JMFS097H07+ TTTATAAGAACAACATTATTGTTCTCTCTTTTTTTCCTGCTTGAAATAACATAGAGAAAA
JMFF041K05+ TTTATAAGAACAACATTATTGTTCTCTCTTTTTTTCCTGCTTGAAATAACATAGAGAAAA
JMFF040B22+ TTTATAAGAACAACATTATTGTTCTCTCTTTTTTTCCTGCTTGAAATAACATAGAGAAAA
JMFF034M05+ TTTATAAGAACAACATTATTGTTCTCTCTTTTTTTCCTGCTTGAAATAACATAGAGAAAA
JMSF008I08+ CATAGAGAAAA
                      ____________________________________________________________
consensus TTTATAAGAACAACATTATTGTTCTCTCTTTTTTTCCTGCTTGAAATAACATAGAGAAAA
 
. : . : . : . : . : . :
JMFS098B11+ CCTTCTCGAAGGGCTTTCGTATTGATTCCAGAGATTCTTTGGT
JMFS097H07+ CCTTCTCGAAGGGCTTTCGTATTGATTCCAGAGATTCTTTGGTGAAGAGTTGAAGGCAG
JMFF041K05+ CCTTCTCGAAGGGCTTTCGTATTGATTCCAGAGATTCTTTGGTGAAGAGTTGAAGGCAGG
JMFF040B22+ CCTTCTCGAAGGGCTTTCGTATTGATTCCAGAGATTCTTTGGTGAAGAGTTGAAGGCAGG
JMFF034M05+ CCTTCTCGAAGGGCTTTCGTATTGATTCCAGAGATTCTTTGGTGAAGAGTTGAAGGCAGG
JMSF008I08+ CCTTCTCGAAGGGCTTTCGTATTGATTTCAGAGATTCTTTGGTGAAGAGTTGAAGGCAGG
                      ____________________________________________________________
consensus CCTTCTCGAAGGGCTTTCGTATTGATTCCAGAGATTCTTTGGTGAAGAGTTGAAGGCAGG
 
. : . : . : . : . : . :
JMFF041K05+ GTTAGGCATGTGTTTGGAGAGATTCTAGACGGAGAACGGGAGAAGAAGAGGAGAGAGAGA
JMFF040B22+ GTTAGGCATGTGTTTGGAGAGATTCTAGACGGAGAACGGGAGAAGAAGAGGAGAGAGAGA
JMFF034M05+ GTTAGGCATGTGTTTGGAGAGATTCTAGACGGAGAACGGGAGAAGAAGAGGAGAGAGAGA
JMSF008I08+ GTCTGACTTGTGTTTGGAGAGATTCTAGACAGAGAACGGGAGAAGAAGAGGAGAGAGATA
                      ____________________________________________________________
consensus GTTAGGCATGTGTTTGGAGAGATTCTAGACGGAGAACGGGAGAAGAAGAGGAGAGAGAGA
 
. : . : . : . : . : . :
JMFF041K05+ GGGATCTCTCACCTCTTCTGTCTCACGCAGTCACGCAACTTTTCCTCTGTGTTTTGGGT
JMFF040B22+ GGGATCTCTCACCTCTTCTGTCTCACGCAGTCACGCAACTTTTCCTCTGTGTTTTGGGT
JMFF034M05+ GGGATCTCTCACCTCTTCTGTCTCACGCAGTCACGCAACTTTTCCTCTGTGTTTTGGGTG
JMSF008I08+ GGGATCTCTCACCTCTTCTGCCTCACGCAGACACGCAACTTTCCCTGTGTGTTTTGGGTG
                      ____________________________________________________________
consensus GGGATCTCTCACCTCTTCTGTCTCACGCAGTCACGCAACTTTTCCTCTGTGTTTTGGGTG
 
. : . : . : . : . : . :
JMFF034M05+ ATTTCTTC
JMSF008I08+ ATTTCTTCCAAACTTTCGCATCCATGACCAGCTACCCAGGTTGGGTGATTTCTTCATCTC
                      ____________________________________________________________
consensus ATTTCTTCCAAACTTTCGCATCCATGACCAGCTACCCAGGTTGGGTGATTTCTTCATCTC