Previous Contig 004987:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF005F02Sequence511004987 (6)pir|T48140|T481402e-34flavonoid 3',5'-hydroxylase homolog T4C9.140 [similarity] - Arabidopsis thaliana737008376 (7)pir|T48140|T481405e-70flavonoid 3',5'-hydroxylase homolog T4C9.140 [similarity] - Arabidopsis thaliana
JMFF006N09Sequence613004987 (6)pir|T48140|T481409e-44flavonoid 3',5'-hydroxylase homolog T4C9.140 [similarity] - Arabidopsis thaliana774008376 (7)pir|T48140|T481402e-85flavonoid 3',5'-hydroxylase homolog T4C9.140 [similarity] - Arabidopsis thaliana
JMFF011B08Sequence507004987 (6)pir|T48140|T481405e-33flavonoid 3',5'-hydroxylase homolog T4C9.140 [similarity] - Arabidopsis thaliana611008376 (7)pir|T48143|T481432e-63flavonoid 3',5'-hydroxylase homolog T4C9.170 [similarity] - Arabidopsis thaliana
JMFN030E02Sequence377004987 (6)pir|T48140|T481402e-37flavonoid 3',5'-hydroxylase homolog T4C9.140 [similarity] - Arabidopsis thaliana
JMFS114F03Sequence526004987 (6)pir|T48140|T481405e-50flavonoid 3',5'-hydroxylase homolog T4C9.140 [similarity] - Arabidopsis thaliana
JMSF008G17Sequence444004987 (6)pir|T48140|T481402e-25flavonoid 3',5'-hydroxylase homolog T4C9.140 [similarity] - Arabidopsis thaliana730008376 (7)pir|T48143|T481431e-83flavonoid 3',5'-hydroxylase homolog T4C9.170 [similarity] - Arabidopsis thaliana

Alignment

This contig is upended


. : . : . : . : . : . :
JMFN030E02+ CCCAAGAA
JMFS114F03+ AATCTCCCTAAACTCTGACCCAAGAA
                      ____________________________________________________________
consensus AATCTCCCTAAACTCTGACCCAAGAA
 
. : . : . : . : . : . :
JMFN030E02+ TTTCTCTTTCCTTCCCCTTCACAGTTCCACCCCACATCATGCCTGTAATCACATTAAGGA
JMFS114F03+ TTTCTCTTTCCTTCCCCTTCACAGTTCCACCCCACATCATGCCTGTAATCACATTAAGGA
JMFF006N09+ CACATCATGCCTGTAATCACATTAAGGA
                      ____________________________________________________________
consensus TTTCTCTTTCCTTCCCCTTCACAGTTCCACCCCACATCATGCCTGTAATCACATTAAGGA
 
. : . : . : . : . : . :
JMFN030E02+ TAGTCAAGAACATCTGCTCACCAATATTCACCGTTGTCCCAGCATGATCGTAGAAAAACT
JMFS114F03+ TAGTCAAGAACATCTGCTCACCAATATTCACCGTTCTCCCAGCATGATCGTAGAAAAACT
JMFF006N09+ TAGTCAAGAACATCTGCTCACCAATATTCACCGTTTTCCCAGCATGATCGTAGAAAAACT
                      ____________________________________________________________
consensus TAGTCAAGAACATCTGCTCACCAATATTCACCGTTTTCCCAGCATGATCGTAGAAAAACT
 
. : . : . : . : . : . :
JMFN030E02+ TCATAGTTTGTTTAATTTCTTGGCGCCTGAGATCATAAACAGAGTCTAGAGTTGAATTGC
JMFS114F03+ TCATAGTTTGTCTAATTTCTTGGCGCCTGAGATCATAAACAGAGTCTAGAGTTGAATTGC
JMFF006N09+ TCATAGTCTGTCTAATTTCTCGGCGCCTGAGATCATAAACAGAGTCTAGAGTGGAATTGC
JMFF011B08+ AGATCATAAACAGAGTCTAGAGTTGAATTGN
JMFF005F02+ CCTGAGATCATAAACAGAGTNTAGAGTGGAATTGC
                      ____________________________________________________________
consensus TCATAGTTTGTCTAATTTCTTGGCGCCTGAGATCATAAACAGAGTCTAGAGTTGAATTGC
 
. : . : . : . : . : . :
JMFN030E02+ TAAGCATTTGGCGTACACATACCTTCCTCAGCATCCTCCATTCAGGTCCATACGGTGTCC
JMFS114F03+ TAAGCATTTCGCGTACACATACCTTCCTCAGCATCCTCCATTCAGGTCCATACGGTGTCC
JMFF006N09+ TAAGCATTTCGCGGACGCATACCTTCCTCAGCATCCTCCATTCCGGTCCATACGGTGTCC
JMFF011B08+ TAAGCATTTCGCGTACACATACCTTCCTCAGCATCCTCCATTCAGGTCCATACGGTGTCC
JMFF005F02+ TAAGCATTTCGCGGACGCATACCTTCCTCAGCATCCTCCATTCCGGTCCATACGGTGTCC
JMSF008G17+ TCCATTCAGGTCCATACGGTGTCC
                      ____________________________________________________________
consensus TAAGCATTTCGCGTACACATACCTTCCTCAGCATCCTCCATTCAGGTCCATACGGTGTCC
 
. : . : . : . : . : . :
JMFN030E02+ ACACGATATCCTTGCCGCCATAGGTGGCTTCCCTTCCCACAACAGGAACGTCTCGGTTTG
JMFS114F03+ ACACGATATCCTTGCCGCCATAGGTGGCTTCCCTTCCCACAACAGGAACGTCTCGGTTTG
JMFF006N09+ ACACGATATCCTTGCCGCCATAGGTTGCTTCCCTTCCCACAACAGGAACGTCTCGGTTCG
JMFF011B08+ ACACGATATCCTTGCCGCCATAGGTGGCTTCCCTTCCCACAACAGGAACGTCTCGGTTTG
JMFF005F02+ ACACGATATCCTTGCCGCCATAGGTTGCTTCCCTTCCCACAACAGGAACGTCTCGGTTCG
JMSF008G17+ ACACGATATCCTTGCCGCCATAGGTGGCTTCCCTTCCCACAACAGGAACGTCTCGGTTTG
                      ____________________________________________________________
consensus ACACGATATCCTTGCCGCCATAGGTGGCTTCCCTTCCCACAACAGGAACGTCTCGGTTTG
 
. : . : . : . : . : . :
JMFN030E02+ CGAAGGTGGTGTCTTGATCCTTTAGCACCTCGCTAGCCATGGCGGGCGAGCTGATGATAA
JMFS114F03+ CAAAGGTGGTGTCTTGATCCTTTAGCACCTCGCTAGCCATGGCGGGCGAGCTGATGATAA
JMFF006N09+ CAAAGGTGGTGTCTTGATCCTTTAGCACCTCGCGAGCCATGGCGGGCGAGCTGATGATTA
JMFF011B08+ CAAAGGTGGTGTCTTGATCCTTTAGCACCTCGCTAGCCATGGCGGGCGAGCTGATGATAA
JMFF005F02+ CAAAGGTGGTGTCTTGATCCTTTAGCACCTCGCGAGCCATGGCGGGCGAGCTGATGATTA
JMSF008G17+ CAAAGGTGGTGTCTTGATCCTTTAGCACCTCGCTAGCCATGGCGGGCGAGCTGATGATAA
                      ____________________________________________________________
consensus CAAAGGTGGTGTCTTGATCCTTTAGCACCTCGCTAGCCATGGCGGGCGAGCTGATGATAA
 
. : . : . : . : . : . :
JMFN030E02+ TCC
JMFS114F03+ TCCCGGGCTTCTTGCCAAGCCAGAGTGTGTAGATGGGGCCATGGACCTTAGACAAGGCTG
JMFF006N09+ TCCCGGGCTTCTTGCCCAGCCAGAGCGTGTAGATGGGGCCGTGGACCTTAGACAAGGCTG
JMFF011B08+ TCCCGGGCTTCTTGCCAAGCCAGAGTGTGTAGATGGGGCCATGGACCTTAGACAAGGCTG
JMFF005F02+ TCCCGGGCTTCTTGCCCAGCCAGAGCGTGTAGATGGGGCCGTGGACCTTAGACAAGGCTG
JMSF008G17+ TCCCGGGCTTCTTGCCAAGCCAGAGTGTGTAGATGGGGCCATGGACCTTAGACAAGGCTG
                      ____________________________________________________________
consensus TCCCGGGCTTCTTGCCAAGCCAGAGTGTGTAGATGGGGCCATGGACCTTAGACAAGGCTG
 
. : . : . : . : . : . :
JMFS114F03+ CAAAATAGGTGTGGAGCTCAGGGTCTAGAGACAACAGGTTCCCAACTAAGGGGAGAGGTC
JMFF006N09+ CAAAATAGGTGTGGAGCTCAGGGTCTAGAGACAGCAGGTTCCCAACTAAGGGGAGAGGTC
JMFF011B08+ CAAAATAGGTGTGGAGCTCAGGGTCTAGAGACAACAGGTTCCCAACTAAGGGGAGAGGTC
JMFF005F02+ CAAAATAGGTGTGGAGCTCAGGGTCTAGAGACAGCAGGTTCCCAACTAAGGGGAGAGGTC
JMSF008G17+ CAAAATAGGTGTGGAGCTCAGGGTCTAGAGACAACAGGTTCCCAACTAAGGGGAGAGGTC
                      ____________________________________________________________
consensus CAAAATAGGTGTGGAGCTCAGGGTCTAGAGACAACAGGTTCCCAACTAAGGGGAGAGGTC
 
. : . : . : . : . : . :
JMFS114F03+ TGGGACCTGGCGGCAATGGC
JMFF006N09+ TGGGACCTGGCGGCATTGGCCGCTGCCCATTTCCAGACTTCTTGAAGATGAAAACCCAAA
JMFF011B08+ TGGGACCTGGCGGCAATGGCGGCTGCCCATTTCCAGACTTCTTGAAGATGAACATCCAAG
JMFF005F02+ TGGGACCTGGCGGCATTGGCCGCTGCCCATTTCCAGACTTCTTGAAGATGAAAACCCAAA
JMSF008G17+ TGGGACCTGGCGGCAATGGCGGCTGCCCATTTCCAGACTTCTTGAAGATGAACATCCAAG
                      ____________________________________________________________
consensus TGGGACCTGGCGGCAATGGCGGCTGCCCATTTCCAGACTTCTTGAAGATGAACATCCAAG
 
. : . : . : . : . : . :
JMFF006N09+ CAAACCACAGCACCCACAGCAAGGCGAGGGCGTAGCTGAAAGTTGCAGCCTGCAAAGAAT
JMFF011B08+ CAAACCACAGAGCCCCCAGCAAGGCGAGGGCATAGCTGAACGTTGCAGCCTGCAAAGAAT
JMFF005F02+ CAAACCACAGCACCCACAGCAAGGCGAGGGCGTAGCTGAAAGTTGCAGCCTGCAAAGAAT
JMSF008G17+ CAAACCACAGAGCCCCCAGCAAGGCGAGGGCATAGCTGAACGTTGCAGCCTGCAAAGAAT
                      ____________________________________________________________
consensus CAAACCACAGCGCCCCCAGCAAGGCGAGGGCGTAGCTGAACGTTGCAGCCTGCAAAGAAT
 
. : . : . : . : . : . :
JMFF006N09+ CATGGAGTGCTCTAATCAAATCTTGAAACATGTTTGAAGA
JMFF011B08+ CATGGAGTGCTTTGATCAAATCTTGAAACATGGTTGAAGA
JMFF005F02+ CATGGAGTGCTCTAATCAAATCTTGAAACATGTTTGAAGA
JMSF008G17+ CATGGAGTGCTTTGATCAAATCTTGAAACATGGTTGAAGAGGTTTAATTTGGGAGTGGCC
                      ____________________________________________________________
consensus CATGGAGTGCTTTGATCAAATCTTGAAACATGTTTGAAGAGGTTTAATTTGGGAGTGGCC