Previous Contig 004976:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS036C02Sequence581004976 (4)
JMFS119H01Sequence601004976 (4)gb:AP004768_18447027e-49Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC clone:P001
JMFS140A02Sequence625004976 (4)
JMSF008E20Sequence435004976 (4)739011352 (3)

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS119H01+ AACGCTTCACCTCAGCCACCATTCCCAGTACACGTGT
                      ____________________________________________________________
consensus AACGCTTCACCTCAGCCACCATTCCCAGTACACGTGT
 
. : . : . : . : . : . :
JMFS119H01+ GGGGTCAGCCTCACCATTTATTNTACGCTGCAAGTTCTCTATCCTATCTTCAAACGAACG
                      ____________________________________________________________
consensus GGGGTCAGCCTCACCATTTATTNTACGCTGCAAGTTCTCTATCCTATCTTCAAACGAACG
 
. : . : . : . : . : . :
JMFS119H01+ GAGAGTGTTGGCAACTATGAGTGTTTCATCAAGATCAAATACAATTCCAAGACATCTAAG
                      ____________________________________________________________
consensus GAGAGTGTTGGCAACTATGAGTGTTTCATCAAGATCAAATACAATTCCAAGACATCTAAG
 
. : . : . : . : . : . :
JMFS119H01+ GTTCAGCATGACCAGGCAAGAACTATATAGTCCTGGGGAGACAATGAATCCCCAAAAACA
                      ____________________________________________________________
consensus GTTCAGCATGACCAGGCAAGAACTATATAGTCCTGGGGAGACAATGAATCCCCAAAAACA
 
. : . : . : . : . : . :
JMFS119H01+ AGGGCAAAAACCACCATACTCCCTAGACTGCATCGCAACCAAATGAAGCTCCTCCCTTCC
                      ____________________________________________________________
consensus AGGGCAAAAACCACCATACTCCCTAGACTGCATCGCAACCAAATGAAGCTCCTCCCTTCC
 
. : . : . : . : . : . :
JMFS119H01+ AAGGGACATAACAGCAGTCTTGTTTTCTCTGAGACAGGTGGAGTGCAAAACATAGAGCGG
                      ____________________________________________________________
consensus AAGGGACATAACAGCAGTCTTGTTTTCTCTGAGACAGGTGGAGTGCAAAACATAGAGCGG
 
. : . : . : . : . : . :
JMFS119H01+ CGAGTAGTCCTGTGTCTGTGTCTTTGGAGATTTGGATTCCAGTTTGAAGCTAAGCCCAGA
                      ____________________________________________________________
consensus CGAGTAGTCCTGTGTCTGTGTCTTTGGAGATTTGGATTCCAGTTTGAAGCTAAGCCCAGA
 
. : . : . : . : . : . :
JMFS119H01+ AGAAGAAGAAGAAGTAATAGTGTGAAGCACTGCAAGTGGTGGACACCTCTCACTGGGTTG
                      ____________________________________________________________
consensus AGAAGAAGAAGAAGTAATAGTGTGAAGCACTGCAAGTGGTGGACACCTCTCACTGGGTTG
 
. : . : . : . : . : . :
JMFS119H01+ AGAATAGTGAGAGACTCGAATTTCCTTCCCACCCCAAACGACACCGTTCTGAGGATACAA
JMFS140A02+ TCGAATTTCCTTCCCACCCCAAACGACACCGTTCTGAGGATACAA
                      ____________________________________________________________
consensus AGAATAGTGAGAGACTCGAATTTCCTTCCCACCCCAAACGACACCGTTCTGAGGATACAA
 
. : . : . : . : . : . :
JMFS119H01+ TTCCACTTCTCCCAGAAGTGTCTCACCTTCATACACCTTCACCATCTCCATAGATTTATA
JMFS140A02+ TTCCACTTCTCCCAGAAGTGTCTCACCTTCATACACCTTCACCATCTCCATAGATTTATA
JMFS036C02+ TTCCACTTCTCCCAGAAGTGTCTCACCTTCATACACCTTCACCATCTCCATAGATTTATA
                      ____________________________________________________________
consensus TTCCACTTCTCCCAGAAGTGTCTCACCTTCATACACCTTCACCATCTCCATAGATTTATA
 
. : . : . : . : . : . :
JMFS119H01+ CATTTTTGTATATTCCAAGAACAA
JMFS140A02+ CATTTTTGTATATTCCAAGAACAATAATAACAATAGTAATAGTAATCAAAAACAGGAATC
JMFS036C02+ CATTTTTGTATATTCCAAGAACAATAATAACAATAGTAATAGTAATCAAAAACAGGAATC
                      ____________________________________________________________
consensus CATTTTTGTATATTCCAAGAACAATAATAACAATAGTAATAGTAATCAAAAACAGGAATC
 
. : . : . : . : . : . :
JMFS140A02+ GGATTCGGCTTTTCACTTTCAATTTCTCATCATCGTGGGAAATTTTCCCTTAAAAAAATC
JMFS036C02+ GGATTCGGCTTTTCACTTTCAATTTCTCATCATCGTGGGAAATTTTCCCTTAAAAAAATC
JMSF008E20+ TTCCCTTAAAAAAATC
                      ____________________________________________________________
consensus GGATTCGGCTTTTCACTTTCAATTTCTCATCATCGTGGGAAATTTTCCCTTAAAAAAATC
 
. : . : . : . : . : . :
JMFS140A02+ AAAAATCGAAAAACCAGCAATCGGATCCTCTCATCGTTCACGTTTTTGAAATTCGAATAT
JMFS036C02+ AAAAATCGAAAAACCAGCAATCGGATCCTCTCATCGTTCACGTTTTTGAAATTCGAATAT
JMSF008E20+ AAAAATCGAAAAACCAGCAATCGGATCCTCTCATCGTTCACGTTTTTGAAATTCGAATAT
                      ____________________________________________________________
consensus AAAAATCGAAAAACCAGCAATCGGATCCTCTCATCGTTCACGTTTTTGAAATTCGAATAT
 
. : . : . : . : . : . :
JMFS140A02+ CGAACGGTCCGGTTTTCTCACGGTTTATCCAATTGCTGATACAAACAAAAAATAGACAGA
JMFS036C02+ CGAACGGTCCGGTTTTCTCACGGTTTATCCAATTGCTGATACAAACAAAAAATAGACAGA
JMSF008E20+ CGAACGGTCCGGTTTTCTCACGGTTTATCCAATTGCTGATACAAACAAAAAATAGACAGA
                      ____________________________________________________________
consensus CGAACGGTCCGGTTTTCTCACGGTTTATCCAATTGCTGATACAAACAAAAAATAGACAGA
 
. : . : . : . : . : . :
JMFS140A02+ TCGGAAAATTAAGGTTTTTATGGAAAATAGATTTTTCCGATGACGATGGTGATTGATTGT
JMFS036C02+ TCGGAAAATTAAGGTTTTTATGGAAAATAGATTTTTCCGATGACGATGGTGATTGATTGT
JMSF008E20+ TCGGAAAATTAAGGTTTTTATGGAAAATAGATTTTTCCGATGACGATGGTGATTGATTGT
                      ____________________________________________________________
consensus TCGGAAAATTAAGGTTTTTATGGAAAATAGATTTTTCCGATGACGATGGTGATTGATTGT
 
. : . : . : . : . : . :
JMFS140A02+ ATTCCTGACGGTGACGACCACGACGGCGAAAAAACCTTAGATCCAGAGGGAGTGAAAAAT
JMFS036C02+ ATTCCTGACGGTGACGACCACGACGGCGAAAAAACCTTAGATCCAGAGGGAGTGAAAAAT
JMSF008E20+ ATTCCTGACGGTGACGACCACGACGGCGAAAAAACCTTAGATCCAGAGGGAGTGAAAAAT
                      ____________________________________________________________
consensus ATTCCTGACGGTGACGACCACGACGGCGAAAAAACCTTAGATCCAGAGGGAGTGAAAAAT
 
. : . : . : . : . : . :
JMFS140A02+ CGAAGTTTTAGATTTAGGGTTTGATGAACTGTTTTTCTTTTTTTTCGTTGATGATGATGC
JMFS036C02+ CGAAGTTTTAGATTTAGGGTTTGATGAACTGTTTTTCTTTTTTTTCGTTGATGATGATGC
JMSF008E20+ CGAAGTTTTAGATTTAGGGTTTGATGAACTGTTTTTCTTTTTTTTCGTTGATGATGATGC
                      ____________________________________________________________
consensus CGAAGTTTTAGATTTAGGGTTTGATGAACTGTTTTTCTTTTTTTTCGTTGATGATGATGC
 
. : . : . : . : . : . :
JMFS140A02+ AGTTGAGTCACACGAAGAGGAAACCCTAGATCCAGAGGGAGTGAAAAGTCAATTTTGTAC
JMFS036C02+ AGTTGAGTCACACGAAGAGGAAACCCTAGATCCAGAGGGAGTGAAAAGTCAATTTTGTAC
JMSF008E20+ AGTTGAGTCACACGAAGAGGAAACCCTAGATCCAGAGGGAGTGAAAAGTCAATTTTGTAC
                      ____________________________________________________________
consensus AGTTGAGTCACACGAAGAGGAAACCCTAGATCCAGAGGGAGTGAAAAGTCAATTTTGTAC
 
. : . : . : . : . : . :
JMFS140A02+ CCTCTCTCTCTCTCTCTCCCCCCTTTGCCCTTTGAATCTT
JMFS036C02+ CCTCTCTCTCTCTCTCTCCCCCCTTTGCCCTTTGAATCTT
JMSF008E20+ CCTCTCTCT-TCTCTCTCCCCCCTTTGCCCTTTGAATCTTTCTCTCTCTAGAAAGCTAAC
                      ____________________________________________________________
consensus CCTCTCTCTCTCTCTCTCCCCCCTTTGCCCTTTGAATCTTTCTCTCTCTAGAAAGCTAAC