Previous Contig 004975:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF002D10Sequence586004975 (10)gb:CPL306960_16486531e-54Craterostigma plantagineum mRNA for aldehyde dehydrogenase (ALDH gene).756002609 (8)gb:AY084648_15697362e-83Arabidopsis thaliana clone 1141 mRNA, complete sequence.
JMFF010B05Sequence576004975 (10)gb:CPL306960_16486533e-43Craterostigma plantagineum mRNA for aldehyde dehydrogenase (ALDH gene).790002609 (8)gb:AY084648_15697368e-93Arabidopsis thaliana clone 1141 mRNA, complete sequence.
JMFF017B02Sequence582004975 (10)gb:CPL306960_16486534e-44Craterostigma plantagineum mRNA for aldehyde dehydrogenase (ALDH gene).771002609 (8)gb:AY084648_15697363e-85Arabidopsis thaliana clone 1141 mRNA, complete sequence.
JMFF040F11Sequence526004975 (10)gb:CPL306960_16486533e-42Craterostigma plantagineum mRNA for aldehyde dehydrogenase (ALDH gene).122002609 (8)gb:CPL306960_16486533e-11Craterostigma plantagineum mRNA for aldehyde dehydrogenase (ALDH gene).
JMFF048B13Sequence268004975 (10)gb:CPL306960_16486538e-06Craterostigma plantagineum mRNA for aldehyde dehydrogenase (ALDH gene).376002609 (8)gb:AY084648_15697361e-28Arabidopsis thaliana clone 1141 mRNA, complete sequence.
JMFS116F04Sequence567004975 (10)gb:CPL306960_16486532e-46Craterostigma plantagineum mRNA for aldehyde dehydrogenase (ALDH gene).
JMSF004K23Sequence384004975 (10)gb:CPL306960_16486531e-16Craterostigma plantagineum mRNA for aldehyde dehydrogenase (ALDH gene).361002609 (8)gb:AY054633_15632873e-13Arabidopsis thaliana putative aldehyde dehydrogenase (At4g34240; F10M10.10) mRNA
JMSF008E19Sequence452004975 (10)gb:CPL306960_16486538e-19Craterostigma plantagineum mRNA for aldehyde dehydrogenase (ALDH gene).746002609 (8)gb:AY084648_15697363e-87Arabidopsis thaliana clone 1141 mRNA, complete sequence.
JMSF022H15Sequence665004975 (10)gb:CPL306960_16486531e-56Craterostigma plantagineum mRNA for aldehyde dehydrogenase (ALDH gene).521023031
JMSF042H10Sequence784004975 (10)gb:CPL306960_16486532e-74Craterostigma plantagineum mRNA for aldehyde dehydrogenase (ALDH gene).884023985gb:CPL306960_16486534e-69Craterostigma plantagineum mRNA for aldehyde dehydrogenase (ALDH gene).

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF042H10+ AAANCCACGGG
                      ____________________________________________________________
consensus AAANCCACGGG
 
. : . : . : . : . : . :
JMSF042H10+ AGTTAGGTGTTTTGCAGCGGCTGCCATGACAATGCGCCCAACTTTTCCATTTCCTGTGTA
                      ____________________________________________________________
consensus AGTTAGGTGTTTTGCAGCGGCTGCCATGACAATGCGCCCAACTTTTCCATTTCCTGTGTA
 
. : . : . : . : . : . :
JMSF022H15+ AGATCCCTCAAT
JMSF042H10+ AAATATTTTATCCCATTTTTGCTCCAGTAAAGCAGTGGTCTCGGGAACAGATCCCTCAAT
                      ____________________________________________________________
consensus AAATATTTTATCCCATTTTTGCTCCAGTAAAGCAGTGGTCTCGGGAACAGATCCCTCAAT
 
. : . : . : . : . : . :
JMFF002D10+ CCTTTACTGCAGTGGTATCCATATAGTCATTGAACAGTTTGGCAAGCAATGAAGATGT
JMSF022H15+ AACCTTTACTGCAGTGGTATCCATATAGTCATTGAACAGTTTGGCAAGCAATGAAGATGT
JMSF042H10+ AACCTTTACTGCAGTGGTATCCATATAGTCATTGAACAGTTTGGCAAGCAATGAAGATGT
                      ____________________________________________________________
consensus AACCTTTACTGCAGTGGTATCCATATAGTCATTGAACAGTTTGGCAAGCAATGAAGATGT
 
. : . : . : . : . : . :
JMFF002D10+ GGCTGGGGCAATTTCTGATGGTTTCAAAACTACAGCATTACCAGCAGCAATTGCTCCAAT
JMFS116F04+ GCTGGGGCAATTTCTGATGGTTTCAAAACTACAGCATTACCAGCAGCAATTGCTCCAAT
JMSF022H15+ GGCTGGGGCAATTTCTGATGGTTTCAAAACTACAGCATTACCAGCAGCAATTGCTCCAAT
JMSF042H10+ GGCTGGGGCAATTTCTGATGGTTTCAAAACTACAGCATTACCAGCAGCAATTGCTCCAAT
JMFF010B05+ GATGGTTTCAAAACTACAGCATTACCAGCAGCAATTGCTCCAAT
JMFF017B02+ TGATGGTTTCAAAACTACAGCATTACCAGCAGCAATTGCTCCAAT
                      ____________________________________________________________
consensus GGCTGGGGCAATTTCTGATGGTTTCAAAACTACAGCATTACCAGCAGCAATTGCTCCAAT
 
. : . : . : . : . : . :
JMFF002D10+ CACCGGATCCAAAGACAACATGAAGGGGTAGTTCCAGGCAGATATGACCAATACGACTCC
JMFS116F04+ CACCGGATCCAAAGACAACATGAAGGGGTAGTTCCAGGCAGATATGACCAATACGACTCC
JMSF022H15+ CACCGGATCCAAAGACAACATGAAGGGGTAGTTCCAGGCAGATATGACCAATACGACTCC
JMSF042H10+ CACCGGATCCAAAGACAACATGAAGGGGTAGTTCCAGGCAGATATGACCAATACGACTCC
JMFF010B05+ CACCGGATCCAAAGACAACATGAAGGGGTAGTTCCAGGCAGATATGACCAATACGACTCC
JMFF040F11+ GATCCAAAGACAACATGAAGGGGTAGTTCCAGGCAGATATGACCAATACGACTCC
JMFF017B02+ CACCGGATCCAAAGACAACATGAAGGGGTAGTTCCAGGCAGATATGACCAATACGACTCC
                      ____________________________________________________________
consensus CACCGGATCCAAAGACAACATGAAGGGGTAGTTCCAGGCAGATATGACCAATACGACTCC
 
. : . : . : . : . : . :
JMFF002D10+ AAGGGGTTCTGAAACTATTTTAGCTGATGAAGGATAAGTGGCGAATGCACTTTTCACATT
JMFS116F04+ AAGGGGTTCTGAAACTATTTTAGCTGATGAAGGATAAGTGGCGAATGCACTTTTCACATT
JMSF022H15+ AAGGGGTTCTGAAACTATTTTAGCTGATGAAGGATAAGTGGCGAATGCACTTTTCACATT
JMSF042H10+ AAGGGGTTCTGAAACTATTTTAGCTGATGAAGGATAAGTGGCGAATGCACTTTTCACATT
JMFF010B05+ AAGGGGTTCTGAAACTATTTTAGCTGATGAAGGATAAGTGGCGAATGCACTTTTCACATT
JMFF040F11+ AAGGGGTTCTGAAACTATTTTAGCTGATGAAGGATAAGTGGCGAATGCACTTTTCACATT
JMFF017B02+ AAGGGGTTCTGAAACTATTTTAGCTGATGAAGGATAAGTGGCGAATGCACTTTTCACATT
                      ____________________________________________________________
consensus AAGGGGTTCTGAAACTATTTTAGCTGATGAAGGATAAGTGGCGAATGCACTTTTCACATT
 
. : . : . : . : . : . :
JMFF002D10+ TTCAGGTTTCATCCAACGTTTTAGTTCCTTCAACGCCAACTTACATGATGCTTTGACAAA
JMFS116F04+ TTCAGGTTTCATCCAACGTTTTAGTTCCTTCAACGCCAACTTACATGATGCTTTGACAAA
JMSF022H15+ TTCAGGTTTCATCCAACGTTTTAGTTCCTTCAACGCCAACTTACATGATGCTTTGACAAA
JMSF042H10+ TTCAGGTTTCATCCAACGTTTTAGTTCCTTCAACGCCAACTTACATGATGCTTTGACAAA
JMFF010B05+ TTCAGGTTTCATCCAACGTTTTAGTTCCTTCAACGTCAACTTACATGATGCTTTGACAAA
JMFF040F11+ TTCAGGTTTCATCCAACGTTTTAGTTCCTTCAACGCCAACTTACATGATGCTTTGACAAA
JMSF004K23+ TTCAACGCCAACTTACATGATGC-TTGACAAA
JMFF017B02+ TTCAGGTTTCATCCAACGTTTTAGTTCCTTCAACGCCAACTTACATGATGCTTTGACAAA
JMSF008E19+ TTCAACGCCAACTTACATGATGCTTTGACAAA
                      ____________________________________________________________
consensus TTCAGGTTTCATCCAACGTTTTAGTTCCTTCAACGCCAACTTACATGATGCTTTGACAAA
 
. : . : . : . : . : . :
JMFF002D10+ TGCAATCTCATGAACGAAGGATTCGAGCTCTGGTTTGGAGAGGTCAGAGAAAAGGGCGTC
JMFS116F04+ TGCAATCTCATGAACGAAGGATTCGAGCTCTGGTTTGGAGAGGTCAGAGAAAAGGGCGTC
JMSF022H15+ TGCAATCTCATGAACGAAGGATTCGAGCTCTGGTTTGGAGAGGTCAGAGAAAAGGGCGTC
JMSF042H10+ TGCAATCTCATGAACGAAGGATTCGAGCTCTGGTTTGGAGAGGTCAGAGAAAAGGGCGTC
JMFF010B05+ TGCAATCTCATGAACGAAGGATTCGAGCTCTGGTTTGGAGAGGTCAGAGAAAAGGGCGTC
JMFF040F11+ TGCAATCTCATGAACGAAGGATTCGAGCTCTGGTTTGGAGAGGTCAGAGAAAAGGGCGTC
JMSF004K23+ TGCAATCTCATGAACGAAGGATTCGAGCTCTGGTTTGGAGAGGTCAGAGAAAAGGGCGTC
JMFF017B02+ TGCAATCTCATGAACGAAGGATTCGAGCTCTGGTTTGGAGAGGTCAGAGAAAAGGGCGTC
JMSF008E19+ TGCAATCTCATGAACGAAGGATTCGAGCTCTGGTTTGGAGAGGTCAGAGAAAAGGGCGTC
                      ____________________________________________________________
consensus TGCAATCTCATGAACGAAGGATTCGAGCTCTGGTTTGGAGAGGTCAGAGAAAAGGGCGTC
 
. : . : . : . : . : . :
JMFF002D10+ CATGATCGCCTTCTCGTGATGTTCGGCGATCTTCAACACAGCTTTCAGTTGCGACACTCT
JMFS116F04+ CATGATCGCCTTCTCGTGATGTTCGGCGATCTTCAACACAGCTTTCAGTTGCGACACTCT
JMSF022H15+ CATGATCGCCTTCTCGTGATGTTCGGCGATCTTCAACACAGCTTTCAGTTGCGACACTCT
JMSF042H10+ CATGATCGCCTTCTCGTGATGTTCGGCGATCTTCAACACAGCTTTCAGTTGCGACACTCT
JMFF010B05+ CATGATCGCCTTCTCGTGATGTTCGGCGATCTTCAACACAGCTTTCAGTTGCGACACTCT
JMFF040F11+ CATGATCGCCTTCTCGTGATGTTCGGCGATCTTCAACACAGCTTTCAGTTGCGACACTCT
JMSF004K23+ CATGATCGCCTTCTCGTGATGTTCGGCGATCTTCAACACAGCTTTCAGTTGCGACACTCT
JMFF048B13+ TCTTCAACACAGCTTTCAGTTGCGACACTCT
JMFF017B02+ CATGATCGCCTTCTCGTGATGTTCGGCGATCTTCAACACAGCTTTCAGTTGCGACACTCT
JMSF008E19+ CATGATCGCCTTCTCGTGATGTTCGGCGATCTTCAACACAGCTTTCAGTTGCGACACTCT
                      ____________________________________________________________
consensus CATGATCGCCTTCTCGTGATGTTCGGCGATCTTCAACACAGCTTTCAGTTGCGACACTCT
 
. : . : . : . : . : . :
JMFF002D10+ CCACTCGTAACTCTTCGTCTTCCCGGCAGCGAACGTCTCCCTCAACTCACTCACTGCCGC
JMFS116F04+ CCACTCGTAACTCTTCGTCTTCCCGGCAGCGAACGTCTCCCTCAACTCACTCACTGCCGC
JMSF022H15+ CCACTCGTAACTCTTCGTCTTCCCGGCAGCGAACGTCTCCCTCAACTCACTCACTGCCGC
JMSF042H10+ CCACTCGTAACTCTTCGTCTTCCCGGCAGCGAACGTCTCCCTCAACTCACTCACTGCCGC
JMFF010B05+ CCACTCGTAACTCTTCGTCTTCCCGGCAGCGAACGTCTCCCTCAACTCACTCACTGCCGC
JMFF040F11+ CCACTCGTAACTCTTCGTCTTCCCGGCAGCGAACGTCTCCCTCAACTCACTCACTGCCGC
JMSF004K23+ CCACTCGTAACTCTTCGTCTTCCCGGCAGCGAACGTCTCCCTCAACTCACTCACTGCCGC
JMFF048B13+ CCACTCGTAACTCTTCGTCTTCCCGGCAGCGAACGTCTCCCTCAACTCACTCACTGCCGC
JMFF017B02+ CCACTCGTAACTCTTCGTCTTCCCGGCAGCGAACGTCTCCCTCAACTCACTCACTGCCGC
JMSF008E19+ CCACTCGTAACTCTTCGTCTTCCCGGCAGCGAACGTCTCCCTCAACTCACTCACTGCCGC
                      ____________________________________________________________
consensus CCACTCGTAACTCTTCGTCTTCCCGGCAGCGAACGTCTCCCTCAACTCACTCACTGCCGC
 
. : . : . : . : . : . :
JMFF002D10+ CGCCGCATCCATCTCCAATCACTTCCTCTCCTCTCTTCCTAAACAATATATATATTTATA
JMFS116F04+ CGCCGCATCCATCTCCAATCACTTCCTCTCCTCTCTTCCTAAACAATATATATATTTATA
JMSF022H15+ CGCCGCATCCATCTCCAATCACTTCCTCTCCTCTCTTCCTAAACAATATATATATTTATA
JMSF042H10+ CGCCGCATCCATCTCCAATCACTTCCTCTCCTCTCTTCCTAAACAATATATATATTTATA
JMFF010B05+ CGCCGCATCCATCTCCAATCACTTCCTCTCCTCTCTTCCTAAACAATATATATATTTATA
JMFF040F11+ CGCCGCATCCATCTCCAATCACTTCCTCTCCTCTCTTCCTAAACAATATATATATTTATA
JMSF004K23+ CGCCGCATCCATCTCCAATCACTTCCTCTCCTCTCTTCCTAAACAATATATATATTTATA
JMFF048B13+ CGCCGCATCCATCTCCAATCACTTCCTCTCCTCTCTTCCTAAACAATATATATATTCATA
JMFF017B02+ CGCCGCATCCATCTCCAATCACTTCCTCTCCTCTCTTCCTAAACAATATATATATTTATA
JMSF008E19+ CGCCGCATCCATCTCCAATCACTTCCTCTCCTCTCTTCCTAAACAATATATATATTTATA
                      ____________________________________________________________
consensus CGCCGCATCCATCTCCAATCACTTCCTCTCCTCTCTTCCTAAACAATATATATATTTATA
 
. : . : . : . : . : . :
JMFF002D10+ TATATGAAATCAACCGCACTATACTTAAGTATGTATATCAGTATATAC
JMFS116F04+ TATATGAAATCAACCGCACTATACTTAAGTATGTATATCAGTATATACAATTCCTCCAAT
JMSF022H15+ TATATGAAATCAACCGCACTATACTTAAGTATGTATATCAGTATATACAATTCCTCCAAT
JMSF042H10+ TATATGAAATCAACCGCACTATACTTAAGTATGTATATCAGTATATACAATTCCTCCAAT
JMFF010B05+ TATATGAAATCAACCGCACTATACTTAAGTATGTATATCAGTATATACAATTCCTCCAAT
JMFF040F11+ TATATGAAATCAACCGCACTATACTTAAGTATGTATATCAGTATATACAATTCCTCCAAT
JMSF004K23+ TATATGAAATCAACCGCACTATACTTAAGTATGTATATCAGTATATACAATTCCTCCAAT
JMFF048B13+ TATATGAAATCAACCTCACTATACTTAAGTATGTATATCAGTATATACAATTCCTCCAAT
JMFF017B02+ TATATGAAATCAACCGCACTATACTTAAGTATGTATATCAGTATATACAATTCCTCCAAT
JMSF008E19+ TATATGAAATCAACCGCACTATACTTAAGTATGTATATCAGTATATACAATTCCTCCAAT
                      ____________________________________________________________
consensus TATATGAAATCAACCGCACTATACTTAAGTATGTATATCAGTATATACAATTCCTCCAAT
 
. : . : . : . : . : . :
JMFS116F04+ GCTATATATGTAATCGCATATATAGATG
JMSF022H15+ GCTATATATGTAATCGCATATATAGATGGAGATAAGATAGATATGAATGT
JMSF042H10+ GCTATATATGTAATCGCATATATAGATGGAGATAAGATAGATATGAATGTTC
JMFF010B05+ GCTATATATGTAATCGCATATATAGATGGAGATAAGATAGATATGAAAGTTC
JMFF040F11+ GCTATATATGTAATCGCATATATAGATGGAGATAAGATAGATATGAATGTT
JMSF004K23+ GCTATATATGTAATCGCATATATAGATGGAGATAAGATAGATATGAATGTTC
JMFF048B13+ GCTATATATGTAATCGCATATATAGATGGAGATAAGATAGATATGAATGTTC
JMFF017B02+ GCTATATATGTAATCGCATATATAGATGGAGATAAGATAGATATGAATGTTC
JMSF008E19+ GCTATATATGTAATCGCATATATAGATGGAGATAAGATAGATATGAATGTTCAAATTCTG
                      ____________________________________________________________
consensus GCTATATATGTAATCGCATATATAGATGGAGATAAGATAGATATGAATGTTCAAATTCTG
 
. : . : . : . : . : . :
JMSF008E19+ GCATCTTGTCTACTCCGGCGATATATATATTATGCATGCGTGTATAATTGTCTGTATACC
                      ____________________________________________________________
consensus GCATCTTGTCTACTCCGGCGATATATATATTATGCATGCGTGTATAATTGTCTGTATACC