Previous Contig 004969:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF008E06Sequence493004969 (2)pir|T05655|T056550.006hypothetical protein F22I13.40 - Arabidopsis thaliana>gb:ATCHRIV89_1547781 Arabi780011429 (2)pir|T05655|T05655e-125hypothetical protein F22I13.40 - Arabidopsis thaliana>gb:ATCHRIV89_1547781 Arabi
JMSF011C05Sequence336004969 (2)pir|T05655|T056550.041hypothetical protein F22I13.40 - Arabidopsis thaliana>gb:ATCHRIV89_1547781 Arabi764011429 (2)pir|T05655|T05655e-121hypothetical protein F22I13.40 - Arabidopsis thaliana>gb:ATCHRIV89_1547781 Arabi

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF008E06+ CATCATCATTCTC
                      ____________________________________________________________
consensus CATCATCATTCTC
 
. : . : . : . : . : . :
JMSF008E06+ ATCACTAGGGTTTTTCCAGACCCATGACTTTGAAAGGTTATCAGACTTCACCCTCATGGC
                      ____________________________________________________________
consensus ATCACTAGGGTTTTTCCAGACCCATGACTTTGAAAGGTTATCAGACTTCACCCTCATGGC
 
. : . : . : . : . : . :
JMSF008E06+ TCTAACAGCACCTGAAGCATCACTGTATGTTACAATTATGTCAATATCCTTTTCATTTGG
                      ____________________________________________________________
consensus TCTAACAGCACCTGAAGCATCACTGTATGTTACAATTATGTCAATATCCTTTTCATTTGG
 
. : . : . : . : . : . :
JMSF008E06+ ACGCGCAGCAGAACCTGTATGACTTTGCTCCTGCCAAGTCATTGCCGAAGATTTAATGGG
                      ____________________________________________________________
consensus ACGCGCAGCAGAACCTGTATGACTTTGCTCCTGCCAAGTCATTGCCGAAGATTTAATGGG
 
. : . : . : . : . : . :
JMSF011C05+ CCTTTCTATTGG
JMSF008E06+ AGGAATGAACAGGCACAATGAGATGCTCACATGCAGACAGTGAAAATACCTTTCTATTGG
                      ____________________________________________________________
consensus AGGAATGAACAGGCACAATGAGATGCTCACATGCAGACAGTGAAAATACCTTTCTATTGG
 
. : . : . : . : . : . :
JMSF011C05+ CACGTTCTGGACAATCATACAGGGGCAAAAGATCTCTGAGCTCCGTCCGAACTGTTGATC
JMSF008E06+ CACGTTCTGGACAATCATACAGGGGCAAAAGATCTCTGAGCTCCGTCCGAACTGTTGATC
                      ____________________________________________________________
consensus CACGTTCTGGACAATCATACAGGGGCAAAAGATCTCTGAGCTCCGTCCGAACTGTTGATC
 
. : . : . : . : . : . :
JMSF011C05+ CATATGATATTTCTGCTCCAACAACTGCTGTGTATAACATAACCAGGAAGAGGAAGACGG
JMSF008E06+ CATATGATATTTCTGCTCCAACAACTGCTGTGTATAACATAACCAGGAAGAGGAAGACGG
                      ____________________________________________________________
consensus CATATGATATTTCTGCTCCAACAACTGCTGTGTATAACATAACCAGGAAGAGGAAGACGG
 
. : . : . : . : . : . :
JMSF011C05+ TGAGCAGAGATGCAGAAGGGCATGATCCTGTAAAGAGAAGCCGAGGAGCACTCATCCT
JMSF008E06+ TGAGCAGAGATGCAGAAGGGCATGATCCTGTAAAGAGAAGCCGAGGAGCACTCATCCTGA
                      ____________________________________________________________
consensus TGAGCAGAGATGCAGAAGGGCATGATCCTGTAAAGAGAAGCCGAGGAGCACTCATCCTGA
 
. : . : . : . : . : . :
JMSF008E06+ ATCCTGAGTTCCTGACGGTGAGCAGATAATACACAAAGCCAAACAACGATTTAGATCTCC
                      ____________________________________________________________
consensus ATCCTGAGTTCCTGACGGTGAGCAGATAATACACAAAGCCAAACAACGATTTAGATCTCC