Previous Contig 004966:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF008D20Sequence361004966 (8)
JMSF012H04Sequence256004966 (8)743004966 (8)gb:AY035084_15598564e-77Arabidopsis thaliana unknown protein (At5g08540) mRNA, complete cds.>gb:AY051035
JMSF017B05Sequence370004966 (8)786004966 (8)gb:AY035084_15598561e-78Arabidopsis thaliana unknown protein (At5g08540) mRNA, complete cds.>gb:AY051035
JMSF017H15Sequence463004966 (8)
JMSF038H14Sequence640004966 (8)gb:AY086404_15714532e-23Arabidopsis thaliana clone 249722 mRNA, complete sequence.918004966 (8)gb:AY035084_1559856e-101Arabidopsis thaliana unknown protein (At5g08540) mRNA, complete cds.>gb:AY051035

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF012H04- AAACAAT
rJMSF017B05- TTTGGATGAGGGAAAAACAAT
rJMSF038H14- GCCGTCCTAAATTTTCATTTGGATGAGGGAAAAACAAT
                      ____________________________________________________________
consensus GCCGTCCTAAATTTTCATTTGGATGAGGGAAAAACAAT
 
. : . : . : . : . : . :
rJMSF012H04- CAAAGGAAAACATTTTACAAAAATTCTCCAATATATTGGTAAATCACCTTTGCTAGCTTT
rJMSF017B05- CAAAGGAAAACATTTTACAAAAATTCTCCAATATATTGGTAAATCACCTTTGCTAGCTTT
rJMSF038H14- CAAAGGAAAACATTTTACAAAAATTCTCCAATATATTGGTAAATCACCTTTGCTAGCTTT
                      ____________________________________________________________
consensus CAAAGGAAAACATTTTACAAAAATTCTCCAATATATTGGTAAATCACCTTTGCTAGCTTT
 
. : . : . : . : . : . :
rJMSF012H04- AAAGTTTAAACCTATCACTAAACTCTACTCAAGTAATGTGAGTTAGGAAGCATGAGATGA
rJMSF017B05- AAAGTTTAAACCTATCACTAAACTCTACTCAAGTAATGTGAGTTAGGAAGCATGAGATGA
rJMSF038H14- AAAGTTTAAACCTATCACTAAACTCTACTCAAGTAATGTGAGTTAGGAAGCATGAGATGA
                      ____________________________________________________________
consensus AAAGTTTAAACCTATCACTAAACTCTACTCAAGTAATGTGAGTTAGGAAGCATGAGATGA
 
. : . : . : . : . : . :
rJMSF012H04- CTCGTCACTCGAATCTTCTGAATCTGAGCCATCAACCATCTTTTCCAGAGAATCCAAATC
rJMSF017B05- CTCGTCACTCGAATCTTCTGAATCTGAGCCATCAACCATCTTTTCCAGAGAATCCAAATC
rJMSF038H14- CTCGTCACTCGAATCTTCTGAATCTGAGCCATCAACCATCTTTTACAGAGAATCCAAATC
                      ____________________________________________________________
consensus CTCGTCACTCGAATCTTCTGAATCTGAGCCATCAACCATCTTTTCCAGAGAATCCAAATC
 
. : . : . : . : . : . :
rJMSF012H04- CCCGGCATCGGAGATAGTATGCAACCTAAGCTTTTCCGCATCCTCATCTGCTACCCCAAA
rJMSF017B05- CCCGGCATCGGAGATAGTATGCAACCTAAGCTTTTCCGCATCCTCATCTGCTACCCCAAA
rJMSF038H14- CCCGGCATCGGAGATAGTATGCAACCTAAGCTTTTCCGCATCCTCATCTGCTACCCCAAA
                      ____________________________________________________________
consensus CCCGGCATCGGAGATAGTATGCAACCTAAGCTTTTCCGCATCCTCATCTGCTACCCCAAA
 
. : . : . : . : . : . :
rJMSF012H04- TATTTCTTTAACTGTTAAAGAGCTATCCCTTGAACAAAACTCAGGCATCTCTGACAAATA
rJMSF017B05- TATTTCTTTAACTGTTAAAGAGCTATCCCTTGAACAAAACTCAGGCATCTCTGACAAATA
rJMSF038H14- TATTTCTTTAACTGTTAAAGAGCTATCCCTTGAACAAAACTCAGGCATCTCTGACAAATA
                      ____________________________________________________________
consensus TATTTCTTTAACTGTTAAAGAGCTATCCCTTGAACAAAACTCAGGCATCTCTGACAAATA
 
. : . : . : . : . : . :
rJMSF012H04- ATAAACCTTTCCAAAAAGTGCTTGCACCGCGAGTTTTCTCTTGAACCCCTTCTCAGAATA
rJMSF017B05- ATAAACCTTTCCAAAAAGTGCTTGCACCGCGAGTTTTCTCTTGAACCCCTTCTCAGAATA
rJMSF038H14- ATAAACCTTTCCAAAAAGTGCTTGCACCGCGAGTTTTCTCTTGAACCCCTTCTCAGAATA
                      ____________________________________________________________
consensus ATAAACCTTTCCAAAAAGTGCTTGCACCGCGAGTTTTCTCTTGAACCCCTTCTCAGAATA
 
. : . : . : . : . : . :
rJMSF012H04- CCCTGACATGTCCATGACAACAGGACCTTTATCTTTAACAATACGACTTGAGATCTCATT
rJMSF017B05- CCCTGACATGTCCATGACAACAGGACCTTTATCTTTAACAATACGACTTGAGATCTCATT
rJMSF038H14- CCCTGACATGTCCATGACAACAGGACCTTTATCTTTAACAATACGACTTGAGATCTCATT
                      ____________________________________________________________
consensus CCCTGACATGTCCATGACAACAGGACCTTTATCTTTAACAATACGACTTGAGATCTCATT
 
. : . : . : . : . : . :
rJMSF012H04- AAGGATTTCAGCTACTTGAGAATCACTTAAAAGTGAGGCCTTCCTGAGTTGAATCAAATC
rJMSF017B05- AAGGATTTCAGCTACTTGAGAATCACTTAAAAGTGAGGCCTTCCTGAGTTGAATCAAATC
rJMSF038H14- AAGGATTTCAGCTACTTGAGAATCACTTAAAAGTGAGGCCTTCCTGAGTTGAATCAAATC
                      ____________________________________________________________
consensus AAGGATTTCAGCTACTTGAGAATCACTTAAAAGTGAGGCCTTCCTGAGTTGAATCAAATC
 
. : . : . : . : . : . :
rJMSF012H04- AGCTACCAAATCAGGGTTAAACGGTTTCTCATTCAAGGCATATCGAATATATTTGCGCAA
rJMSF017B05- AGCTACCAAATCAGGGTTAAACGGTTTCTCATTCAAGGCATATCGAATATATTTGCGCAA
rJMSF038H14- AGCTACCAAATCAGGGTTAAACGGTTTCTCATTCAAGGCATATCGAATATATTTGCGCAA
                      ____________________________________________________________
consensus AGCTACCAAATCAGGGTTAAACGGTTTCTCATTCAAGGCATATCGAATATATTTGCGCAA
 
. : . : . : . : . : . :
rJMSF012H04- AATATCCTCCATTTCAAAATTTGTCTTTTTCATCAGGTCCTTCAACTCTGACTCATCAAC
rJMSF017B05- AATATCCTCCATTTCAAAATTTGTCTTTTTCATCAGGTCCTTCAACTCTGACTCATCAAC
rJMSF038H14- AATATCCTCCATTTCAAAATTTGTCTTTTTCATCAGGTCCTTCAACTCTGACTCATCAAC
                      ____________________________________________________________
consensus AATATCCTCCATTTCAAAATTTGTCTTTTTCATCAGGTCCTTCAACTCTGACTCATCAAC
 
. : . : . : . : . : . :
rJMSF012H04- ACTTTGCCGTCCTTTCTCAAAGAGCTCATCAATTGATGTACACAGGAAAGCATTTTTATT
rJMSF017B05- ACTTTGCCGTCCTTTCTCAAAGAGCTCATCAATTGATGTACACAGGAAAGCATTTTTATT
rJMSF038H14- ACTTTGCCGTCCTTTCTCAAAGAGCTCATCAATTGATGTACACAGGAAAGCATTTTTATT
                      ____________________________________________________________
consensus ACTTTGCCGTCCTTTCTCAAAGAGCTCATCAATTGATGTACACAGGAAAGCATTTTTATT
 
. : . : . : . : . : . :
rJMSF012H04- GACCAATTTTCGACGCTTTGCTCTAGGGGAATTGAACTTCCGGACGGTCTTAACGAAGGC
rJMSF017B05- GACCAATTTTCGACGCTTTGCTCTAGGGGAATTGAACTTCCGGACGGTCTTAACGAAGGC
rJMSF038H14- GACCAATTTTCGACGCTTTGCTCTAGGGGAATTGAACTTCCGGACGGTCTTAACGAAGGC
JMSF038H14+ GCTCTAGGGGAATTGAACTTCCGGACGGTCTTAACGAAGGC
                      ____________________________________________________________
consensus GACCAATTTTCGACGCTTTGCTCTAGGGGAATTGAACTTCCGGACGGTCTTAACGAAGGC
 
. : . : . : . : . : . :
rJMSF012H04- AATAACAAATGTGATA
rJMSF017B05- AATAACAAATGTGATACCNAAAATAAGCCAAGGGCACGGCGAGAA
rJMSF038H14- AATAACAAATGTGATACC-AAAATAAGCCAAGGGCACGGCGAGAATCCATGGCAAGGAGC
JMSF038H14+ AATAACAAATGTGATACC-AAAATAAGCCAAGGGCACGGCGAGAATCCATGGCAAGGAGC
                      ____________________________________________________________
consensus AATAACAAATGTGATACC-AAAATAAGCCAAGGGCACGGCGAGAATCCATGGCAAGGAGC
 
. : . : . : . : . : . :
rJMSF038H14- TCCCACCGACACGAGGCCCAGGAATTGCCTGAGTGACGGAGCCCGTGAATTCAACGAGGT
JMSF038H14+ TCCCACCGACACGAGGCCCAGGAATTGCCTGAGTGACGGAGCCCGTGAATTCAACGAGGT
                      ____________________________________________________________
consensus TCCCACCGACACGAGGCCCAGGAATTGCCTGAGTGACGGAGCCCGTGAATTCAACGAGGT
 
. : . : . : . : . : . :
rJMSF038H14- CCAATGCCTTTTCCTGTATCCACGGTAGTTCTTCCTCCACC
JMSF038H14+ CCAATGCCTTTTCCTGTATCCACGGTAGTTCTTCCTCCACCTCTCCTACTTCTTCTTCTT
JMSF017H15+ ATCCACGGTAGTTCTTCCTCCACCTCTTCTACTTCTTCTTCTT
                      ____________________________________________________________
consensus CCAATGCCTTTTCCTGTATCCACGGTAGTTCTTCCTCCACCTCTTCTACTTCTTCTTCTT
 
. : . : . : . : . : . :
JMSF017B05+ CGCCGCCGTTTC
JMSF038H14+ CTTCTTCTTCTCCTTGTTTCTCTTGTTTCTTCTCACTATTATCGCCGCCGCCGCCGTTTC
JMSF017H15+ CTTCTTCTTCTCCTTGTTTCTCTTGTTTCTTCTCACTATNATCGCCGCCGCCGCCGTTTC
JMSF008D20+ C
                      ____________________________________________________________
consensus CTTCTTCTTCTCCTTGTTTCTCTTGTTTCTTCTCACTATTATCGCCGCCGCCGCCGTTTC
 
. : . : . : . : . : . :
JMSF017B05+ TCGTAGCGGCCGCCGCTCGGGCGAAGGCCGATGAGCGGCCTGTGGAAGGTAAGGGGAAGA
JMSF038H14+ TCGTAGCGGCCGCCGCTCGGGCGAAGGCCGATGAGCGGCCTGTGGAAGGTAAGGGGAAGA
JMSF017H15+ TCGTAGCGGCCGCCGCTCGGGCGAAGGCCGATGAGCGGCCTGTGGAAGGTAAGGGGAAGA
JMSF008D20+ TCGTAGCGGCCGCCGCTCGGGCGAAGGCCGATGAGCGGCCTGTGGAAGGTAAGGGGAAGA
                      ____________________________________________________________
consensus TCGTAGCGGCCGCCGCTCGGGCGAAGGCCGATGAGCGGCCTGTGGAAGGTAAGGGGAAGA
 
. : . : . : . : . : . :
JMSF017B05+ AAATATGATTGAATTTGCAGCTGTTTAAGTGTGGTATTTTCAATTTTGGGAAATGGGAAG
JMSF038H14+ AAATATGATTGAATTTGCAGCTGTTTAAGTGTGGTATTTTCAATTTTGGGAAATGGGAAG
JMSF017H15+ AAATATGATTGAATTNGCAGCTGTTTAAGTGTGGTATTTTCAATTTTGGGAAATGGGAAG
JMSF012H04+ TTTGGGAAATGGGAAG
JMSF008D20+ AAATATGATTGAATTTGCAGCTGTTTAAGTGTGGTATTTTCAATTTTGGGAAATGGGAAG
                      ____________________________________________________________
consensus AAATATGATTGAATTTGCAGCTGTTTAAGTGTGGTATTTTCAATTTTGGGAAATGGGAAG
 
. : . : . : . : . : . :
JMSF017B05+ GTCTCTTGATGACGGAAGCGGCGGCGGCGGCGGCAGGAGGAGATAGACTGGGTAGGCATT
JMSF038H14+ GTCTCTTGATGACGGAAGCGGCGGCGGCGGCGGCAGGAGGAGATAGACTGGGTAGGCATT
JMSF017H15+ GTCTCTTGATGACGGAAGCGGCGGCGGCGGCGGCAGGAGGAGATAGACTGGGTAGGCATT
JMSF012H04+ GTCTCTTGATGACGGAAGCGGCGGCGGCGGCGGCAGGAGGAGATAGACTGGGTAGGCATT
JMSF008D20+ GTCTCTTGATGACGGAAGCGGCGGCGGCGGCGGCAGGAGGAGATAGACTGGGTAGGCATT
                      ____________________________________________________________
consensus GTCTCTTGATGACGGAAGCGGCGGCGGCGGCGGCAGGAGGAGATAGACTGGGTAGGCATT
 
. : . : . : . : . : . :
JMSF017B05+ GGGAATTACGAACGAGAGAACAGTTGTAAACGCTAGTACAAGAAGAAGACGCCATTGCAG
JMSF038H14+ GGGAATTACGAACGAGAGAACAGTTGTAAACGCTAGTACAAGAAGAAGACGCCATTGCAG
JMSF017H15+ GGGAATTACGAACGAGAGAACAGTTGTAAACGCTAGTACAAGAAGAAGACGCCATTGCAG
JMSF012H04+ GGGAATTACGAACGAGAGAACAGTTGTAAACGCTAGTACAAGAAGAAGACGCCATTGCAG
JMSF008D20+ GGGAATTACGAACGAGAGAACAGTTGTAAACGCTAGTACAAGAAGAAGACGCCATTGCAG
                      ____________________________________________________________
consensus GGGAATTACGAACGAGAGAACAGTTGTAAACGCTAGTACAAGAAGAAGACGCCATTGCAG
 
. : . : . : . : . : . :
JMSF017B05+ AGAAGGGAAGCAGCTCTTTGAGATTAATGTTTAAGCGGCGGCGAATGTATTTGCGGCAGC
JMSF038H14+ AGAAGGGAAGCAGCTCTTTGAGATTAATGTTTAAGCGGCGGCGAATGTATTTGCGGCAGC
JMSF017H15+ AGAAGGGAAGCAGCTCTTTGAGATTAATGTTTAAGCGGCGGCGAATGTATTTGCGGCAGC
JMSF012H04+ AGAAGGGAAGCAGCTCTTTGAGATTAATGTTTAAGCGGCGGCGAATGTATTTGCGGCAGC
JMSF008D20+ AGAAGGGAAGCAGCTCTTTGAGATTAATGTTTAAGCGGCGGCGAATGTATTTGCGGCAGC
                      ____________________________________________________________
consensus AGAAGGGAAGCAGCTCTTTGAGATTAATGTTTAAGCGGCGGCGAATGTATTTGCGGCAGC
 
. : . : . : . : . : . :
JMSF017B05+ AAAGCAGGCCGGCGAGAATCAATCTGGGCTCTAGTTTTCTGGGACGTTTGCTATCCT
JMSF038H14+ AAAGCAGGCCGGCGAGAATCAATCTGGGCTCTAGTTTTCTGGGACGTTTGCTATCCTT
JMSF017H15+ AAAGCAGGCCGGGGAGAATCAATCTGGGCTCTAGTTTTCTGGGACGTTTGCTATCCTT
JMSF012H04+ AAAGCAGGCCGGCGAGAATCAATCTGGGCTCTAGTTTTCTGGGACGTTTGCTATCCTT
JMSF008D20+ AAAGCAGGCCGGGGAGAATCAATCTGGGCTCTAGTTTTCTGGGACGTTTGCTATCCTTCC
                      ____________________________________________________________
consensus AAAGCAGGCCGGCGAGAATCAATCTGGGCTCTAGTTTTCTGGGACGTTTGCTATCCTTCC