Previous Contig 004964:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFN033N14Sequence546004964 (15)gb:AY087830_15728573e-16Arabidopsis thaliana clone 38751 mRNA, complete sequence.
JMSF008D17Sequence367004964 (15)pir|F96748|F967482e-06unknown protein T10D10.8 [imported] - Arabidopsis thaliana>gb:AE005173_894792 Ar814004964 (15)gb:AY087830_15728573e-07Arabidopsis thaliana clone 38751 mRNA, complete sequence.
JMSF009H14Sequence443004964 (15)pir|F96748|F967483e-06unknown protein T10D10.8 [imported] - Arabidopsis thaliana>gb:AE005173_894792 Ar758004964 (15)gb:AY087830_15728573e-07Arabidopsis thaliana clone 38751 mRNA, complete sequence.
JMSF028A23Sequence669004964 (15)pir|F96748|F967482e-14unknown protein T10D10.8 [imported] - Arabidopsis thaliana>gb:AE005173_894792 Ar735004964 (15)gb:AY087830_15728573e-07Arabidopsis thaliana clone 38751 mRNA, complete sequence.
JMSF036M21Sequence669004964 (15)pir|F96748|F967482e-14unknown protein T10D10.8 [imported] - Arabidopsis thaliana>gb:AE005173_894792 Ar629004964 (15)gb:AY087830_15728579e-08Arabidopsis thaliana clone 38751 mRNA, complete sequence.
JMSF047G22Sequence679004964 (15)pir|F96748|F967483e-14unknown protein T10D10.8 [imported] - Arabidopsis thaliana>gb:AE005173_894792 Ar754004964 (15)gb:AP005198_18493233e-12Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC clone:P061
JMSF047G23Sequence677004964 (15)pir|F96748|F967483e-14unknown protein T10D10.8 [imported] - Arabidopsis thaliana>gb:AE005173_894792 Ar700004964 (15)gb:AY087830_15728571e-07Arabidopsis thaliana clone 38751 mRNA, complete sequence.
JMSF052E17Sequence681004964 (15)pir|F96748|F967483e-14unknown protein T10D10.8 [imported] - Arabidopsis thaliana>gb:AE005173_894792 Ar841004964 (15)gb:AP005198_18493234e-12Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC clone:P061

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF008D17- ATTGAATATACACCTCA
                      ____________________________________________________________
consensus ATTGAATATACACCTCA
 
. : . : . : . : . : . :
rJMSF036M21- ATATGCATCACATATATAAAGAATATTCGTTGACTT
rJMSF008D17- TAGTGTTCATTACATTTTAAACAAATATGCATCACATATATAAAGAATATTCGTTGACTT
rJMSF009H14- TATTCGTTGACTT
rJMSF052E17- GTTCATTACATTTTAAACAAATATGCATCACATATATAAAGAATATTCGTTGACTT
                      ____________________________________________________________
consensus TAGTGTTCATTACATTTTAAACAAATATGCATCACATATATAAAGAATATTCGTTGACTT
 
. : . : . : . : . : . :
rJMSF036M21- GACCAAGTTTGGTGAGCCAAAGTGAGAGCAATAAGTGATGACAACTACATCTATCTATCA
rJMSF008D17- GACCAAGTTTGGTGAGCCAAAGTGAGAGCAATAAGTGATGACAACTACATCTATCTATCA
rJMSF028A23- AGTTTGGTGAGCC-AAGTGAGAGCAATAAGTGATGACAACTACATCTATCTATCA
rJMSF009H14- GACC-AGTTTGGTGAGCCAAAGTGAGAGCAATAAGTGATGACAACTACATCTATCTATCA
rJMSF052E17- GACCAAGTTTGGTGAGCCAAAGTGAGAGCAATAAGTGATGACAACTACATCTATCTATCA
rJMSF047G23- CTACATCTATCTATCA
rJMSF047G22- AAGTGATGACAACTACATCTATCTATCA
                      ____________________________________________________________
consensus GACCAAGTTTGGTGAGCCAAAGTGAGAGCAATAAGTGATGACAACTACATCTATCTATCA
 
. : . : . : . : . : . :
rJMSF036M21- TGT-GTAAAACGCAGCTGAGACAAG-TTGGTGGGTAATCCACTAAAAAAAAGTCAGAGAA
rJMSF008D17- TGT-GTAAAACGCAGCTGAGACAAG-TTGGTGGGTAATCCACTAAAAAAAAGTCAGAGAA
rJMSF028A23- TGT-GTAAAACGCAGCTGAGACAAG-TTGGTGGGTAATCCACTAAAAAAAAGTCAGAGAA
rJMSF009H14- TGT-GTAAAACGCAGCTGAGACAAG-TTGGTGGGTAATCCACTAAAAAAAAGTCAGAGAA
rJMSF052E17- TGT-GTAAAACGCAGCTGAGACAAG-TTGGTGGGTAATCCACTAAAAAAAAGTCAGAGAA
rJMSF047G23- TGTGGTAAAACGCAGCTGAGACAAGCTTGGTGGGTAATCCACTAAAAAAAAGTCAGAGAA
rJMSF047G22- TGT-GTAAAACGCAGCTGAGACAAG-TTGGTGGGTAATCCACTAAAAAAAAGTCAGAGAA
                      ____________________________________________________________
consensus TGT-GTAAAACGCAGCTGAGACAAG-TTGGTGGGTAATCCACTAAAAAAAAGTCAGAGAA
 
. : . : . : . : . : . :
rJMSF036M21- AGGAGGCTAGTTAGGTGCCCTGCAGGGAGGGACAGGGAAGACTATTGAATGCAATAGGAG
rJMSF008D17- AGGAGGCTAGTTAGGTGCCCTGCAGGGAGGGACAGGGAAGACTATTGAATGCAATAGGAG
rJMSF028A23- AGGAGGCTAGTTAGGTGCCCTGCAGGGAGGGACAGGGAAGACTATTGAATGCAATAGGAG
rJMSF009H14- AGGAGGCTAGTTAGGTGCCCTGCAGGGAGGGACAGGGAAGACTATTGAATGCAATAGGAG
rJMSF052E17- AGGAGGCTAGTTAGGTGCCCTGCAGGGAGGGACAGGGAAGACTATTGAATGCAATAGGAG
rJMSF047G23- AGGAGGCTANTTAGGTGCCCTGCAGGGAGGGACAGGGAAGACTATTGAATGCNATAGGAG
rJMSF047G22- AGGAGGCTAGTTAGGTGCCCTGCAGGGAGGGACAGGGAAGACTATTGAATGCAATAGGAG
                      ____________________________________________________________
consensus AGGAGGCTAGTTAGGTGCCCTGCAGGGAGGGACAGGGAAGACTATTGAATGCAATAGGAG
 
. : . : . : . : . : . :
rJMSF036M21- AGGAAGGATTAAACAAAAATGGTCAGATCTATAAGCAGCTGCTGCTGATATGGACTATAA
rJMSF008D17- AGGAAGGATTAAACAAAAATGGTCAGATCTATAAGCAGCTGCTGCTGATATGGACTATAA
rJMSF028A23- AGGAAGGATTAAACAAAAATGGTCAGATCTATAAGCAGCTGCTGCTGATATGGACTATAA
rJMSF009H14- AGGAAGGATTAAACAAAAATGGTCAGATCTATAAGCAGCTGCTGCTGATATGGACTATAA
rJMSF052E17- AGGAAGGATTAAACAAAAATGGTCAGATCTATAAGCAGCTGCTGCTGATATGGACTATAA
rJMSF047G23- AGGAAGGATTAAACAAAAATGGTCAGATCTATAAGCAGCTGCTGCTGATATGGACTATAA
rJMSF047G22- AGGAAGGATTAAACAAAAATGGTCAGATCTATAAGCAGCTGCTGCTGATATGGACTATAA
                      ____________________________________________________________
consensus AGGAAGGATTAAACAAAAATGGTCAGATCTATAAGCAGCTGCTGCTGATATGGACTATAA
 
. : . : . : . : . : . :
rJMSF036M21- CTTCAAGTTGAGATCCAATTCATCCTTGTTCTTGGGAGACGATTTGTCGCCCTTGGAAGA
rJMSF008D17- CTTCAAGTTGAGATCCAATTCATCCTTGTTCTTGGGAGACGATTTGTCGCCCTTGGAAGA
rJMSF028A23- CTTCAAGTTGAGATCCAATTCATCCTTGTTCTTGGGAGACGATTTGTCGCCCTTGGAAGA
rJMSF009H14- CTTCAAGTTGAGATCCAATTCATCCTTGTTCTTGGGAGACGATTTGTCGCCCTTGGAAGA
rJMSF052E17- CTTCAAGTTGAGATCCAATTCATCCTTGTTCTTGGGAGACGATTTGTCGCCCTTGGAAGA
rJMSF047G23- CTTCAAGTTGAGATCCAATTCATCCTTGTTCTTGGGAGACGATTTGTCGCCCTTGGAAGA
rJMSF047G22- CTTCAAGTTGAGATCCAATTCATCCTTGTTCTTGGGAGACGATTTGTCGCCCTTGGAAGA
JMFN033N14+ GTTCTTGGGAGACGATTTGTCGCCCTTGGAAGA
                      ____________________________________________________________
consensus CTTCAAGTTGAGATCCAATTCATCCTTGTTCTTGGGAGACGATTTGTCGCCCTTGGAAGA
 
. : . : . : . : . : . :
rJMSF036M21- TGAGGCTATGAAGTGAAGCCTCGTTCTTGGAAGACGATAGGGCTTAAACGCCGAAAGTCA
rJMSF008D17- TGAGGCTATGAAGTGAAGCCTCGTTCTTGGAAGACGATAGGGCTTAAACGCCGAAAGTCA
rJMSF028A23- TGAGGCTATGAAGTGAAGCCTCGTTCTTGGAAGACGATAGGGCTTAAGCGCCGAAAGTCA
rJMSF009H14- TGAGGCTATGAAGTGAAGCCTCGTTCTTGGAAGACGATAGGGCTTAAACGCCGAAAGTCA
rJMSF052E17- TGAGGCTATGAAGTGAAGCCTCGTTCTTGGAAGACGATAGGGCTTAAACGCCGAAAGTCA
rJMSF047G23- TGAGGCTATGAAGTGAAGCCTCGTTCTTGGAAGACGATAGGGCTTAAACGCCGAAAGTCA
rJMSF047G22- TGAGGCTATGAAGTGAAGCCTCGTTCTTGGAAGACGATAGGGCTTAAACGCCGAAAGTCA
JMFN033N14+ TGAGGCTATGAAGGGAAGCCTCGTTCTGGGAAGACGATAGGGCTTAAACGCCGAAAGTCA
                      ____________________________________________________________
consensus TGAGGCTATGAAGTGAAGCCTCGTTCTTGGAAGACGATAGGGCTTAAACGCCGAAAGTCA
 
. : . : . : . : . : . :
rJMSF036M21- GGCCTATGAAATTGACGGATTACAGCTTGAAGTTGAGGTCTAGTTCATCCTCGGCCTTGG
rJMSF008D17- GGCCTATGAAATTGACGGATTACAGCTTGAAGTTGAGGTCTAGTTCATCCTCGGCCTTGG
rJMSF028A23- GGCCTATGAAATTGACGGATTACAGCTTGAAGTTGAGGTCTAGTTCATCCTCGGCCTTGG
rJMSF009H14- GGCCTATGAAATTGACGGATTACAGCTTGAAGTTGAGGTCTAGTTCATCCTCGGCCTTGG
rJMSF052E17- GGCCTATGAAATTGACGGATTACAGCTTGAAGTTGAGGTCTAGTTCATCCTCGGCCTTGG
rJMSF047G23- GGCCTATGAAATTGACGGATTACAGCTTGAAGTTGAGGTCTAGTTCATCCTCGGCCTTGG
rJMSF047G22- GGCCTATGAAATTGACGGATTACAGCTTGAAGTTGAGGTCTAGTTCATCCTCGGCCTTGG
JMFN033N14+ GGCCTATGAAATTGGCGGATTACAGCTTGAAGTTGAGGTCTAGTTCATCCTCGGCCTTGG
                      ____________________________________________________________
consensus GGCCTATGAAATTGACGGATTACAGCTTGAAGTTGAGGTCTAGTTCATCCTCGGCCTTGG
 
. : . : . : . : . : . :
rJMSF036M21- AAGAAGAAGCCTCGTTCTTGGAAGACGACCCTTCGTTCTTTGCTGATGGAGCGACTGGAT
rJMSF008D17- AAGAAGAAGCCTCGTTCTTGGAAGACGACCCTTCGTTCTTTGCTGATGGAGCGACTGGAT
rJMSF028A23- AAGAAGAAGCCTCGTTCTTGGAAGACGACCCTTCGTTCTTTGCTGATGGAGCGACTGGAT
rJMSF009H14- AAGAAGAAGCCTCGTTCTTGGAAGACGACCCTTCGTTCTTTGCTGATGGAGCGACTGGAT
rJMSF052E17- AAGAAGAAGCCTCGTTCTTGGAAGACGACCCTTCGTTCTTTGCTGATGGAGCGACTGGAT
rJMSF047G23- AAGAAGAAGCCTCGTTCTTGGAAGACGACCCTTCGTTCTTTGCTGATGGAGCGACTGGAT
rJMSF047G22- AAGAAGAAGCCTCGTTCTTGGAAGACGACCCTTCGTTCTTTGCTGATGGAGCGACTGGAT
JMFN033N14+ AAGAAGAAGCCTCGTTCTTGGAAGACGACCCTTCGTTCTTTGCTGATGGAGCGACTGGAT
                      ____________________________________________________________
consensus AAGAAGAAGCCTCGTTCTTGGAAGACGACCCTTCGTTCTTTGCTGATGGAGCGACTGGAT
 
. : . : . : . : . : . :
rJMSF036M21- TATGTAGTTGGTATGGCGCTCTAGCCGTGGCCCTATCCTTCCTCTTCTCAAGGAATCGGT
rJMSF008D17- TATGTAGTTGGTATGGCGCTCTAGCCGTGGCCCTATCCTTCCTCTTCTCAAGGAATCGGT
rJMSF028A23- TATGTAGTTGGTATGGCGCTCTAGCCGTGGCCCTATCCTTCCTCTTCTCAAGGAATCGGT
rJMSF009H14- TATGTAGTTGGTATGGCGCTCTAGCCGTGGCCCTATCCTTCCTCTTCTCAAGGAATCGGT
rJMSF052E17- TATGTAGTTGGTATGGCGCTCTAGCCGTGGCCCTATCCTTCCTCTTCTCAAGGAATCGGT
rJMSF047G23- TATGTAGTTGGTATGGCGCTCTAGCCGTGGCCCTATCCTTCCTCTTCTCAAGGAATCGGT
rJMSF047G22- TATGTAGTTGGTATGGCGCTCTAGCCGTGGCCCTATCCTTCCTCTTCTCAAGGAATCGGT
JMFN033N14+ TATGTAGTTGGTATGGCGCTCTAGCCGTGGCCCTATCCTTCCTCTTCTCAAGGAATCGGT
                      ____________________________________________________________
consensus TATGTAGTTGGTATGGCGCTCTAGCCGTGGCCCTATCCTTCCTCTTCTCAAGGAATCGGT
 
. : . : . : . : . : . :
rJMSF036M21- GAAGGGATGATCTTCTTGCAATTGGAAGATCAGAAACATTAGATCCTGAAGGCGA
rJMSF008D17- GAAGGGATGATCTTCTTGCAATTGGAAGATCAGAAACATTAGATCCTGAAGGCGAAGAAA
rJMSF028A23- GAAGGGATGATCTTCTTGCAATTGGAAGATCAGAAACATTAGATCCTGAAGGCGAAGAAA
rJMSF009H14- GAAGGGATGATCTTCTTGCAATTGGAAGATCAGAAACATTAGATCCTGAAGGCGAAGAAA
rJMSF052E17- GAAGGGATGATCTTCTTGCAATTGGAAGATCAGAAACATTAGATCCTGAAGGCGAAGAAA
rJMSF047G23- GAAGGGATGATCTTCTTGCAATTGGAAGATCNGAAACATTANATCCTGAANGCGAANAAA
rJMSF047G22- GAAGGGATGATCTTCTTGCAATTGGAAGATCAGAAACATTAGATCCTGAAGGCGAAGAAA
JMFN033N14+ GAAGGGATGATCTTCTTGCAATTGGAAGATCAGAAACATTAGATCCTGAAGGCGAAGAAG
                      ____________________________________________________________
consensus GAAGGGATGATCTTCTTGCAATTGGAAGATCAGAAACATTAGATCCTGAAGGCGAAGAAA
 
. : . : . : . : . : . :
rJMSF008D17- CTTGGGGTGAAGATGGTGCAGGACTTGCAGTCCTCCTAGGC-GGGGGGTTGGCTGAGTTA
rJMSF028A23- CTTGGGGTGAAGATGGTGCAGGACTTGCAGTCCTCCTAGGC-GGGGGGTTGGCTGAGTTA
rJMSF009H14- CTTGGGGTGAAGATGGTGCAGGACTTGCAGTCCTCCTAGGC-GGGGGGTTGGCTGAGTTA
rJMSF052E17- CTTGGGGTGAAGATGGTGCAGGACTTGCAGTCCTCCTAGGC-GGGGGGTTGGCTGAGTTA
rJMSF047G23- CTTGGGGTGAANATGGTGCAGGACTTGCAGTCCTCCTANGCNGGGGGGTTGGCTGAGTTA
rJMSF047G22- CTTGGGGTGAAGATGGTGCAGGACTTGCAGTCCTCCTAGGC-GGGGGGTTGGCTGAGTTA
JMFN033N14+ CTTGGGGTGAAGATGGTGCAGGACTTGCAGTCCTCCTAGGC-GGGGGGTTGGCTGAGTTA
JMSF047G23+ TAGGC-GGGGGGTTGGCTGAGTTA
JMSF052E17+ TAGGC-GGGGGGTTGGCTGAGTTA
JMSF047G22+ CCTAGGC-GGGGGGTTGGCTGAGTTA
JMSF036M21+ GGCTGAGTTA
JMSF028A23+ GGCTGAGTTA
                      ____________________________________________________________
consensus CTTGGGGTGAAGATGGTGCAGGACTTGCAGTCCTCCTAGGC-GGGGGGTTGGCTGAGTTA
 
. : . : . : . : . : . :
rJMSF008D17- GCCGCTACAGGCTGGATTTCTGCACCAGCAGTCTGGAAAACGCCCTGAGGGCTTACTTTG
rJMSF028A23- GCCGCTACAGGCTGGATTTCTGCACCAGCAGTCTGGAAAACGCCCTGAGGGCTTACTTTG
rJMSF009H14- GCCGCTACAGGCTGGATTTCTGCACCAGCAGTCTGGAAAACGCCCTGAGGGCTTACTTTG
rJMSF052E17- GCCGCTACAGGCTGGATTTCTGCACCAGCAGTCTGGAAAACGCCATGAGGGCTTACTTTG
rJMSF047G23- GCCGCTACAGGCTGGATTTCTGCACCAGCAGTCTGGAAAACGCCCTGAGGGCTTACTTTG
rJMSF047G22- GCCGCTACAGGCTGGATTTCTGCACCAGCAGTCTGGAAAACGCCCTGAGGGCTTACTTTG
JMFN033N14+ GCCGCTACAGGCTGGATTTCTGCACCAGCAGTCTGGAAAACGCCCTGAGGGCTTACTTTG
JMSF047G23+ GCCGCTACAGGCTGGATTTCTGCACCAGCAGTCTGGAAAACGCCCTGAGGGCTTACTTTG
JMSF052E17+ GCCGCTACAGGCTGGATTTCTGCACCAGCAGTCTGGAAAACGCCATGAGGGCTTACTTTG
JMSF047G22+ GCCGCTACAGGCTGGATTTCTGCACCAGCAGTCTGGAAAACGCCCTGAGGGCTTACTTTG
JMSF036M21+ GCCGNTACAGGCTGGATTTCTGCACCAGCAGTCTGGAAAACGCCCTGAGGGCTTACTTTG
JMSF028A23+ GCCGCTACAGGCTGGATTTCTGCACCAGCAGTCTGGAAAACGCCCTGAGGGCTTACTTTG
                      ____________________________________________________________
consensus GCCGCTACAGGCTGGATTTCTGCACCAGCAGTCTGGAAAACGCCCTGAGGGCTTACTTTG
 
. : . : . : . : . : . :
rJMSF008D17- C-TGNCAACAACATTACTGCC
rJMSF028A23- CTTGCCAACACCATTACTGCCCTG
rJMSF009H14- CTTGCCANCAACATTACTGCCCTGGCTTT
rJMSF052E17- CTTGCCAACAACATTACTGCCCTGGCTTTGTCGGCCGGGAAATCATCAAACACCATAATC
rJMSF047G23- CTTG-CAACAACATTACTGCCCTGG
rJMSF047G22- CTTGCCAACAACATTACTGCCCTGGCTTTGTCGGCCGGGAAATCATCAAACACCATAATC
JMFN033N14+ CTTGCCAACAACATTACTGCCCTGGCTTTGTCGGCCGGGAAATCATCAAACACCATAATC
JMSF047G23+ CTTGCCAACAACATTACTGCCCTGGCTTTGTCGGCCGGGAAATCATCAAACACCATAATC
JMSF052E17+ CTTGCCAACAACATTACTGCCCTGGCTTTGTCGGCCGGGAAATCATCAAACACCATAATC
JMSF047G22+ CTTGCCAACAACATTACTGCCCTGGCTTTGTCGGCCGGGAAATCATCAAACACCATAATC
JMSF036M21+ CTTGCCAACAACATTACTGCCCTGGCTTTGTCGGCCGGGAAATCATCAAACACCATAATC
JMSF028A23+ CTTGCCAACAACATTACTGCCCTGGCTTTGTCGGCCGGGAAATCATCAAACACCATAATC
                      ____________________________________________________________
consensus CTTGCCAACAACATTACTGCCCTGGCTTTGTCGGCCGGGAAATCATCAAACACCATAATC
 
. : . : . : . : . : . :
rJMSF052E17- TTGCCGGA
rJMSF047G22- TTGCCGGAG
JMFN033N14+ TTGCCGGAGTAGAAAATAGTCAGTGGAGC
JMSF047G23+ TTGCCGGAGTAGAAAATAGTCAGTGGAGCAGCCTTGGGCTCTCTTGGTGCTTCTTTGCTA
JMSF052E17+ TTGCCGGAGTAGAAAATAGTCAGTGGAGCAGCCTTGGGCTCTCTTGGTGCTTCTTTGCTA
JMSF047G22+ TTGCCGGAGTAGAAAATAGTCAGTGGAGCAGCCTTGGGCTCTCTTGGTGCTTCTTTGCTA
JMSF036M21+ TTGCCGGAGTAGAAAATAGTCAGTGGAGCAGCCTTGGGCTCTCTTGGTGCTTCTTTGCTA
JMSF028A23+ TTGCCGGAGTAGAAAATAGTCAGTGGAGCAGCCTTGGGCTCTCTTGGTGCTTCTTTGCTA
                      ____________________________________________________________
consensus TTGCCGGAGTAGAAAATAGTCAGTGGAGCAGCCTTGGGCTCTCTTGGTGCTTCTTTGCTA
 
. : . : . : . : . : . :
JMSF047G23+ GTACTAGCTTCATTTGCGTTTTCCTCAATTGTTCTAACAGACCCCATAGCATCATCCTGC
JMSF052E17+ GTACTAGCTTCATTTGCGTTTTCCTCAATTGTTCTAACAGACCCCATAGCATCATCCTGC
JMSF047G22+ GTACTAGCTTCATTTGCGTTTTCCTCAATTGTTCTAACAGACCCCATAGCATCATCCTGC
JMSF036M21+ GTACTAGCTTCATTTGCGTTTTCCTCAATTGTTCTAACAGACCCCATAGCATCATCCTGC
JMSF009H14+ TCTAACAGACCCCATAGCATCATCCTGC
JMSF028A23+ GTACTAGCTTCATTTGCGTTTTCCTCAATTGTTCTAACAGACCCCATAGCATCATCCTGC
                      ____________________________________________________________
consensus GTACTAGCTTCATTTGCGTTTTCCTCAATTGTTCTAACAGACCCCATAGCATCATCCTGC
 
. : . : . : . : . : . :
JMSF047G23+ TCAGTGAGGGGATCTGTGGAATTCAAGTCCAGTTCTGGAATCTGACTTGATTTCTCCATG
JMSF052E17+ TCAGTGAGGGGATCTGTGGAATTCAAGTCCAGTTCTGGAATCTGACTTGATTTCTCCATG
JMSF047G22+ TCAGTGAGGGGATCTGTGGAATTCAAGTCCAGTTCTGGAATCTGACTTGATTTCTCCATG
JMSF036M21+ TCAGTGAGGGGATCTGTGGAATTCAAGTCCAGTTCTGGAATCTGACTTGATTTCTCCATG
JMSF009H14+ TCAGTGAGGGGATCTGTGGAATTCAAGTCCAGTTCTGGAATCTGACTTGATTTCTCCATG
JMSF028A23+ TCAGTGAGGGGATCTGTGGAATTCAAGTCCAGTTCTGGAATCTGACTTGATTTCTCCATG
JMSF008D17+ CTCCATG
                      ____________________________________________________________
consensus TCAGTGAGGGGATCTGTGGAATTCAAGTCCAGTTCTGGAATCTGACTTGATTTCTCCATG
 
. : . : . : . : . : . :
JMSF047G23+ TTGGCTAGGAAATCT-ATGGTGGTTGCAGCATTAGACATATCAGATTTCCCTGCAGCCTC
JMSF052E17+ TTGGCTAGGAAATCT-ATGGTGGTTGCAGCATTAGACATATCAGATTTCCCTGCAGCCTC
JMSF047G22+ TTGGCTAGGAAATCT-ATGGTGGTTGCAGCATTAGACATATCAGATTTCCCTGCAGCCTC
JMSF036M21+ TTGGCTAGGAAATCT-ATGGTGGTTGCAGCATTAGACATATCAGATTTCCCTGCAGCCTC
JMSF009H14+ TTGGCTAGGAAATCT-ATGGTGGTTGCAGCATTAGACATATCAGATTTCCCTGCAGCCTC
JMSF028A23+ TTGGCTAGGAAATCT-ATGGTGGTTGCAGCATTAGACATATCAGATTTCCCTGCAGCCTC
JMSF008D17+ TNGGCTAGGAAATCTAATGGTGGTTGCAGCATTAGACATATCAGATTTCCCTGCAGCCTC
                      ____________________________________________________________
consensus TTGGCTAGGAAATCT-ATGGTGGTTGCAGCATTAGACATATCAGATTTCCCTGCAGCCTC
 
. : . : . : . : . : . :
JMSF047G23+ CAATTTGCCACGAATTTCAAGACCCAGATCTCTGCGGCTGCCTTTCCCTTTGAGGAACTG
JMSF052E17+ CAATTTGCCACGAATTTCAAGACCCAGATCTCTGCGGCTGCCTTTCCCTTTGAGGAACTG
JMSF047G22+ CAATTTGCCACGAATTTCAAGACCCAGATCTCTGCGGCTGCCTTTCCCTTTGAGGAACTG
JMSF036M21+ CAATTTGCCACGAATTTCAAGACCCAGATCTCTGCGGCTGCCTTTCCCTTTGAGGAACTG
JMSF009H14+ CAATTTGCCACGAATTTCAAGACCCAGATCTCTGCGGCTGCCTTTCCCTTTGAGGAACTG
JMSF028A23+ CAATTTGCCACGAATTTCAAGACCCAGATCTCTGCGGCTGCCTTTCCCTTTGAGGAACTG
JMSF008D17+ CAATTTGCCACGAATTTCAAGACCCAGATCTCTGCGGCTGCCTTTCCCTTTGAGGAACTG
                      ____________________________________________________________
consensus CAATTTGCCACGAATTTCAAGACCCAGATCTCTGCGGCTGCCTTTCCCTTTGAGGAACTG
 
. : . : . : . : . : . :
JMSF047G23+ ACCCAGGAGGCTGCAAGTCTGCGAGAAATTCGACTTCTCCGGCGCCCTGCCGGCCCTTCC
JMSF052E17+ ACCCAGGAGGCTGCAAGTCTGCGAGAAATTCGACTTCTCCGGCGCCCTGCCGGCCCTTCC
JMSF047G22+ ACCCAGGAGGCTGCAAGTCTGCGAGAAATTCGACTTCTCCGGCGCCCTGCCGGCCCTTCC
JMSF036M21+ ACCCAGGAGGCTGCAAGTCTGCGAGAAATTCGACTTCTCCGGCGCCCTGCCGGCCCTTCC
JMSF009H14+ ACCCAGGAGGCTGCAAGTCTGCGAGAAATTCGACTTCTCCGGCGCCCTGCCGGCCCTTCC
JMSF028A23+ ACCCAGGAGGCTGCAAGTCTGCGAGAAATTCGACTTCTCCGGCGCCCTGCCGGCCCTTCC
JMSF008D17+ ACCCAGGAGGCTGCAAGTCTGCGAGAAATTCGACTTCTCCGGCGCCCTGCCGGCCCTTCC
                      ____________________________________________________________
consensus ACCCAGGAGGCTGCAAGTCTGCGAGAAATTCGACTTCTCCGGCGCCCTGCCGGCCCTTCC
 
. : . : . : . : . : . :
JMSF047G23+ ACCGTCCAACGGCAGCTGCATGGTCAAGATTTTCTTGATTTTCCGGCGAAGAACGAAGAT
JMSF052E17+ ACCGTCCAACGGCAGCTGCATGGTCAAGATTTTCTTGATTTTCCGGCGAAGAACGAAGAT
JMSF047G22+ ACCGTCCAACGGCAGCTGCATGGTCAAGATTTTCTTGATTTTCCGGCGAAGAACGAAGAT
JMSF036M21+ ACCGTCCAACGGCAGCTGCATGGTCAAGATTTTCTTGATTTTCCGGCGAAGAACGAAGAT
JMSF009H14+ ACCGTCCAACGGCAGCTGCATGGTCAAGATTTTCTTGATTTTCCGGCGAAGAACGAAGAT
JMSF028A23+ ACCGTCCAACGGCAGCTGCATGGTCAAGATTTTCTTGATTTTCCGGCGAAGAACGAAGAT
JMSF008D17+ ACCGTCCAACGGCAGCTGCATGGTCAAGATTTTCTTGATTTTCCGGCGAAGAACGAAGAT
                      ____________________________________________________________
consensus ACCGTCCAACGGCAGCTGCATGGTCAAGATTTTCTTGATTTTCCGGCGAAGAACGAAGAT
 
. : . : . : . : . : . :
JMSF047G23+ TAAGAAAAAAGCGGCGAGCTTGTTGCTGTAGTGCACCGGAAGCTATTCAGAGTATCTGAT
JMSF052E17+ TAAGAAAAAAGCGGCGAGCTTGTTGCTGTAGTGCACCGGAAGCTATTCAGAGTATCTGAT
JMSF047G22+ TAAGAAAAAAGCGGCGAGCTTGTTGCTGTAGTGCACCGGAAGCTATTCAGAGTATCTGAT
JMSF036M21+ TAAGAAAAAAGCGGCGAGCTTGTTGCTGTAGTGCACCGGAAGCTATTCAGAGTATCTGAT
JMSF009H14+ TAAGAAAAAAGCGGCGAGCTTGTTGCTGTAGTGCACCGGAAGCTATTCAGAGTATCTGAT
JMSF028A23+ TAAGAAAAAAGCGGCGAGCTTGTTGCTGTAGTGCACCGGAAGCTATTCAGAGTATCTGAT
JMSF008D17+ TAAGAAAAAAGCGGCGAGCTTGTTGCTGTAGTGCACCGGAAGCTATTCAGAGTATCTGAT
                      ____________________________________________________________
consensus TAAGAAAAAAGCGGCGAGCTTGTTGCTGTAGTGCACCGGAAGCTATTCAGAGTATCTGAT
 
. : . : . : . : . : . :
JMSF047G23+ ACAGAGGGAGGAAGAGTCCGGAATATATGGGTAGACTGGATTCAAAGGCTGCAC
JMSF052E17+ ACAGAGGGAGGAAGAGTCCGGAATATATGGGTAGACTGGATTCAAAGGCTGC
JMSF047G22+ ACAGAGGGAGGAAGAGTCCGGAATATATGGGTAGACTGGATTCAAAGGCTGCAC
JMSF036M21+ ACAGAGGGAGGAAGAGTCCGGAATATATGGGTAGACTGGATTCAAAGGCTGCAC
JMSF009H14+ ACAGAGGGAGGAAGAGTCCGGAATATATGGGTAGACTGGATTCAAAGGCTGCAC
JMSF028A23+ ACAGAGGGAGGAAGAGTCCGGAATATATGGGTAGACTGGATTCAAAGGCTGCAC
JMSF008D17+ ACAGAGGGAGGAAGAGTCCGGAATATATGGGTAGACTGGATTCAAAGGCTGCACAGGTCC
                      ____________________________________________________________
consensus ACAGAGGGAGGAAGAGTCCGGAATATATGGGTAGACTGGATTCAAAGGCTGCACAGGTCC