Previous Contig 004953:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFN045O21Sequence563004953 (3)
JMSF008C07Sequence267004953 (3)582004953 (3)

Alignment

This contig is upended


. : . : . : . : . : . :
JMFN045O21+ GAGTATATGATATATAATCACGTTTATACTGTAAA
rJMSF008C07- CAAATATGAGTATATGATATATAATCACGTTTATACTGTAAA
                      ____________________________________________________________
consensus CAAATATGAGTATATGATATATAATCACGTTTATACTGTAAA
 
. : . : . : . : . : . :
JMFN045O21+ TTCAATCGAACACAAATTCATATAATCACATTACATACACACTTATTACTGCAAATTAAA
rJMSF008C07- TTCAATCGAACACAAATTCATATAATCACATTACATACACACTTATTACTGCAAATTAAA
                      ____________________________________________________________
consensus TTCAATCGAACACAAATTCATATAATCACATTACATACACACTTATTACTGCAAATTAAA
 
. : . : . : . : . : . :
JMFN045O21+ TCAAAACAAAATCACTATAATAAGGTAAGAATCAAAGAATTATATATAGGAGCTGATCGA
rJMSF008C07- TCAAAACAAAATCACTATAATAAGGTAAGAATCAAAGAATTATATATAGGAGCTGATCGA
                      ____________________________________________________________
consensus TCAAAACAAAATCACTATAATAAGGTAAGAATCAAAGAATTATATATAGGAGCTGATCGA
 
. : . : . : . : . : . :
JMFN045O21+ TCGATGGAGGAATATAATACTATACGGCAATCTAGTTGTTAACTTCGTTGGTTCCTTTGC
rJMSF008C07- TCGATGGAGGAATATAATACTATACGGCAATCTAGTTGTTAACTTCGTTGGTTCCTTTGC
                      ____________________________________________________________
consensus TCGATGGAGGAATATAATACTATACGGCAATCTAGTTGTTAACTTCGTTGGTTCCTTTGC
 
. : . : . : . : . : . :
JMFN045O21+ TCGGTCCGGACGGCGGCAGCCTCCCTTTCGGCAGCATGTGCAGCAGTGACATCACGCGCT
rJMSF008C07- TCGGTCCGGACGGCGGCAGCCTCCCTTTCGGCAGCATGTGCAGCAGTGACATCACGCGCT
                      ____________________________________________________________
consensus TCGGTCCGGACGGCGGCAGCCTCCCTTTCGGCAGCATGTGCAGCAGTGACATCACGCGCT
 
. : . : . : . : . : . :
JMFN045O21+ TCTTTCTCGCGTCTGCAACGCCCGATTCTGAGATTCCGGCGGAGGAGGAGGCGGCGGCGG
rJMSF008C07- TCTTTCTCGCGTCTGCAACGCCCGATTCTGAGATTCCGGCGGAGGAGGAGGCGGCGGCGG
JMSF008C07+ TTCCGGCGGAGGAGGAGGCGGCGGCGG
                      ____________________________________________________________
consensus TCTTTCTCGCGTCTGCAACGCCCGATTCTGAGATTCCGGCGGAGGAGGAGGCGGCGGCGG
 
. : . : . : . : . : . :
JMFN045O21+ CGCCGTGGTTGTCTGTCGGGAGTAGTAAGAGGTTGGAGGAAGATCCGGCGGCGTTTCTGA
rJMSF008C07- CGCCGTGGTTGTCTGTCGGGAGTAGTAAGAGGTTGGAGGAAGATCCGGCGGCGTTTCTGA
JMSF008C07+ CGCCGTGGTTGTCTGTCGGGAGTAGTAAGAGGTTGGAGGAAGATCCGGCGGCGTTTCTGA
                      ____________________________________________________________
consensus CGCCGTGGTTGTCTGTCGGGAGTAGTAAGAGGTTGGAGGAAGATCCGGCGGCGTTTCTGA
 
. : . : . : . : . : . :
JMFN045O21+ GGAAGTGATGGCGGCAGAGTGGTCTGGCGGCTGTCGATGATGATGATGATGAGAATATGA
rJMSF008C07- GGAAGTGATGGCGGCAGAGTGGTCTGGCGGCTGTCGATGATGATGATGATGAGAATATGA
JMSF008C07+ GGAAGTGATGGCGGCAGAGTGGTCTGGCGGCTGTCGATGATGATGATGATGAGAATATGA
                      ____________________________________________________________
consensus GGAAGTGATGGCGGCAGAGTGGTCTGGCGGCTGTCGATGATGATGATGATGAGAATATGA
 
. : . : . : . : . : . :
JMFN045O21+ TTAGGAGAAGGAGGAGGAGGAGAGAGATTGGTGGTGCGGAGGGTTTCATGGCGGATATGA
rJMSF008C07- TTAGGAGAAGGAGGAGGAGGAGAGAGATTGGTGGTGCGGAGGGTTTCATGGCGGATATGA
JMSF008C07+ TTAGGAGAAGGAGGAGGAGGAGAGAGATTGGTGGTGCGGAGGGTTTCATGGCGGATATGA
                      ____________________________________________________________
consensus TTAGGAGAAGGAGGAGGAGGAGAGAGATTGGTGGTGCGGAGGGTTTCATGGCGGATATGA
 
. : . : . : . : . : . :
JMFN045O21+ TGAGAGAGAAATGGGGGATTTTGTGTTGCTGTGGTGAATCTGAGTTGA
rJMSF008C07- TGAGAGAGAAATGGGGGATTTTGTGTTGCTGTGGTGAATCTGANTTGANATTAATTGGTC
JMSF008C07+ TGAGAGAGAAATGGGGGATTTTGTGTTGCTGTGGTGAATCTGAGTTGAGATTAATTGGTC
                      ____________________________________________________________
consensus TGAGAGAGAAATGGGGGATTTTGTGTTGCTGTGGTGAATCTGAGTTGAGATTAATTGGTC