Previous Contig 004951:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF008C03Sequence210004951 (2)148004951 (2)

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF008C03+ GGGGGGGGGCATTGGACTCTGTTAATGTGTA
JMSF008C03- GGGGGGGGGCATTGGACTCTGTTAATGTGTA
                      ____________________________________________________________
consensus GGGGGGGGGCATTGGACTCTGTTAATGTGTA
 
. : . : . : . : . : . :
rJMSF008C03+ AACTTGTTTTCCAGTTGCAGTGGGCAAGTGTAGTTTGGTTTTTCTGTATCTCTGTAAATA
JMSF008C03- AACTTGTTTTCCAGTTGCAGTGGGCAAGTGTAGTTTGGTTTTTCTGTATCTCTGTAAATA
                      ____________________________________________________________
consensus AACTTGTTTTCCAGTTGCAGTGGGCAAGTGTAGTTTGGTTTTTCTGTATCTCTGTAAATA
 
. : . : . : . : . : . :
rJMSF008C03+ TGGAAAATGTTGTATTTTGGTCAATTTGGAATCTCTGANCTTGAACTGTAAACTCTG
JMSF008C03- TGGAAAATGTTGTATTTTGGTCAATTTGGAATCTCTGA-CTTGAACTGTAAACTCTGTTA
                      ____________________________________________________________
consensus TGGAAAATGTTGTATTTTGGTCAATTTGGAATCTCTGANCTTGAACTGTAAACTCTGTTA
 
. : . : . : . : . : . :
JMSF008C03- AGGTATCAACTGATTGGAGGTAACAGTGGCACCACCTTGGTGCCCTTCTTAANAAAAAAA
                      ____________________________________________________________
consensus AGGTATCAACTGATTGGAGGTAACAGTGGCACCACCTTGGTGCCCTTCTTAANAAAAAAA