Previous Contig 004949:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF008B23Sequence276004949 (4)781012254 (4)pir|S65148|S651484e-42tRNA adenylyltransferase (EC 2.7.7.25) - white lupine>gb:LAU15930_1683929 Lupinu
JMSF022H01Sequence117004949 (4)669012254 (4)gb:BT000361_16346392e-27Arabidopsis thaliana tRNA adenylyltransferase-like protein (At1g22660) mRNA, com
JMSF023J10Sequence692004949 (4)pir|S65148|S651486e-62tRNA adenylyltransferase (EC 2.7.7.25) - white lupine>gb:LAU15930_1683929 Lupinu774012254 (4)gb:BT000361_16346391e-43Arabidopsis thaliana tRNA adenylyltransferase-like protein (At1g22660) mRNA, com
JMSF035O14Sequence630004949 (4)pir|S65148|S651485e-49tRNA adenylyltransferase (EC 2.7.7.25) - white lupine>gb:LAU15930_1683929 Lupinu709012254 (4)gb:BT000361_16346391e-35Arabidopsis thaliana tRNA adenylyltransferase-like protein (At1g22660) mRNA, com

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF023J10+ TTCAACCGAACTTGAGTTAATATTGTAAAATAAGCTGTTAATGGTTAA
                      ____________________________________________________________
consensus TTCAACCGAACTTGAGTTAATATTGTAAAATAAGCTGTTAATGGTTAA
 
. : . : . : . : . : . :
JMSF023J10+ GTCCCTGCGATATGCATCCTCTTCTGCAGTGCCAAATCTCATTGTTGGAATACGACTACT
JMSF035O14+ TCTGCAGTGCCAAATCTCATTGTTGGAATACGACTACT
                      ____________________________________________________________
consensus GTCCCTGCGATATGCATCCTCTTCTGCAGTGCCAAATCTCATTGTTGGAATACGACTACT
 
. : . : . : . : . : . :
JMSF023J10+ TTCACTGTAATCTTCTGCTCGCAAGTTAACAAAATCAACCCATACATCACAAAGGCGCAT
JMSF035O14+ TTCACTGTAATCTTCTGCTCGCAAGTTAACAAAATCAACCCATACATCACAAAGGCGCAT
                      ____________________________________________________________
consensus TTCACTGTAATCTTCTGCTCGCAAGTTAACAAAATCAACCCATACATCACAAAGGCGCAT
 
. : . : . : . : . : . :
JMSF023J10+ CCTTGCTGTTTCCAAGTGTTTTGACTGATCAGGATTGCACTGGATGACACCTATTCCTTG
JMSF035O14+ CCTTGCTGTTTCCAAGTGTTTTGACTGATCAGGATTGCACTGGATGACACCTATTCCTTG
                      ____________________________________________________________
consensus CCTTGCTGTTTCCAAGTGTTTTGACTGATCAGGATTGCACTGGATGACACCTATTCCTTG
 
. : . : . : . : . : . :
JMSF023J10+ GGTTTCTTCCCCAGTAGATGATAAGTACTCATTGACCTTCTCACAGAATTCTCTTCCTAG
JMSF035O14+ GGTTTCTTCCCCAGTAGATGATAAGTACTCATTGACCTTCTCACAGAATTCTCTTCCTAG
                      ____________________________________________________________
consensus GGTTTCTTCCCCAGTAGATGATAAGTACTCATTGACCTTCTCACAGAATTCTCTTCCTAG
 
. : . : . : . : . : . :
JMSF023J10+ CATGTTATCAAGTGCAATATCTATATCACAGCATTCTTTACCAAGAAGCTTATCGCGAAC
JMSF035O14+ CATGTTATCAAGTGCAATATCTATATCACAGCATTCTTTACCAAGAAGCTTATCGCGAAC
                      ____________________________________________________________
consensus CATGTTATCAAGTGCAATATCTATATCACAGCATTCTTTACCAAGAAGCTTATCGCGAAC
 
. : . : . : . : . : . :
JMSF023J10+ CCATCCACCGGCGACGCGGAGCTGCGTCTGGAGATTAAAGTGGCGCAGGACTTGAAGAAG
JMSF035O14+ CCATCCACCGGCGACGCGGAGCTGCGTCTGGAGATTAAAGTGGCGCAGGACTTGAAGAAG
                      ____________________________________________________________
consensus CCATCCACCGGCGACGCGGAGCTGCGTCTGGAGATTAAAGTGGCGCAGGACTTGAAGAAG
 
. : . : . : . : . : . :
JMSF023J10+ GCGGTCAAAAATCTGCTTCTCCTTGGCTGTCAAGTCGATGTGGTCTTTCACATGAACTAG
JMSF035O14+ GCGGTCAAAAATCTGCTTCTCCTTGGCTGTCAAGTCGATGTGGTCTTTCACATGAACTAG
JMSF008B23+ GGCTGTCAAGTCGATGTGGTCTTTCACATGAACTAG
                      ____________________________________________________________
consensus GCGGTCAAAAATCTGCTTCTCCTTGGCTGTCAAGTCGATGTGGTCTTTCACATGAACTAG
 
. : . : . : . : . : . :
JMSF023J10+ CGCAGGAGACGGGTCGGATTCCGCCATACTTGGCCCGCTGCGAAACCTCCGGGGAGGAAT
JMSF035O14+ CGCAGGAGACGGGTCGGATTCCGCCATACTTGGCCCGCTGCGAAACCTCCGGGGAGGAAT
JMSF022H01+ TGGCCCGCTGCGAAACCTCCGGGGAGGAAN
JMSF008B23+ CGCAGGAGACGGGTCGGATTCCGCCATACTTGGCCCGCTGCGAAACCTCCGGGGAGGAAT
                      ____________________________________________________________
consensus CGCAGGAGACGGGTCGGATTCCGCCATACTTGGCCCGCTGCGAAACCTCCGGGGAGGAAT
 
. : . : . : . : . : . :
JMSF023J10+ GTAGGAGCTGTGAGATATAGAGTAGTTGCGGCACTTGAATTGTATAGTCTGAAGTTTTGG
JMSF035O14+ GTAGGAGCTGTGAGATATAGAGTAGTTGCGGCACTTGAATTGTATAGTCTGAAGTTTTGG
JMSF022H01+ GTAGGAGCTNTGAGATATAGAGTAGTTGCGGCACTNGAATNGTATAGTCTGAAGTTTTGG
JMSF008B23+ GTAGGAGCTGTGAGATATAGAGTAGTTGCGGCACTTGAATTGTATAGTCTGAAGTTTTGG
                      ____________________________________________________________
consensus GTAGGAGCTGTGAGATATAGAGTAGTTGCGGCACTTGAATTGTATAGTCTGAAGTTTTGG
 
. : . : . : . : . : . :
JMSF023J10+ GAGAGGTGAAAGGCGAGAAGAGTTGCGTGATGAATGGAAGAAGAGGCGGTGAGTGTAGTG
JMSF035O14+ GAGAGGTGAAAGGCGAGAAGAGTTGCGTGATGAATGGAAGAAGAGGCGGTGAGTGTAGTG
JMSF022H01+ GAGAGGNGAAAGGCGAGAAGAGTT
JMSF008B23+ GAGAGGTGAAAGGCGAGAAGAGTTGCGTGATGAATGGAAGAAGAGGCGGTGAGTGTAGTG
                      ____________________________________________________________
consensus GAGAGGTGAAAGGCGAGAAGAGTTGCGTGATGAATGGAAGAAGAGGCGGTGAGTGTAGTG
 
. : . : . : . : . : . :
JMSF023J10+ GTTCAAAGTTGAAACCAGTCTCATTGCGCTTCCCTCAGTCCGCC
JMSF035O14+ GTTCAAAGTTGAAACCAGTCTCATTGCGCTTCCCTCAGTCCGCCCATTTTCC
JMSF008B23+ GTTCAAAGTTGAAACCAGTCTCATTGCGCTTCCCTCAGTCCGCCCATTTTCCTTTCCCCC
                      ____________________________________________________________
consensus GTTCAAAGTTGAAACCAGTCTCATTGCGCTTCCCTCAGTCCGCCCATTTTCCTTTCCCCC