Previous Contig 004948:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF017O14Sequence493004948 (4)gb:AY045660_15612514e-12Arabidopsis thaliana AT5g24120/MLE8_4 mRNA, partial cds.798011422 (4)pir|T51328|T513283e-79transcription initiation factor sigma5, plastid -specific [imported] - Arabidops
JMSF008B18Sequence219004948 (4)gb:AY045660_15612510.032Arabidopsis thaliana AT5g24120/MLE8_4 mRNA, partial cds.770011422 (4)pir|T51328|T513282e-81transcription initiation factor sigma5, plastid -specific [imported] - Arabidops
JMSF021C02Sequence676004948 (4)gb:AY045660_15612514e-22Arabidopsis thaliana AT5g24120/MLE8_4 mRNA, partial cds.753011422 (4)pir|T51328|T513284e-75transcription initiation factor sigma5, plastid -specific [imported] - Arabidops
JMSF050J23Sequence615004948 (4)gb:AY045660_15612512e-17Arabidopsis thaliana AT5g24120/MLE8_4 mRNA, partial cds.709011422 (4)pir|T51328|T513283e-71transcription initiation factor sigma5, plastid -specific [imported] - Arabidops

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF021C02+ CCAGTCCATGCTCACT
                      ____________________________________________________________
consensus CCAGTCCATGCTCACT
 
. : . : . : . : . : . :
JMSF050J23+ TCTTCTTCTGTTTCC
JMSF021C02+ AAATCTGTGCCAACCGAATATTCTCTAACGAGTTTATTGATTTTTTCTTCTTCTGTTTCC
                      ____________________________________________________________
consensus AAATCTGTGCCAACCGAATATTCTCTAACGAGTTTATTGATTTTTTCTTCTTCTGTTTCC
 
. : . : . : . : . : . :
JMSF050J23+ TCCTTACGCTTCCTTTCGTGGGAAGAAGCGACTATTTCGTCTCCCTTCATGTTTCTAAGA
JMSF021C02+ TCCTTACGCTTCCTTTCGTGGGAAGAAGCGACTATTTCGTCTCCCTTCATGTTTCTAAGA
                      ____________________________________________________________
consensus TCCTTACGCTTCCTTTCGTGGGAAGAAGCGACTATTTCGTCTCCCTTCATGTTTCTAAGA
 
. : . : . : . : . : . :
JMSF050J23+ GCAACCCTCTTATCAAGACTCAACCGTTTCGTTTTCTTCCTTTGACAACTTCTCTTGACT
JMFF017O14+ CAACTTCTCTTGACT
JMSF021C02+ GCAACCCTCTTATCAAGACTCAACCGTTTCGTTTTCTTCCTTTGACAACTTCTCTTGACT
                      ____________________________________________________________
consensus GCAACCCTCTTATCAAGACTCAACCGTTTCGTTTTCTTCCTTTGACAACTTCTCTTGACT
 
. : . : . : . : . : . :
JMSF050J23+ ATACAGCCTTCAGAACCTATACGAGAAGTAGTAGGTTCTGGACTATGGATGTATAATTTC
JMFF017O14+ ATACAGCCTTCAGAACCTATACGAGAAGTAGTAGGTTCTGGACTATGGATGTATAATTTC
JMSF021C02+ ATACAGCCTTCAGAACCTATACGAGAAGTAGTAGGTTCTGGACTATGGATGTATAATTTC
                      ____________________________________________________________
consensus ATACAGCCTTCAGAACCTATACGAGAAGTAGTAGGTTCTGGACTATGGATGTATAATTTC
 
. : . : . : . : . : . :
JMSF050J23+ TCGAGTTTGGCAGCAACATCATTGTAATCCAAATCTAGAGTACTCGGAGAGGCTTCACCC
JMFF017O14+ TCGAGTTTGGCAGCAACATCATTGTAATCCAAATCTAGAGTACTCGGAGAGGCTTCACCC
JMSF021C02+ TCGAGTTTGGCAGCAACATCATTGTAATCCAAATCTAGAGTACTCGGAGAGGCTTCACCC
                      ____________________________________________________________
consensus TCGAGTTTGGCAGCAACATCATTGTAATCCAAATCTAGAGTACTCGGAGAGGCTTCACCC
 
. : . : . : . : . : . :
JMSF050J23+ GTAGAGACAGCATGAATCCTATCTGAACGCTTTTTAGCTCGCCCCACTCTCTTTTTACTC
JMFF017O14+ GTAGAGACAGCATGAATCCTATCTGAACGCTTTTTAGCTCGCCCCACTCTCTTTTTACTC
JMSF021C02+ GTAGAGACAGCATGAATCCTATCTGAACGCTTTTTAGCTCGCCCCACTCTCTTTTTACTC
                      ____________________________________________________________
consensus GTAGAGACAGCATGAATCCTATCTGAACGCTTTTTAGCTCGCCCCACTCTCTTTTTACTC
 
. : . : . : . : . : . :
JMSF050J23+ TCTTTCGATGTCTCTAGAGACAACGATGTAGGTTCATCAGGATAAACCAAAGCAGCAGCA
JMFF017O14+ TCTTTCGATGTCTCTAGAGACAACGATGTAGGTTCATCAGGATAAACCAAAGCAGCAGCA
JMSF021C02+ TCTTTCGATGTCTCTAGAGACAACGATGTAGGTTCATCAGGATAAACCAAAGCAGCAGCA
                      ____________________________________________________________
consensus TCTTTCGATGTCTCTAGAGACAACGATGTAGGTTCATCAGGATAAACCAAAGCAGCAGCA
 
. : . : . : . : . : . :
JMSF050J23+ TTTTTCGGTTTATTGGCTTTGAATGACAGTACTAACGGTCTTTTAAGCGCACATAAACGA
JMFF017O14+ TTTTTCGGTTTATTGGCTTTGAATGACAGTACTAACGGTCTTTTAAGCGCACATAAACGA
JMSF021C02+ TTTTTCGGTTTATTGGCTTTGAATGACAGTACTAACGGTCTTTTAAGCGCACATAAACGA
JMSF008B18+ AATGACAGTACTAACGGTCTTTTAAGCGCACATAAACGA
                      ____________________________________________________________
consensus TTTTTCGGTTTATTGGCTTTGAATGACAGTACTAACGGTCTTTTAAGCGCACATAAACGA
 
. : . : . : . : . : . :
JMSF050J23+ GAGGAAAATCTCGTGCTCAATCCCAAAGGACTCCTTGCAGCAGAGCTAGAAACAGTCACA
JMFF017O14+ GAGGAAAATCTCGTGCTCAATCCCAAAGGACTCCTTGCAGCAGAGCTAGAAACAGTCACA
JMSF021C02+ GAGGAAAATCTCGTGCTCAATCCCAAAGGACTCCTTGCAGCAGAGCTAGAAACAGTCACA
JMSF008B18+ GAGGAAAATCTCGTGCTCAATCCCAAAGGACTCCTTGCAGCAGAGCTAGAAACAGTCACA
                      ____________________________________________________________
consensus GAGGAAAATCTCGTGCTCAATCCCAAAGGACTCCTTGCAGCAGAGCTAGAAACAGTCACA
 
. : . : . : . : . : . :
JMSF050J23+ ACTCCCATGCCAATAAAGTCTCAGAGAGAATTCAGCAAGTCTGCAGAGTTTCTGGTCGCC
JMFF017O14+ ACTCCCATGCCAATAAAGTCTCAGAGAGAATTCAGCAAGTCTGCAGAGTTTCTGGTCGCC
JMSF021C02+ ACTCCCATGCCAATAAAGTCTCAGAGAGAATTCAGCAAGTCTGCAGAGTTTCTGGTCGCC
JMSF008B18+ ACTCCCATGCCAATAAAGTCTCAGAGAGAATTCAGCAAGTCTGCAGAGTTTCTGGTCGCC
                      ____________________________________________________________
consensus ACTCCCATGCCAATAAAGTCTCAGAGAGAATTCAGCAAGTCTGCAGAGTTTCTGGTCGCC
 
. : . : . : . : . : . :
JMSF050J23+ GGAGATTCAAGATTCCGGTGACTCTCAATCAAACAGAGGGCCCTGGACCGTAGTATTT
JMFF017O14+ GGAGATTCAAGATTCCGGTGACTCTCAATCAAACAGAGGGCCCTGGACCGTAGTATTT
JMSF021C02+ GGAGATTCAAGATTCCGGTGACTCTCAATCAAACAGAGGGCCCTGGACCGTAGTATTT
JMSF008B18+ GGAGATTCAAGATTCCGGTGACTCTCAATCAAACAGAGGGCCCTGGACCGTAGTATTTCC
                      ____________________________________________________________
consensus GGAGATTCAAGATTCCGGTGACTCTCAATCAAACAGAGGGCCCTGGACCGTAGTATTTCC