Previous Contig 004942:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF008B02Sequence282004942 (2)685001322 (5)pir|A96538|A965385e-47hypothetical protein F14I3.20 [imported] - Arabidopsis thaliana>gb:AE005173_8929
JMSF051F12Sequence679004942 (2)729001322 (5)pir|A96538|A965386e-47hypothetical protein F14I3.20 [imported] - Arabidopsis thaliana>gb:AE005173_8929

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF051F12+ AATCAATTTCAGTAGGTTA
                      ____________________________________________________________
consensus AATCAATTTCAGTAGGTTA
 
. : . : . : . : . : . :
JMSF051F12+ ATTCAACTCTAACCCTAATTCAACAATTTTTTAACGTGATGATTTTACATTTTTACTATA
                      ____________________________________________________________
consensus ATTCAACTCTAACCCTAATTCAACAATTTTTTAACGTGATGATTTTACATTTTTACTATA
 
. : . : . : . : . : . :
JMSF051F12+ CAAACTGAGAACTTAATGACACTATGAGACAAATGCTAATCCCAATCTATCATTGTTGAA
                      ____________________________________________________________
consensus CAAACTGAGAACTTAATGACACTATGAGACAAATGCTAATCCCAATCTATCATTGTTGAA
 
. : . : . : . : . : . :
JMSF051F12+ TAGTTTCATCGAATTCATTAGTTCACAGCCTCACACACAAGGAAGCAGAAGAGCAGAGGT
                      ____________________________________________________________
consensus TAGTTTCATCGAATTCATTAGTTCACAGCCTCACACACAAGGAAGCAGAAGAGCAGAGGT
 
. : . : . : . : . : . :
JMSF051F12+ GATTATGTATAGGATGACTTCGACTCTTCAAGTCATCAACTGACCAGTGGACACGCACAA
                      ____________________________________________________________
consensus GATTATGTATAGGATGACTTCGACTCTTCAAGTCATCAACTGACCAGTGGACACGCACAA
 
. : . : . : . : . : . :
JMSF051F12+ TTGCGCAACCACACAAGTCGCAAACCAACCCTAGTTTCTAGAGAAGAGGCAAGGAAGTTG
                      ____________________________________________________________
consensus TTGCGCAACCACACAAGTCGCAAACCAACCCTAGTTTCTAGAGAAGAGGCAAGGAAGTTG
 
. : . : . : . : . : . :
JMSF051F12+ AGGATTCCTGAGGTTTAATAGAGAGCCTTGAATATGTTTTCATGATCATTAGAAAACGGA
                      ____________________________________________________________
consensus AGGATTCCTGAGGTTTAATAGAGAGCCTTGAATATGTTTTCATGATCATTAGAAAACGGA
 
. : . : . : . : . : . :
JMSF051F12+ AAATTAGCAATTTCGATTAACCAGTGGTATAGACTCAATCAACAGCCGCCGCCGGGTAGC
JMSF008B02+ AACCAGTGGTATAGACTCAATCAACAGCCGCCGCCGGGTAGC
                      ____________________________________________________________
consensus AAATTAGCAATTTCGATTAACCAGTGGTATAGACTCAATCAACAGCCGCCGCCGGGTAGC
 
. : . : . : . : . : . :
JMSF051F12+ GACCTCCCGAGTGCCGACCTGCTAGTCTCCTACAGTGCCTAGTGCGGTAGTACCTACCTA
JMSF008B02+ GACCTCCCGAGTGCCGACCTGCTAGTCTCCTACAGTGCCTAGTGCGGTAGTACCTACCTA
                      ____________________________________________________________
consensus GACCTCCCGAGTGCCGACCTGCTAGTCTCCTACAGTGCCTAGTGCGGTAGTACCTACCTA
 
. : . : . : . : . : . :
JMSF051F12+ CCCTGTCTGGATGCCTATCGAACTACCATGGGAACTGGGAAGACATACCTCGACTCACAG
JMSF008B02+ CCCTGTCTGGATGCCTATCGAACTACCATGGGAACTGGGAAGACATACCTCGACTCACAG
                      ____________________________________________________________
consensus CCCTGTCTGGATGCCTATCGAACTACCATGGGAACTGGGAAGACATACCTCGACTCACAG
 
. : . : . : . : . : . :
JMSF051F12+ CCTGTCGCCGCCTGCCGCCTGCCGCCCGTCGCCCGTCGCCACTCGCCAGTCGAAGGAGTC
JMSF008B02+ CCTGTCGCCGCCTGCCGCCTGCCGCCCGTCGCCCGTCGCCACTCGCCAGTCGAAGGAGTC
                      ____________________________________________________________
consensus CCTGTCGCCGCCTGCCGCCTGCCGCCCGTCGCCCGTCGCCACTCGCCAGTCGAAGGAGTC
 
. : . : . : . : . : . :
JMSF051F12+ TCGGTCCTCTCGGACAAAGTCGCAGCCGCAGGATTAATTTTTTACAACGAAAAGAATCTC
JMSF008B02+ TCGGTCCTCTCGGACAAAGTCGCAGCCGCAGGATTAATTTTTTACAACGAAAAGAATCTC
                      ____________________________________________________________
consensus TCGGTCCTCTCGGACAAAGTCGCAGCCGCAGGATTAATTTTTTACAACGAAAAGAATCTC