Previous Contig 004938:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF001K14Sequence595004938 (159)gb:AF291761_17837163e-14Ipomoea batatas S-adenosylmethionine decarboxylase (SAMDC) gene, complete cds.703004938 (159)sp|Q96471|DCAM_PHANIe-102S-adenosylmethionine decarboxylase proenzyme (EC 4.1.1.50) (AdoMetDC) (SamDC) [C
JMFF001K20Sequence683004938 (159)sp|Q96471|DCAM_PHANI4e-89S-adenosylmethionine decarboxylase proenzyme (EC 4.1.1.50) (AdoMetDC) (SamDC) [C
JMFF001L19Sequence644004938 (159)sp|Q96471|DCAM_PHANI4e-91S-adenosylmethionine decarboxylase proenzyme (EC 4.1.1.50) (AdoMetDC) (SamDC) [C
JMFF001M19Sequence538004938 (159)gb:AF291761_17837163e-14Ipomoea batatas S-adenosylmethionine decarboxylase (SAMDC) gene, complete cds.644004938 (159)sp|Q96471|DCAM_PHANI4e-90S-adenosylmethionine decarboxylase proenzyme (EC 4.1.1.50) (AdoMetDC) (SamDC) [C
JMFF002C05Sequence547004938 (159)gb:AF291761_17837163e-14Ipomoea batatas S-adenosylmethionine decarboxylase (SAMDC) gene, complete cds.737004938 (159)sp|Q96471|DCAM_PHANIe-102S-adenosylmethionine decarboxylase proenzyme (EC 4.1.1.50) (AdoMetDC) (SamDC) [C
JMFF002F07Sequence606004938 (159)gb:AF291761_17837163e-14Ipomoea batatas S-adenosylmethionine decarboxylase (SAMDC) gene, complete cds.714004938 (159)sp|Q96471|DCAM_PHANIe-102S-adenosylmethionine decarboxylase proenzyme (EC 4.1.1.50) (AdoMetDC) (SamDC) [C
JMFF003K21Sequence199004938 (159)791004938 (159)sp|Q96471|DCAM_PHANIe-123S-adenosylmethionine decarboxylase proenzyme (EC 4.1.1.50) (AdoMetDC) (SamDC) [C
JMFF004H09Sequence549004938 (159)gb:AF291761_17837163e-14Ipomoea batatas S-adenosylmethionine decarboxylase (SAMDC) gene, complete cds.726004938 (159)sp|Q96471|DCAM_PHANIe-101S-adenosylmethionine decarboxylase proenzyme (EC 4.1.1.50) (AdoMetDC) (SamDC) [C
JMFF005K17Sequence550004938 (159)gb:AF291761_17837163e-14Ipomoea batatas S-adenosylmethionine decarboxylase (SAMDC) gene, complete cds.715004938 (159)sp|Q96471|DCAM_PHANIe-102S-adenosylmethionine decarboxylase proenzyme (EC 4.1.1.50) (AdoMetDC) (SamDC) [C
JMFF007E07Sequence605004938 (159)gb:AF291761_17837163e-14Ipomoea batatas S-adenosylmethionine decarboxylase (SAMDC) gene, complete cds.734004938 (159)sp|Q96471|DCAM_PHANI6e-98S-adenosylmethionine decarboxylase proenzyme (EC 4.1.1.50) (AdoMetDC) (SamDC) [C
JMFF007F17Sequence617004938 (159)gb:AF291761_17837164e-14Ipomoea batatas S-adenosylmethionine decarboxylase (SAMDC) gene, complete cds.765004938 (159)sp|Q96471|DCAM_PHANIe-102S-adenosylmethionine decarboxylase proenzyme (EC 4.1.1.50) (AdoMetDC) (SamDC) [C
JMFF008E17Sequence522004938 (159)sp|Q96471|DCAM_PHANI8e-95S-adenosylmethionine decarboxylase proenzyme (EC 4.1.1.50) (AdoMetDC) (SamDC) [C709004938 (159)sp|Q96471|DCAM_PHANIe-100S-adenosylmethionine decarboxylase proenzyme (EC 4.1.1.50) (AdoMetDC) (SamDC) [C
JMFF008K11Sequence629004938 (159)gb:AF291761_17837164e-14Ipomoea batatas S-adenosylmethionine decarboxylase (SAMDC) gene, complete cds.779004938 (159)sp|Q96471|DCAM_PHANIe-120S-adenosylmethionine decarboxylase proenzyme (EC 4.1.1.50) (AdoMetDC) (SamDC) [C
JMFF012F14Sequence544004938 (159)gb:AF291761_17837163e-14Ipomoea batatas S-adenosylmethionine decarboxylase (SAMDC) gene, complete cds.724004938 (159)sp|Q96471|DCAM_PHANIe-102S-adenosylmethionine decarboxylase proenzyme (EC 4.1.1.50) (AdoMetDC) (SamDC) [C
JMFF012K01Sequence503014300gb:AF291761_17837167e-13Ipomoea batatas S-adenosylmethionine decarboxylase (SAMDC) gene, complete cds.810004938 (159)sp|Q96471|DCAM_PHANIe-120S-adenosylmethionine decarboxylase proenzyme (EC 4.1.1.50) (AdoMetDC) (SamDC) [C
JMFF013C19Sequence500004938 (159)gb:AF291761_17837162e-14Ipomoea batatas S-adenosylmethionine decarboxylase (SAMDC) gene, complete cds.577004938 (159)sp|Q96471|DCAM_PHANI1e-63S-adenosylmethionine decarboxylase proenzyme (EC 4.1.1.50) (AdoMetDC) (SamDC) [C
JMFF013K04Sequence591004938 (159)gb:AF291761_17837163e-14Ipomoea batatas S-adenosylmethionine decarboxylase (SAMDC) gene, complete cds.779004938 (159)sp|Q96471|DCAM_PHANIe-124S-adenosylmethionine decarboxylase proenzyme (EC 4.1.1.50) (AdoMetDC) (SamDC) [C
JMFF014G05Sequence589004938 (159)gb:AF291761_17837163e-14Ipomoea batatas S-adenosylmethionine decarboxylase (SAMDC) gene, complete cds.808004938 (159)sp|Q96471|DCAM_PHANIe-119S-adenosylmethionine decarboxylase proenzyme (EC 4.1.1.50) (AdoMetDC) (SamDC) [C
JMFF014I09Sequence733004938 (159)sp|Q96471|DCAM_PHANIe-101S-adenosylmethionine decarboxylase proenzyme (EC 4.1.1.50) (AdoMetDC) (SamDC) [C
JMFF015K19Sequence600004938 (159)gb:AF291761_17837163e-14Ipomoea batatas S-adenosylmethionine decarboxylase (SAMDC) gene, complete cds.622004938 (159)sp|Q96471|DCAM_PHANI9e-82S-adenosylmethionine decarboxylase proenzyme (EC 4.1.1.50) (AdoMetDC) (SamDC) [C
JMFF016K04Sequence627004938 (159)gb:AF291761_17837164e-14Ipomoea batatas S-adenosylmethionine decarboxylase (SAMDC) gene, complete cds.720004938 (159)sp|Q96471|DCAM_PHANIe-102S-adenosylmethionine decarboxylase proenzyme (EC 4.1.1.50) (AdoMetDC) (SamDC) [C
JMFF018L18Sequence606004938 (159)gb:AF291761_17837163e-14Ipomoea batatas S-adenosylmethionine decarboxylase (SAMDC) gene, complete cds.791004938 (159)sp|Q96471|DCAM_PHANIe-117S-adenosylmethionine decarboxylase proenzyme (EC 4.1.1.50) (AdoMetDC) (SamDC) [C
JMFF018O13Sequence547004938 (159)gb:AF291761_17837163e-14Ipomoea batatas S-adenosylmethionine decarboxylase (SAMDC) gene, complete cds.719004938 (159)sp|Q96471|DCAM_PHANIe-102S-adenosylmethionine decarboxylase proenzyme (EC 4.1.1.50) (AdoMetDC) (SamDC) [C
JMFF019H23Sequence592004938 (159)gb:AF291761_17837163e-14Ipomoea batatas S-adenosylmethionine decarboxylase (SAMDC) gene, complete cds.704004938 (159)sp|Q96471|DCAM_PHANIe-101S-adenosylmethionine decarboxylase proenzyme (EC 4.1.1.50) (AdoMetDC) (SamDC) [C
JMFF020D24Sequence576004938 (159)gb:AF291761_17837163e-14Ipomoea batatas S-adenosylmethionine decarboxylase (SAMDC) gene, complete cds.783004938 (159)sp|Q96471|DCAM_PHANIe-121S-adenosylmethionine decarboxylase proenzyme (EC 4.1.1.50) (AdoMetDC) (SamDC) [C
JMFF020E21Sequence606004938 (159)gb:AF291761_17837163e-14Ipomoea batatas S-adenosylmethionine decarboxylase (SAMDC) gene, complete cds.736004938 (159)sp|Q96471|DCAM_PHANIe-101S-adenosylmethionine decarboxylase proenzyme (EC 4.1.1.50) (AdoMetDC) (SamDC) [C
JMFF020J13Sequence588004938 (159)gb:AF291761_17837163e-14Ipomoea batatas S-adenosylmethionine decarboxylase (SAMDC) gene, complete cds.703004938 (159)sp|Q96471|DCAM_PHANIe-101S-adenosylmethionine decarboxylase proenzyme (EC 4.1.1.50) (AdoMetDC) (SamDC) [C
JMFF022G08Sequence524004938 (159)gb:AF291761_17837162e-14Ipomoea batatas S-adenosylmethionine decarboxylase (SAMDC) gene, complete cds.693004938 (159)sp|Q96471|DCAM_PHANI5e-96S-adenosylmethionine decarboxylase proenzyme (EC 4.1.1.50) (AdoMetDC) (SamDC) [C
JMFF022I03Sequence448004938 (159)gb:AF291761_17837162e-14Ipomoea batatas S-adenosylmethionine decarboxylase (SAMDC) gene, complete cds.705004938 (159)sp|Q96471|DCAM_PHANI8e-98S-adenosylmethionine decarboxylase proenzyme (EC 4.1.1.50) (AdoMetDC) (SamDC) [C
JMFF023F17Sequence551004938 (159)gb:AF291761_17837163e-14Ipomoea batatas S-adenosylmethionine decarboxylase (SAMDC) gene, complete cds.753004938 (159)sp|Q96471|DCAM_PHANIe-108S-adenosylmethionine decarboxylase proenzyme (EC 4.1.1.50) (AdoMetDC) (SamDC) [C
JMFF023F22Sequence549004938 (159)gb:AF291761_17837163e-14Ipomoea batatas S-adenosylmethionine decarboxylase (SAMDC) gene, complete cds.714004938 (159)sp|Q96471|DCAM_PHANIe-102S-adenosylmethionine decarboxylase proenzyme (EC 4.1.1.50) (AdoMetDC) (SamDC) [C
JMFF024G10Sequence460004938 (159)gb:AF291761_17837162e-14Ipomoea batatas S-adenosylmethionine decarboxylase (SAMDC) gene, complete cds.695004938 (159)sp|Q96471|DCAM_PHANIe-101S-adenosylmethionine decarboxylase proenzyme (EC 4.1.1.50) (AdoMetDC) (SamDC) [C
JMFF024H12Sequence144004938 (159)745004938 (159)sp|Q96471|DCAM_PHANIe-111S-adenosylmethionine decarboxylase proenzyme (EC 4.1.1.50) (AdoMetDC) (SamDC) [C
JMFF024N03Sequence552004938 (159)gb:AF291761_17837163e-14Ipomoea batatas S-adenosylmethionine decarboxylase (SAMDC) gene, complete cds.702004938 (159)sp|Q96471|DCAM_PHANIe-101S-adenosylmethionine decarboxylase proenzyme (EC 4.1.1.50) (AdoMetDC) (SamDC) [C
JMFF028C05Sequence585004938 (159)gb:AF291761_17837163e-14Ipomoea batatas S-adenosylmethionine decarboxylase (SAMDC) gene, complete cds.701004938 (159)sp|Q96471|DCAM_PHANIe-102S-adenosylmethionine decarboxylase proenzyme (EC 4.1.1.50) (AdoMetDC) (SamDC) [C
JMFF028M07Sequence592004938 (159)gb:AF291761_17837163e-14Ipomoea batatas S-adenosylmethionine decarboxylase (SAMDC) gene, complete cds.701004938 (159)sp|Q96471|DCAM_PHANIe-101S-adenosylmethionine decarboxylase proenzyme (EC 4.1.1.50) (AdoMetDC) (SamDC) [C
JMFF031E15Sequence592004938 (159)gb:AF291761_17837163e-14Ipomoea batatas S-adenosylmethionine decarboxylase (SAMDC) gene, complete cds.734004938 (159)sp|Q96471|DCAM_PHANIe-109S-adenosylmethionine decarboxylase proenzyme (EC 4.1.1.50) (AdoMetDC) (SamDC) [C
JMFF032P21Sequence601004938 (159)gb:AF291761_17837163e-14Ipomoea batatas S-adenosylmethionine decarboxylase (SAMDC) gene, complete cds.722004938 (159)sp|Q96471|DCAM_PHANIe-102S-adenosylmethionine decarboxylase proenzyme (EC 4.1.1.50) (AdoMetDC) (SamDC) [C
JMFF033B02Sequence551004938 (159)gb:AF291761_17837163e-14Ipomoea batatas S-adenosylmethionine decarboxylase (SAMDC) gene, complete cds.733004938 (159)sp|Q96471|DCAM_PHANIe-131S-adenosylmethionine decarboxylase proenzyme (EC 4.1.1.50) (AdoMetDC) (SamDC) [C
JMFF033K01Sequence546004938 (159)gb:AF291761_17837163e-14Ipomoea batatas S-adenosylmethionine decarboxylase (SAMDC) gene, complete cds.733004938 (159)sp|Q96471|DCAM_PHANIe-102S-adenosylmethionine decarboxylase proenzyme (EC 4.1.1.50) (AdoMetDC) (SamDC) [C
JMFF034N04Sequence602004938 (159)gb:AF291761_17837163e-14Ipomoea batatas S-adenosylmethionine decarboxylase (SAMDC) gene, complete cds.652004938 (159)sp|Q96471|DCAM_PHANI7e-93S-adenosylmethionine decarboxylase proenzyme (EC 4.1.1.50) (AdoMetDC) (SamDC) [C
JMFF034N15Sequence677004938 (159)sp|Q96471|DCAM_PHANI2e-83S-adenosylmethionine decarboxylase proenzyme (EC 4.1.1.50) (AdoMetDC) (SamDC) [C
JMFF035P13Sequence547004938 (159)gb:AF291761_17837163e-14Ipomoea batatas S-adenosylmethionine decarboxylase (SAMDC) gene, complete cds.737004938 (159)sp|Q96471|DCAM_PHANIe-102S-adenosylmethionine decarboxylase proenzyme (EC 4.1.1.50) (AdoMetDC) (SamDC) [C
JMFF036A04Sequence598004938 (159)gb:AF291761_17837163e-14Ipomoea batatas S-adenosylmethionine decarboxylase (SAMDC) gene, complete cds.698004938 (159)sp|Q96471|DCAM_PHANI5e-96S-adenosylmethionine decarboxylase proenzyme (EC 4.1.1.50) (AdoMetDC) (SamDC) [C
JMFF037M04Sequence637004938 (159)gb:AF291761_17837161e-13Ipomoea batatas S-adenosylmethionine decarboxylase (SAMDC) gene, complete cds.483004938 (159)sp|Q96471|DCAM_PHANI2e-58S-adenosylmethionine decarboxylase proenzyme (EC 4.1.1.50) (AdoMetDC) (SamDC) [C
JMFF038E23Sequence532004938 (159)gb:AF291761_17837162e-14Ipomoea batatas S-adenosylmethionine decarboxylase (SAMDC) gene, complete cds.710004938 (159)sp|Q96471|DCAM_PHANI5e-90S-adenosylmethionine decarboxylase proenzyme (EC 4.1.1.50) (AdoMetDC) (SamDC) [C
JMFF038F03Sequence437004938 (159)gb:AF291761_17837162e-14Ipomoea batatas S-adenosylmethionine decarboxylase (SAMDC) gene, complete cds.735004938 (159)sp|Q96471|DCAM_PHANIe-109S-adenosylmethionine decarboxylase proenzyme (EC 4.1.1.50) (AdoMetDC) (SamDC) [C
JMFF038H05Sequence606004938 (159)gb:AF291761_17837163e-14Ipomoea batatas S-adenosylmethionine decarboxylase (SAMDC) gene, complete cds.762004938 (159)sp|Q96471|DCAM_PHANIe-122S-adenosylmethionine decarboxylase proenzyme (EC 4.1.1.50) (AdoMetDC) (SamDC) [C
JMFF038K02Sequence712004938 (159)sp|Q96471|DCAM_PHANIe-102S-adenosylmethionine decarboxylase proenzyme (EC 4.1.1.50) (AdoMetDC) (SamDC) [C
JMFF039E24Sequence592004938 (159)gb:AF291761_17837163e-14Ipomoea batatas S-adenosylmethionine decarboxylase (SAMDC) gene, complete cds.753004938 (159)sp|Q96471|DCAM_PHANIe-105S-adenosylmethionine decarboxylase proenzyme (EC 4.1.1.50) (AdoMetDC) (SamDC) [C
JMFF040M15Sequence519004938 (159)gb:AF291761_17837162e-14Ipomoea batatas S-adenosylmethionine decarboxylase (SAMDC) gene, complete cds.767004938 (159)sp|Q96471|DCAM_PHANIe-114S-adenosylmethionine decarboxylase proenzyme (EC 4.1.1.50) (AdoMetDC) (SamDC) [C
JMFF040P16Sequence401004938 (159)gb:AF291761_17837163e-13Ipomoea batatas S-adenosylmethionine decarboxylase (SAMDC) gene, complete cds.799004938 (159)sp|Q96471|DCAM_PHANIe-122S-adenosylmethionine decarboxylase proenzyme (EC 4.1.1.50) (AdoMetDC) (SamDC) [C
JMFF041C04Sequence643004938 (159)gb:AF291761_17837164e-14Ipomoea batatas S-adenosylmethionine decarboxylase (SAMDC) gene, complete cds.464004938 (159)sp|Q96471|DCAM_PHANI5e-35S-adenosylmethionine decarboxylase proenzyme (EC 4.1.1.50) (AdoMetDC) (SamDC) [C
JMFF044M03Sequence635004938 (159)gb:AF291761_17837168e-14Ipomoea batatas S-adenosylmethionine decarboxylase (SAMDC) gene, complete cds.615004938 (159)sp|Q96471|DCAM_PHANI3e-76S-adenosylmethionine decarboxylase proenzyme (EC 4.1.1.50) (AdoMetDC) (SamDC) [C
JMFF045B18Sequence602004938 (159)gb:AF291761_17837163e-14Ipomoea batatas S-adenosylmethionine decarboxylase (SAMDC) gene, complete cds.658004938 (159)sp|Q96471|DCAM_PHANI1e-75S-adenosylmethionine decarboxylase proenzyme (EC 4.1.1.50) (AdoMetDC) (SamDC) [C
JMFF046E15Sequence617004938 (159)gb:AF291761_17837164e-14Ipomoea batatas S-adenosylmethionine decarboxylase (SAMDC) gene, complete cds.620004938 (159)sp|Q96471|DCAM_PHANI3e-69S-adenosylmethionine decarboxylase proenzyme (EC 4.1.1.50) (AdoMetDC) (SamDC) [C
JMFF047P12Sequence647004938 (159)gb:AF291761_17837164e-14Ipomoea batatas S-adenosylmethionine decarboxylase (SAMDC) gene, complete cds.615004938 (159)sp|Q96471|DCAM_PHANI6e-73S-adenosylmethionine decarboxylase proenzyme (EC 4.1.1.50) (AdoMetDC) (SamDC) [C
JMFF048H10Sequence413000959 (10)gb:AY086752_15717951e-60Arabidopsis thaliana clone 27366 mRNA, complete sequence.402004938 (159)sp|Q96471|DCAM_PHANI1e-32S-adenosylmethionine decarboxylase proenzyme (EC 4.1.1.50) (AdoMetDC) (SamDC) [C
JMFF049C08Sequence632004938 (159)gb:AF291761_17837164e-14Ipomoea batatas S-adenosylmethionine decarboxylase (SAMDC) gene, complete cds.620004938 (159)sp|Q96471|DCAM_PHANI2e-75S-adenosylmethionine decarboxylase proenzyme (EC 4.1.1.50) (AdoMetDC) (SamDC) [C
JMFF049C23Sequence531004938 (159)gb:AF291761_17837162e-14Ipomoea batatas S-adenosylmethionine decarboxylase (SAMDC) gene, complete cds.471004938 (159)sp|Q96471|DCAM_PHANI1e-37S-adenosylmethionine decarboxylase proenzyme (EC 4.1.1.50) (AdoMetDC) (SamDC) [C
JMFF050E04Sequence562004938 (159)gb:AF291761_17837163e-14Ipomoea batatas S-adenosylmethionine decarboxylase (SAMDC) gene, complete cds.360004938 (159)sp|Q96471|DCAM_PHANI3e-38S-adenosylmethionine decarboxylase proenzyme (EC 4.1.1.50) (AdoMetDC) (SamDC) [C
JMFF050G14Sequence638004938 (159)gb:AF291761_17837164e-14Ipomoea batatas S-adenosylmethionine decarboxylase (SAMDC) gene, complete cds.609004938 (159)sp|Q96471|DCAM_PHANI3e-74S-adenosylmethionine decarboxylase proenzyme (EC 4.1.1.50) (AdoMetDC) (SamDC) [C
JMFN012C15Sequence614004938 (159)sp|Q96471|DCAM_PHANI8e-88S-adenosylmethionine decarboxylase proenzyme (EC 4.1.1.50) (AdoMetDC) (SamDC) [C
JMFN015O09Sequence611004938 (159)sp|Q96471|DCAM_PHANI6e-83S-adenosylmethionine decarboxylase proenzyme (EC 4.1.1.50) (AdoMetDC) (SamDC) [C
JMFN018E14Sequence614004938 (159)sp|Q96471|DCAM_PHANI1e-96S-adenosylmethionine decarboxylase proenzyme (EC 4.1.1.50) (AdoMetDC) (SamDC) [C
JMFN039M17Sequence629004938 (159)sp|Q96471|DCAM_PHANI3e-85S-adenosylmethionine decarboxylase proenzyme (EC 4.1.1.50) (AdoMetDC) (SamDC) [C
JMFN043G12Sequence623004938 (159)sp|Q96471|DCAM_PHANI3e-17S-adenosylmethionine decarboxylase proenzyme (EC 4.1.1.50) (AdoMetDC) (SamDC) [C
JMFN044I10Sequence527004938 (159)sp|Q96471|DCAM_PHANI4e-71S-adenosylmethionine decarboxylase proenzyme (EC 4.1.1.50) (AdoMetDC) (SamDC) [C
JMFS002C05Sequence576004938 (159)gb:AF291761_17837163e-14Ipomoea batatas S-adenosylmethionine decarboxylase (SAMDC) gene, complete cds.
JMFS051G03Sequence628004938 (159)gb:AF291761_17837164e-14Ipomoea batatas S-adenosylmethionine decarboxylase (SAMDC) gene, complete cds.
JMFS075H01Sequence626004938 (159)gb:AF291761_17837164e-14Ipomoea batatas S-adenosylmethionine decarboxylase (SAMDC) gene, complete cds.
JMFS076B03Sequence616004938 (159)gb:AF291761_17837163e-14Ipomoea batatas S-adenosylmethionine decarboxylase (SAMDC) gene, complete cds.
JMFS085E05Sequence270004938 (159)sp|Q96471|DCAM_PHANI2e-35S-adenosylmethionine decarboxylase proenzyme (EC 4.1.1.50) (AdoMetDC) (SamDC) [C
JMFS098H01Sequence627004938 (159)gb:AF291761_17837164e-14Ipomoea batatas S-adenosylmethionine decarboxylase (SAMDC) gene, complete cds.
JMFS120A09Sequence624004938 (159)sp|Q96471|DCAM_PHANI3e-80S-adenosylmethionine decarboxylase proenzyme (EC 4.1.1.50) (AdoMetDC) (SamDC) [C
JMFS129C06Sequence625004938 (159)sp|Q96471|DCAM_PHANI2e-70S-adenosylmethionine decarboxylase proenzyme (EC 4.1.1.50) (AdoMetDC) (SamDC) [C
JMSF008A16Sequence268004938 (159)781004938 (159)sp|Q96471|DCAM_PHANIe-116S-adenosylmethionine decarboxylase proenzyme (EC 4.1.1.50) (AdoMetDC) (SamDC) [C
JMSF015J07Sequence262004938 (159)771004938 (159)sp|Q96471|DCAM_PHANIe-124S-adenosylmethionine decarboxylase proenzyme (EC 4.1.1.50) (AdoMetDC) (SamDC) [C
JMSF017E19Sequence260004938 (159)806004938 (159)sp|Q96471|DCAM_PHANIe-120S-adenosylmethionine decarboxylase proenzyme (EC 4.1.1.50) (AdoMetDC) (SamDC) [C
JMSF019L05Sequence594004938 (159)gb:AF291761_17837163e-14Ipomoea batatas S-adenosylmethionine decarboxylase (SAMDC) gene, complete cds.696004938 (159)sp|Q96471|DCAM_PHANI5e-98S-adenosylmethionine decarboxylase proenzyme (EC 4.1.1.50) (AdoMetDC) (SamDC) [C
JMSF024D02Sequence676004938 (159)gb:AF291761_17837164e-14Ipomoea batatas S-adenosylmethionine decarboxylase (SAMDC) gene, complete cds.740004938 (159)sp|Q96471|DCAM_PHANIe-104S-adenosylmethionine decarboxylase proenzyme (EC 4.1.1.50) (AdoMetDC) (SamDC) [C
JMSF024H19Sequence687004938 (159)gb:AF291761_17837164e-14Ipomoea batatas S-adenosylmethionine decarboxylase (SAMDC) gene, complete cds.770004938 (159)sp|Q96471|DCAM_PHANIe-116S-adenosylmethionine decarboxylase proenzyme (EC 4.1.1.50) (AdoMetDC) (SamDC) [C
JMSF032B24Sequence700004938 (159)gb:AF291761_17837164e-14Ipomoea batatas S-adenosylmethionine decarboxylase (SAMDC) gene, complete cds.711004938 (159)sp|Q96471|DCAM_PHANIe-101S-adenosylmethionine decarboxylase proenzyme (EC 4.1.1.50) (AdoMetDC) (SamDC) [C
JMSF032J09Sequence695004938 (159)gb:AF291761_17837165e-14Ipomoea batatas S-adenosylmethionine decarboxylase (SAMDC) gene, complete cds.751004938 (159)sp|Q96471|DCAM_PHANIe-109S-adenosylmethionine decarboxylase proenzyme (EC 4.1.1.50) (AdoMetDC) (SamDC) [C
JMSF035L10Sequence677004938 (159)gb:AF291761_17837164e-14Ipomoea batatas S-adenosylmethionine decarboxylase (SAMDC) gene, complete cds.721004938 (159)sp|Q96471|DCAM_PHANIe-105S-adenosylmethionine decarboxylase proenzyme (EC 4.1.1.50) (AdoMetDC) (SamDC) [C
JMSF036O04Sequence632007118 (8)pir|E96508|E965084e-40hypothetical protein T12C22.19 [imported] - Arabidopsis thaliana>gb:AE005173_892716004938 (159)sp|Q96471|DCAM_PHANIe-102S-adenosylmethionine decarboxylase proenzyme (EC 4.1.1.50) (AdoMetDC) (SamDC) [C
JMSF037A19Sequence380004938 (159)sp|Q96471|DCAM_PHANI5e-34S-adenosylmethionine decarboxylase proenzyme (EC 4.1.1.50) (AdoMetDC) (SamDC) [C
JMSF045C12Sequence759004938 (159)sp|Q96471|DCAM_PHANI5e-20S-adenosylmethionine decarboxylase proenzyme (EC 4.1.1.50) (AdoMetDC) (SamDC) [C769004938 (159)sp|Q96471|DCAM_PHANIe-120S-adenosylmethionine decarboxylase proenzyme (EC 4.1.1.50) (AdoMetDC) (SamDC) [C
JMSF045N14Sequence814004938 (159)sp|Q96471|DCAM_PHANI9e-31S-adenosylmethionine decarboxylase proenzyme (EC 4.1.1.50) (AdoMetDC) (SamDC) [C766004938 (159)sp|Q96471|DCAM_PHANIe-101S-adenosylmethionine decarboxylase proenzyme (EC 4.1.1.50) (AdoMetDC) (SamDC) [C
JMSF050D12Sequence464004938 (159)gb:AF291761_17837168e-14Ipomoea batatas S-adenosylmethionine decarboxylase (SAMDC) gene, complete cds.667004938 (159)sp|Q96471|DCAM_PHANIe-103S-adenosylmethionine decarboxylase proenzyme (EC 4.1.1.50) (AdoMetDC) (SamDC) [C
JMSF050E12Sequence675004938 (159)gb:AF291761_17837164e-14Ipomoea batatas S-adenosylmethionine decarboxylase (SAMDC) gene, complete cds.804004938 (159)sp|Q96471|DCAM_PHANIe-117S-adenosylmethionine decarboxylase proenzyme (EC 4.1.1.50) (AdoMetDC) (SamDC) [C

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF049C23- TTA
rJMFF048H10- A
JMFS129C06- GAGAACTAGTCTCGAGTTTTTTTTTTTTTTTTTTA
rJMFF046E15- TTTTTTTTTTTTTTTTA
rJMFF038E23- TTA
rJMFF044M03- A
rJMFF049C08- A
rJMFF050G14- A
rJMFF001K20- TTA
rJMFF047P12- A
rJMFF007F17- TTA
                      ____________________________________________________________
consensus GAGAACTAGTCTCGAGTTTTTTTTTTTTTTTTTTA
 
. : . : . : . : . : . :
rJMFF049C23- CTTAAGCACTCAAGTTTATTACCATCACAACATGTTCA-ACAACAACAAATGAACTCTGA
rJMFF041C04- CTTAAGCACTCAAGTTTATTACCATCACAACATGTTCA-ACAACAACAAATGAACTCTGA
rJMFF048H10- CTTAAGCACTCAAGTTTATTACCATCACAACATGTTCA-ACAACAACAAATGAACTCTGA
JMFS129C06- CTTAAGCACTCAAGTTTATTACCATCACAACATGTTCA-ACAACAACAAATGAACTCTGA
rJMFF046E15- CTTAAGCACTCAAGTTTATTACCATCACAACATGTTCA-ACAACAACAAATGAACTCTGA
rJMFF038E23- CTTAAGCACTCAAGTTTATTACCATCACAACATGTTCA-ACAACAACAAATGAACTCTGA
rJMFF014I09- GTTTATTACCATCACAACATGTTCA-ACAACAACAAATGAACTCTGA
rJMFF007E07- GTTTATTACCATCACAACATGTTCA-ACAACAACAAATGAACTCTGA
rJMFF038K02- TTCA-ACAACAACAAATGAACTCTGA
rJMFF022G08- ATGTTCA-ACAACAACAAATGAACTCTGA
rJMFF002C05- AGTTTATTACCATCACAACATGTTCA-ACAACAACAAATGAACTCTGA
rJMFF033K01- TTTATTACCATCACAACATGTTCA-ACAACAACAAATGAACTCTGA
rJMFF018O13- AACATGTTCA-ACAACAACAAATGAACTCTGA
rJMFF024G10- ACTCTGA
rJMFF036A04- AATGAACTCTGA
rJMFF015K19- TATTACCATCACAACATGTTCA-ACAACAACAAATGAACTCTGA
rJMFF044M03- CTTAAGCACTCAAGTTTATTACCATCACAACATGTTCA-ACAACAACAAATGAACTCTGA
rJMFF049C08- CTTAAGCACTCAAGTTTATTACCATCACAACATGTTCA-ACAACAACAAATGAACTCTGA
rJMFF045B18- CTTAAGCACTCAAGTTTATTACCATCACAACATGTTCA-ACAACAACAAATGAACTCTGA
rJMFF037M04- AATGAACTCTGA
rJMSF037A19- ATGAACTCTGA
JMFS120A09+ CAACATGTTCA-ACAACAACAAATGAACTCTGA
JMFN015O09+ A-ACAACAACAAATGAACTCTGA
rJMFF050G14- CTTAAGCACTCAAGTTTATTACCATCACAACATGTTCA-ACAACAACAAATGAACTCTGA
rJMFF001K20- CTTAAGCACTCAAGTTTATTACCATCACAACATGTTCA-ACAACAACAAATGAACTCTGA
rJMFF047P12- CTTAAGCACTCANGTTTATTACCATCACAACATGTTCA-ACAACAACAAATGAACTCTGA
rJMFF007F17- CTTAAGCACTCAAGTTTATTACCATCACAACATGTTCA-ACAACAACAAATGAACTCTGA
rJMFF035P13- TTACCATCACAACATGTTCA-ACAACAACAAATGAACTCTGA
rJMFF020E21- GTTTATTACCATCACAACATGTTCA-ACAACAACAAATGAACTCTGA
rJMFF012F14- TCACAACATGTTCA-ACAACAACAAATGAACTCTGA
rJMFF004H09- TCACAACATGTTCA-ACAACAACAAATGAACTCTGA
rJMFF032P21- AACATGTTCA-ACAACAACAAATGAACTCTGA
rJMFF023F22- TCA-ACAACAACAAATGAACTCTGA
rJMFF005K17- CA-ACAACAACAAATGAACTCTGA
rJMSF019L05- AATGAACTCTGA
rJMFF034N04- CTCTGA
rJMFF001M19- ACAAATGAACTCTGA
rJMFF001L19- TGAACTCTGA
rJMFF013C19- CTGA
rJMFF001K14- ACAAATGAACTCTGA
rJMFF028C05- AATGAACTCTGA
rJMFF008E17- AACAACAAATGAACTCTGA
rJMFF028M07- ATGAACTCTGA
JMFN039M17+ GA
rJMFF039E24- AAGTTTATTACCATCACAACATGTTCA-ACAACAACAAATGAACTCTGA
rJMSF045N14- TTATTACCATCACAACATGTTTCAACAACAACAAATGAACTCTGA
rJMFF023F17- AACATGTTCA-ACAACAACAAATGAACTCTGA
rJMSF024H19- CAAATGAACTCTGA
rJMFF040M15- AACTCTGA
rJMFF024H12- ACTCTGA
rJMFF038F03- AATGAACTCTGA
rJMSF024D02- AAATGAACTCTGA
rJMSF035L10- CAAATGAACTCTGA
rJMFF016K04- CATGTTCA-ACAACAACAAATGAACTCTGA
rJMSF036O04- TC-ACAACAACAAATGAACTCTGA
rJMFF024N03- AATGAACTCTGA
rJMFF002F07- A-ACAACAACAAATGAACTCTGA
rJMFF019H23- AATGAACTCTGA
rJMFF020J13- AATGAACTCTGA
rJMFF022I03- CTCTGA
rJMFF014G05- ACATGTTCA-ACAACAACAAATGAACTCTGA
rJMSF032J09- TC-ACAACAACAAATGAACTCTGA
rJMSF032B24- TC-ACAACAACAAATGAACTCTGA
rJMSF008A16- TC-ACAACAACAAATGAACTCTGA
rJMSF050E12- TC-ACAACAACAAATGAACTCTGA
rJMSF017E19- TC-ACAACAACAAATGAACTCTGA
rJMFF040P16- GAACTCTGA
rJMFF012K01- ATGAACTCTGA
                      ____________________________________________________________
consensus CTTAAGCACTCAAGTTTATTACCATCACAACATGTTCA-ACAACAACAAATGAACTCTGA
 
. : . : . : . : . : . :
rJMFF049C23- ATACGATAAATGTCTGAAATGACCACATAACGTGGACTACTAGATTGTCCACTAATGATT
rJMFF041C04- ATACGATAAATGTCTGAAATGACCACATAACGTGGACTACTAGATTGTCCACTAATGATT
rJMFF048H10- ATACGATAAATGTCTGAAATGACCACATAACGTGGACTACTAGATTGTCCACTAATGATT
JMFS129C06- ATACGATAAATGTCTGAAATGACCACATAACGTGGACTACTAGATTGTCCACTAATGATT
rJMFF046E15- ATACGATAAATGTCTGAAATGACCACATAACGTGGACTACTAGATTGTCCACTAATGATT
rJMFF038E23- ATACGATAAATGTCTGAAATGACCACATAACGTGGACTACTAGATTGTCCACTAATGATT
rJMFF014I09- ATACGATAAATGTCTGAAATGACCACATAACGTGGACTACTAGATTGTCCACTAATGATT
rJMFF007E07- ATACGATAAATGTCTGAAATGACCACATAACGTGGACTACTAGATTGTCCACTAATGATT
rJMFF038K02- ATACGATAAATGTCTGAAATGACCACATAACGTGGACTACTAGATTGTCCACTAATGATT
rJMFF022G08- ATACGATANATGTCTGAAATGACCACATAACGTGGACTACTAGATTGTCCACTAATGATT
rJMFF002C05- ATACGATAAATGTCTGAAATGACCACATAACGTGGACTACTAGATTGTCCACTAATGATT
rJMFF033K01- ATACGATAAATGTCTGAAATGACCACATAACGTGGACTACTAGATTGTCCACTAATGATT
rJMFF018O13- ATACGATAAATGTCTGAAATGACCACATAACGTGGACTACTAGATTGTCCACTAATGATT
rJMFF024G10- ATACGATAAATGTCTGAAATGACCACATAACGTGGACTACTAGATTGTCCACTAATGATT
rJMFF036A04- ATACGATAAATGTCTGAAATGACCACATAACGTGGACTACTAGATTGTCCACTAATGATT
rJMFF015K19- ATACGATAAATGTCTGAAATGACCACATAACGTGGACTACTAGATTGTCCACTAATGATT
rJMFF044M03- ATACGATAAATGTCTGAAATGACCACATAACGTGGACTACTAGATTGTCCACTAATGATT
rJMFF049C08- ATACGATAAATGTCTGAAATGACCACATAACGTGGACTACTAGATTGTCCACTAATGATT
rJMFF045B18- ATACGATAAATGTCTGAAATGACCACATAACGTGGACTACTAGATTGTCCACTAATGATT
rJMFF037M04- ATACGATAAATGTCTGAAATGACCACATAACGTGGACTACTAGATTGTCCACTAATGATT
rJMSF037A19- ATACGATAAATGTCTGAAATGACCACATAACGTGGACTACTAGATTGTCCACTAATGATT
JMFS120A09+ ATACGATAAATGTCTGAAATGACCACATAACGTGGACTACTAGATTGTCCACTAATGATT
JMFN015O09+ ATACGATAAATGTCTGAAATGACCACATAACGTGGACTACTAGATTGTCCACTAATGATT
rJMFF050G14- ATACGATAAATGTCTGAAATGACCACATAACGTGGACTACTAGATTGTCCACTAATGATT
rJMFF001K20- ATACGATAAATGTCTGAAATGACCACATAACGTGGACTACTAGATTGTCCACTAATGATT
rJMFF034N15- TCTGAAATGACCACATAACGTGGACTACTAGATTGTCCACTAATGATT
rJMFF047P12- ATACGATNAATGTCTGAAATGACCACATAACGTGGACTACTAGATTGTCCACTAATGATT
rJMFF007F17- ATACGATAAATGTCTGAAATGACCACATAACGTGGACTACTAGATTGTCCACTAATGATT
rJMFF035P13- ATACGATAAATGTCTGAAATGACCACATAACGTGGACTACTAGATTGTCCACTAATGATT
rJMFF020E21- ATACGATAAATGTCTGAAATGACCACATAACGTGGACTACTAGATTGTCCACTAATGATT
rJMFF012F14- ATACGATAAATGTCTGAAATGACCACATAACGTGGACTACTAGATTGTCCACTAATGATT
rJMFF004H09- ATACGATAAATGTCTGAAATGACCACATAACGTGGACTACTAGATTGTCCACTAATGATT
rJMFF032P21- ATACGATAAATGTCTGAAATGACCACATAACGTGGACTACTAGATTGTCCACTAATGATT
rJMFF023F22- ATACGATAAATGTCTGAAATGACCACATAACGTGGACTACTAGATTGTCCACTAATGATT
rJMFF005K17- ATACGATAAATGTCTGAAATGACCACATAACGTGGACTACTAGATTGTCCACTAATGATT
rJMSF019L05- ATACGATAAATGTCTGAAATGACCACATAACGTGGACTACTAGATTGTCCACTAATGATT
rJMFF034N04- ATACGATAAATGTCTGAAATGACCACATAACGTGGACTACTAGATTGTCCACTAATGATT
rJMFF001M19- ATACGATAAATGTCTGAAATGACCACATAACGTGGACTACTAGATTGTCCACTAATGATT
rJMFF001L19- ATACGATAAATGTCTGAAATGACCACATAACGTGGACTACTAGATTGTCCACTAATGATT
JMFN044I10+ TGAAATGACCACATAACGTGGACTACTAGATTGTCCACTAATGATT
rJMFF050E04- CTGAAATGACCACATAACGTGGACTACTAGATTGACCACTAATGATT
JMFN012C15+ ATACGATAAATGTCTGAAATGACCACATAACGTGGACTACTAGATTGTCCACTAATGATT
JMFN018E14+ ACTAATGATT
rJMFF013C19- ATACGATNGATGGCTGANATGACCNCATAACGTGGACTACTANATTGTCCACTAATGATT
rJMFF001K14- ATACGATAAATGTCTGAAATGACCACATAACGTGGACTACTAGATTGTCCACTAATGATT
rJMFF028C05- ATACGATAAATGTCTGAAATGACCACATAACGTGGACTACTAGATTGTCCACTAATGATT
rJMFF008E17- ATACGATAAATGTCTGAAATGACCACATAACGTGGACTACTAGATTGTCCACTAATGATT
rJMFF028M07- ATACGATAAATGTCTGAAATGACCACATAACGTGGACTACTAGATTGTCCACTAATGATT
JMFN039M17+ ATACGATAAATGTCTGAAATGACCACATAACGTGGACTACTAGATTGTCCACTAATGATT
rJMFF039E24- ATACGATAAATGTCTGAAATGACCACATAACGTGGACTACTAGATTGTCCACTAATGATT
rJMSF045N14- ATACGATAAATGTCTGAAATGACCACATAACGTGGACTACTAGATTGTCCACTAATGATT
rJMFF023F17- ATACGATAAATGTCTGAAATGACCACATAACGTGGACTACTAGATTGTCCACTAATGATT
rJMSF024H19- ATACGATAAATGTCTGAAATGACCACATAACGTGGACTACTAGATTGTCCACTAATGATT
rJMFF040M15- ATACGATAAATGTCTGAAATGACCACATAACGTGGACTACTAGATTGTCCACTAATGATT
rJMFF024H12- ATACGATAAATGTCTGAAATGACCACATAACGTGGACTACTAGATTGTCCACTAATGATT
rJMFF038F03- ATACGATAAATGTCTGAAATGACCACATAACGTGGACTACTAGATTGTCCACTAATGATT
rJMSF024D02- ATACGATAAATGTCTGAAATGACCACATAACGTGGACTACTAGATTGTCCACTAATGATT
rJMSF035L10- ATACGATAAATGTCTGAAATGACCACATAACGTGGACTACTAGATTGTCCACTAATGATT
rJMFF016K04- ATACGATAAATGTCTGAAATGACCACATAACGTGGACTACTAGATTGTCCACTAATGATT
rJMSF036O04- ATACGATAAATGTCTGAAATGACCACATAACGTGGACTACTAGATTGTCCACTAATGATT
rJMFF024N03- ATACGATAAATGTCTGAAATGACCACATAACGTGGACTACTAGATTGTCCACTAATGATT
rJMFF002F07- ATACGATAAATGTCTGAAATGACCACATAACGTGGACTACTAGATTGTCCACTAATGATT
rJMFF019H23- ATACGATAAATGTCTGAAATGACCACATAACGTGGACTACTAGATTGTCCACTAATGATT
rJMFF020J13- ATACGATAAATGTCTGAAATGACCACATAACGTGGACTACTAGATTGTCCACTAATGATT
rJMFF022I03- ATACGATAAATGTCTGAAATGACCACATAACGTGGACTACTAGATTGTCCACTAATGATT
rJMFF014G05- ATACGATAAATGTCTGAAATGACCACATAACGTGGACTACTAGATTGTCCACTAATGATT
rJMSF032J09- ATACGATAAATGTCTGAAATGACCACATAACGTGGACTACTAGATTGTCCACTAATGATT
rJMSF032B24- ATACGATAAATGTCTGAAATGACCACATAACGTGGACTACTAGATTGTCCACTAATGATT
rJMSF008A16- ATACGATAAATGTCTGAAATGACCACATAACGTGGACTACTAGATTGTCCACTAATGATT
rJMSF050E12- ATACGATAAATGTCTGAAATGACCACATAACGTGGACTACTAGATTGTCCACTAATGATT
rJMSF017E19- ATACGATAAATGTCTGAAATGACCAAATAACGTGGACTACTAGATTGTCCACTAATGATT
rJMSF050D12- AATGATT
rJMFF008K11- TACGATAAATGTCTGAAATGACCACATAACGTGGACTACTAGATTGTCCACTAATGATT
rJMSF045C12- TCTGAAATGACCACATAACGTGGACTACTAGATTGTCCACTAATGATT
rJMFF020D24- ATGTCTGAAATGACCACATAACGTGGACTACTAGATTGTCCACTAATGATT
rJMFF040P16- ATACGATAAATGTCTGAAATGACCACATAACGTGGACTACTAGATTGTCCACTAATGATT
rJMFF003K21- ACGATAAATGTCTGAAATGACCACATAACGTGGACTACTAGATTGTCCACTAATGATT
rJMFF018L18- TACGATAAATGTCTGAAATGACCACATAACGTGGACTACTAGATTGTCCACTAATGATT
rJMFF012K01- ATACGATAAATATCTAAAATGACAACATAACATAGACTACTAGATTGTCACCTAATGATT
rJMSF015J07- CATAACGTGGACTACTAGATTGTCCACTAATGATT
rJMFF038H05- ACGTGGACTACTAGATTGTCCACTAATGATT
rJMFF031E15- AACGTGGACTACTAGATTGTCCACTAATGATT
rJMFF013K04- AATGACCACATAACGTGGACTACTAGATTGTCCACTAATGATT
                      ____________________________________________________________
consensus ATACGATAAATGTCTGAAATGACCACATAACGTGGACTACTAGATTGTCCACTAATGATT
 
. : . : . : . : . : . :
rJMFF049C23- CCACATAACAGAATCTTTATTCCACAACAGGCAAGTAGATNATATAAAAA-ATACTAATA
rJMFF041C04- CCACATAACAGAATCTTTATTCCACAACAGGCAAGTAGATAATATAAAAA-ATACTAATA
rJMFF048H10- CCACATAACAGAATCTTTATTCCACAACAGGCAAGTAGATNATATAAAAA-ATACTAATA
JMFS129C06- CCACATAACAGAATCTTTATTCCACAACAGGCAAGTAGATAATATAAAAA-ATACTAATA
rJMFF046E15- CCACATAACAGAATCTTTATTCCACAACAGGCAAGTAGATAATATAAAAA-ATACTAATA
rJMFF038E23- CCACATAACAGAATCTTTATTCCACAACAGGCAAGTAGATAATATAAAAA-ATACTAATA
rJMFF014I09- CCACATAACAGAATCTTTATTCCACAACAGGCAAGTAGATAATATAAAAA-ATACTAATA
rJMFF007E07- CCACATAACAGAATCTTTATTCCACAACAGGCAAGTAGATAATATAAAAA-ATACTAATA
rJMFF038K02- CCACATAACAGAATCTTTATTCCACAACAGGCAAGTAGATAATATAAAAA-ATACTAATA
rJMFF022G08- CCACATAACAGAATCTTTATTCCACAACAGGCAAGTAGATAATATAAAAA-ATACTAATA
rJMFF002C05- CCACATAACAGAATCTTTATTCCACAACAGGCAAGTAGATAATATAAAAA-ATACTAATA
rJMFF033K01- CCACATAACAGAATCTTTATTCCACAACAGGCAAGTAGATAATATAAAAA-ATACTAATA
rJMFF018O13- CCACATAACAGAATCTTTATTCCACAACAGGCAAGTAGATAATATAAAAA-ATACTAATA
rJMFF024G10- CCACATAACAGAATCTTTATTCCACAACAGGCAAGTAGATAATATAAAAA-ATACTAATA
rJMFF036A04- CCACATAACAGAATCTTTATTCCACAACAGGCAAGTAGATAATATAAAAA-ATACTAATA
rJMFF015K19- CCACATAACAGAATCTTTATTCCACAACAGGCAAGTAGATAATATAAAAA-ATACTAATA
rJMFF044M03- CCACATAACAGAATCTTTATTCCACAACAGGCAAGTAGATAATATAAAAA-ATACTAATA
rJMFF049C08- CCACATAACAGAATCTTTATTCCACAACAGGCAAGTAGATAATATAAAAA-ATACTAATA
rJMFF045B18- CCACATAACAGAATCTTTATTCCACAACAGGCAAGTAGATTATATAAAAA-ATACTAATA
rJMFF037M04- CCACATAACAGAATCTTTATTCCACAACAGGCAAGTAGATAATATAAAAA-ATACTAATA
rJMSF037A19- CCACATAACAGAATCTTTATTCCACAACAGGCAAGTAGATAATATAAAAA-ATACTAATA
JMFS120A09+ CCACATAACAGAATCTTTATTCCACAACAGGCAAGTAGATAATATAAAAA-ATACTAATA
JMFN015O09+ CCACATAACAGAATCTTTATTCCACAACAGGCAAGTAGATAATATAAAAA-ATACTAATA
rJMFF050G14- CCACATAACAGAATCTTTATTCCACAACAGGCAAGTAGATAATATAAAAA-ATACTAATA
rJMFF001K20- CCACATAACAGAATCTTTATTCCACAACAGGCAAGTAGATAATATAAAAA-ATACTAATA
rJMFF034N15- CCACATAACAGAATCTTTATTCCACAACAGGCAAGTAGATAATATAAAAA-ATACTAATA
rJMFF047P12- CCACATAACAGAATCTTTATTCCACAACAGGCAAGTAGATTATATAAAAA-ATACTAATA
rJMFF007F17- CCACATAACAGAATCTTTATTCCACAACAGGCAAGTAGATAATATAAAAA-ATACTAATA
rJMFF035P13- CCACATAACAGAATCTTTATTCCACAACAGGCAAGTAGATAATATAAAAA-ATACTAATA
rJMFF020E21- CCACATAACAGAATCTTTATTCCACAACAGGCAAGTAGATAATATAAAAA-ATACTAATA
rJMFF012F14- CCACATAACAGAATCTTTATTCCACAACAGGCAAGTAGATAATATAAAAA-ATACTAATA
rJMFF004H09- CCACATAACAGAATCTTTATTCCACAACAGGCAAGTAGATAATATAAAAA-ATACTAATA
rJMFF032P21- CCACATAACAGAATCTTTATTCCACAACAGGCAAGTAGATAATATAAAAA-ATACTAATA
rJMFF023F22- CCACATAACAGAATCTTTATTCCACAACAGGCAAGTAGATAATATAAAAA-ATACTAATA
rJMFF005K17- CCACATAACAGAATCTTTATTCCACAACAGGCAAGTAGATAATATAAAAA-ATACTAATA
rJMSF019L05- CCACATAACAGAATCNTTATTCCACAACAGGCAAGTAGATAATATAAAAG-ATACTAATA
rJMFF034N04- CCACATAACAGAATCTTTATTCCACAACAGGCAAGTAGATAATATAAAAA-ATACTAATA
rJMFF001M19- CCACATAACAGAATCTTTATTCCACAACAGGCAAGTAGATAATATAAAAA-ATACTAATA
rJMFF001L19- CCACATAACAGAATCTTTATTCCACAACAGGCAAGTAGATAATATAAAAA-ATACTAATA
JMFN044I10+ CCACATAACAGAATCTTTATTCCACAACAGGCAAGTAGATAATATAAAAA-ATACTAATA
rJMFF050E04- CCACATAACAGAATCTTTATTCCACAACAGGCAAGTAGATAATATAAAAA-ATACTAATA
JMFN012C15+ CCACATAACAGAATCTTTATTCCACAACAGGCAAGTAGATAATATAAAAA-ATACTAATA
JMFN018E14+ CCACATAACAGAATCTTATTTCCACAACAGGCAAGTAGATAATATAAAAA-ATACTAATA
rJMFF013C19- CCACATAACANAATCTTTATTCCACAANAGGCAAGTAGATAATATAAAAA-ATACTAATA
rJMFF001K14- CCACATAACAGAATCTTTATTCCACAACAGGCAAGTAGATAATATAAAAA-ATACTAATA
rJMFF028C05- CCACATAACAGAATCTTTATTCCACAACAGGCAAGTAGATAATATAAAAA-ATACTAATA
rJMFF008E17- CCACATAACAGAATCTTTATTCCACAACAGGCAAGTAGATAATATAAAAA-ATACTAATA
rJMFF028M07- CCACATAACAGAATCTTTATTCCACAACAGGCAAGTAGATAATATAAAAA-ATACTAATA
JMFN039M17+ CCACATAACAGAATCTTTATTCCACAACAGGCAAGTAGATAATATAAAAA-ATNCTAATA
rJMFF039E24- CCACATAACAGAATCTTTATTCCACAACAGGCAAGTAGATAATATAAAAA-ATACTAATA
rJMSF045N14- CCACATAACAGAATCTTTATTCCACAACAGGCAAGTAGATAATATAAAAA-ATACTAATA
rJMFF023F17- CCACATAACAGAATCTTTATTCCACAACAGGCAAGTAGATAATATAAAAA-ATACTAATA
rJMSF024H19- CCACATAACAGAATCTTTATTCCACAACAGGCAAGTAGATAATATAAAAA-ATACTAATA
rJMFF040M15- CCACATAACAGAATCTTTATTCCACAACAGGCAAGTAGATAATATAAAAA-ATACTAATA
rJMFF024H12- CCACATAACAGAATCTTTATTCCACAACAGGCAAGTAGATAATATAAAAA-ATACTAATA
rJMFF038F03- CCACATAACAGAATCTTTATTCCACAACAGGCAAGTAGATAATATAAAAA-ATACTAATA
rJMSF024D02- CCACATAACAGAATCTTTATTCCACAACAGGCAAGTAGATAATATAAAAA-ATACTAATA
rJMSF035L10- CCACATAACAGAATCTTTATTCCACAACAGGCAAGTAGATAATATAAAAA-ATACTAATA
rJMFF016K04- CCACATAACAGAATCTTTATTCCACAACAGGCAAGTAGATAATATAAAAA-ATACTAATA
rJMSF036O04- CCACATAACAGAATCTTTATTCCACAACAGGCAAGTAGATAATATAAAAA-ATACTAATA
rJMFF024N03- CCACATAACAGAATCTTTATTCCACAACAGGCAAGTAGATAATATAAAAA-ATACTAATA
rJMFF002F07- CCACATAACAGAATCTTTATTCCACAACAGGCAAGTAGATAATATAAAAA-ATACTAATA
rJMFF019H23- CCACATAACAGAATCTTTATTCCACAACAGGCAAGTAGATAATATAAAAA-ATACTAATA
rJMFF020J13- CCACATAACAGAATCTTTATTCCACAACAGGCAAGTAGATAATATAAAAA-ATACTAATA
rJMFF022I03- CCACATAACAGAATCTTTATTCCACAACAGGCAAGTAGATAATATAAAAA-ATACTAATA
rJMFF014G05- CCACATAACAGAATCTTTATTCCACAACAGGCAAGTAGATAATATAAAAA-ATACTAATA
rJMSF032J09- CCACATAACAGAATCTTTATTCCACAACAGGCAAGTAGATAATATAAAAA-ATACTAATA
rJMSF032B24- CCACATAACAGAATCTTTATTCCACAACAGGCAAGTAGATAATATAAAAA-ATACTAATA
rJMSF008A16- CCACATAACAGAATCTTTATTCCACAACAGGCAAGTAGATAATATAAAAA-ATACTAATA
rJMSF050E12- CCACATAACAGAATCTTTATTCCACAACAGGCAAGTAGATAATATAAAAA-ATACTAATA
rJMSF017E19- CCACATAACAGAATCTTTATTCCACAACAGGCAAGTAGATAATATAAAAA-ATACTAATA
rJMSF050D12- CCACATAACANAATCTTTATTCCACAACAGGCNNGTAGATAATATAAAAA-ATACTAATA
rJMFF008K11- CCACATAACAGAATCTTTATTCCACAACAGGCAAGTAGATAATATAAAAA-ATACTAATA
rJMSF045C12- CCACATAACAGAATCTTTATTCCACAACAGGCAAGTAGATAATATAAAAA-ATACTAATA
rJMFF020D24- CCACATAACAGAACCTTTATTCCACAACAGGCAAGTAGATAATATAAAAA-ATACTAATA
rJMFF040P16- CCACATAACAGAATCTTTATTCCACAACAGGCAAGTAGATAATATAAAAA-ATACTAATA
rJMFF003K21- CCACATAACAGAATCTTTATTCCACAACAGGCAAGTAGATAATATAAAAA-ATACTAATA
rJMFF018L18- CCACATAACAGAATCTTTATTCCACAACAGGCAAGTAGATAATATAAAAA-ATACTAATA
rJMFF012K01- CCACATAACAGAATCTTTATTCCCCAACA--AAAGTAGATAATATAAAAAGATACTAATA
rJMSF015J07- CCACATAACAGAATCTTTATTCCACAACAGGCAAGTAGATAATATAAAAA-ATACTAATA
rJMFF038H05- CCACATAACAGAATCTTTATTCCACAACAGGCAAGTAGATAATATAAAAA-ATACTAATA
rJMFF031E15- CCACATAACAGAATCTTTATTCCACAACAGGCAAGTAGATAATATAAAAA-ATACTAATA
rJMFF013K04- CCACATAACAGAATCTTTATTCCACAACAGGCAAGTAGATAATATAAAAA-ATACTAATA
rJMFF033B02- TAAAAA-ATACTAATA
                      ____________________________________________________________
consensus CCACATAACAGAATCTTTATTCCACAACAGGCAAGTAGATAATATAAAAA-ATACTAATA
 
. : . : . : . : . : . :
rJMFF049C23- GAGAAG-AAAAACTAGAATCATCTGATTAGAAGTGTTTCTTCTCTCCTTCCTCGTCCTCG
rJMFF041C04- GAGAAG-AAAAACTAGAATCATCTGATTAGAAGGGTTTCTTCTCTCCTTCCTCGTCCTCG
rJMFF048H10- GAGAAG-AAAAACTAGAATCATCTGATTAGAAGTGTTTCTTCTCTCCTTCCTCGTCCTCG
JMFS129C06- GAGAAG-AAAAACTAGAATCATCTGATTAGAAGTGTTTCTTCTCTCCTTCCTCGTCCTCG
rJMFF046E15- GAGAAG-AAAAACTAGAATCATCTGATTAGAAGTGTTTCTTCTCTCCTTCCTCGTCCTCG
rJMFF038E23- GAGAAG-AAAAACTAGAATCATCTGATTAGAAGTGTTTCTTCTCTCCTTCCTCGTCCTCG
rJMFF014I09- GAGAAG-AAAAACTAGAATCATCTGATTAGAAGTGTTTCTTCTCTCCTTCCTCGTCCTCG
rJMFF007E07- GAGAAG-AAAAACTAGAATCATCTGATTAGAAGTGTTTCTTCTCTCCTTCCTCGTCCTCG
rJMFF038K02- GAGAAG-AAAAACTAGAATCATCTGATTAGAAGTGTTTCTTCTCTCCTTCCTCGTCCTCG
rJMFF022G08- GAGAAG-AAAAACTAGAATCATCTGATTAGAAGTGTTTCTTCTCTCCTTCCTCGTCCTCG
rJMFF002C05- GAGAAG-AAAAACTAGAATCATCTGATTAGAAGTGTTTCTTCTCTCCTTCCTCGTCCTCG
rJMFF033K01- GAGAAG-AAAAACTAGAATCATCTGATTAGAAGTGTTTCTTCTCTCCTTCCTCGTCCTCG
rJMFF018O13- GAGAAG-AAAAACTAGAATCATCTGATTAGAAGTGTTTCTTCTCTCCTTCCTCGTCCTCG
rJMFF024G10- GAGAAG-AAAAACTAGAATCATCTGATTAGAAGTGTTTCTTCTCTCCTTCCTCGTCCTCG
rJMFF036A04- GAGAAG-AAAAACTAGAATCATCTGATTAGAAGTGTTTCTTCTCTCCTTCCTCGTCCTCG
rJMFF015K19- GAGAAG-AAAAACTAGAATCATCTGATTAGAAGTGTTTCTTCTCTCCTTCCTCGTCCTCG
rJMFF044M03- GAGAAG-AAAAACTAGAATCATCTGATTAGAAGTGTTTCTTCTCTCCTTCCTCGTCCTCG
rJMFF049C08- GAGAAG-AAAAACTAGAATCATCTGATTAGAAGTGTTTCTTCTCTCCTTCCTCGTCCTCG
rJMFF045B18- GAGAAG-AAAAACTAGAATCATCTGATTAGAAGTGTTTCTTCTCTCCTTCCTCGTCCTCG
rJMFF037M04- GAGAAG-AAAAACTAGAATCATCTGATTAGAAGTGTTTCTTCTCTCCTTCCTCGTCCTCG
rJMSF037A19- GAGAAG-AAAAACTAGAATCATCTGATTAGAAGTGTTTCTTCTCTCCTTCCTCGTCCTCG
JMFS085E05- TTCTTCTCTCCTTCCTCGTCCTCG
JMFS120A09+ GAGAAG-AAAAACTAGAATCATCTGATTAGAAGTGTTTCTTCTCTCCTTCCTCGTCCTCG
JMFN015O09+ GAGAAG-AAAAACTAGAATCATCTGATTAGAAGTGTTTCTTCTCTCCTTCCTCGTCCTCG
rJMFF050G14- GAGAAG-AAAAACTAGAATCATCTGATTAGAAGTGTTTCTTCTCTCCTTCCTCGTCCTCG
rJMFF001K20- GAGAAG-AAAAACTAGAATCATCTGATTAGAAGTGTTTCTTCTCTCCTTCCTCGTCCTCG
rJMFF034N15- GAGAAG-AAAAACTAGAATCATCTGATTAGAAGTGTTTCTTCTCTCCTTCCTCGTCCTCG
rJMFF047P12- GAGAAG-AAAAACTAGAATCATCTGATTAGAAGTGTTTCTTCTCTCCTTCCTCGTCCTCG
rJMFF007F17- GAGAAG-AAAAACTAGAATCATCTGATTAGAAGTGTTTCTTCTCTCCTTCCTCGTCCTCG
rJMFF035P13- GAGAAG-AAAAACTAGAATCATCTGATTAGAAGTGTTTCTTCTCTCCTTCCTCGTCCTCG
rJMFF020E21- GAGAAGAAAAAACTAGAATCATCTGATTAGAAGTGTTTCTTCTCTCCTTCCTCGTCCTCG
rJMFF012F14- GAGAAG-AAAAACTAGAATCATCTGATTAGAAGTGTTTCTTCTCTCCTTCCTCGTCCTCG
rJMFF004H09- GAGAAG-AAAAACTAGAATCATCTGATTAGAAGTGTTTCTTCTCTCCTTCCTCGTCCTCG
rJMFF032P21- GAGAAG-AAAAACTAGAATCATCTGATTAGAAGTGTTTCTTCTCTCCTTCCTCGTCCTCG
rJMFF023F22- GAGAAG-AAAAACTAGAATCATCTGATTAGAAGTGTTTCTTCTCTCCTTCCTCGTCCTCG
rJMFF005K17- GAGAAG-AAAAACTAGAATCATCTGATTAGAAGTGTTTCTTCTCTCCTTCCTCGTCCTCG
rJMSF019L05- GAGAAG-AAAAACTAGAATCATCTGATTAGAAGTGTTTCTTCTCTCCTTCCTCGTCCTCG
rJMFF034N04- GAGAAG-AAAAACTAGAATCATCTGATTAGAAGTGTTTCTTCTCTCCTTCCTCGTCCTCG
rJMFF001M19- GAGAAG-AAAAACTAGAATCATCTGATTAGAAGTGTTTCTTCTCTCCTTCCTCGTCCTCG
rJMFF001L19- GAGAAG-AAAAACTAGAATCATCTGATTAGAAGTGTTTCTTCTCTCCTTCCTCGTCCTCG
JMFN044I10+ GAGAAG-AAAAACTAGAATCATCTGATTAGAAGTATTTCTTCTCTCCTTCCTCGTCCTCG
rJMFF050E04- GAGAAG-AAAAACTAGAATCATCTGATTAGAAGTGTTTCTTCTCTCCTTCCTCGTCCTCG
JMFN012C15+ GAGAAG-AAAAACTAGAATCATCTGATTAGAAGTGTTTCTTCTCTCCTTCCTCGTCCTCG
JMFN018E14+ GAGAAG-AAAAACTAGAATCATCTGATTAGAAGTGTTTCTTCTCTCCTTCCTCGTCCTCG
rJMFF013C19- GAGAAG---AAACTANAATCATCTGATTAGAAGTGTTTCTTCTCTCCTTCCTCGTCCTCG
rJMFF001K14- GAGAAG-AAAAACTAGAATCATCTGATTAGAAGTGTTTCTTCTCTCCTTCCTCGTCCTCG
rJMFF028C05- GAGAAG-AAAAACTAGAATCATCTGATTAGAAGTGTTTCTTCTCTCCTTCCTCGTCCTCG
rJMFF008E17- GAGAAG-AAAAACTAGAATCATCTGATTAGAAGTGTTTCTTCTCTCCTTCCTCGTCCTCG
rJMFF028M07- GAGAAG-AAAAACTAGAATCATCTGATTAGAAGTGTTTCTTCTCTCCTTCCTCGTCCTCG
JMFN039M17+ GAGAAG-AAAAACTAGAATCATCTGATTAGAAGTGTTTCTTCTCTCCTTCCTCGTCCTCG
rJMFF039E24- GAGAAG-AAAAACTAGAATCATCTGATTAGAAGTGTTTCTTCTCTCCTTCCTCGTCCTCG
rJMSF045N14- GAGAAG-AAAAACTAGAATCATCTGATTAGAAGTGTTTCTTCTCTCCTTCCTCGTCCTCG
rJMFF023F17- GAGAAG-AAAAACTAGAATCATCTGATTAGAAGTGTTTCTTCTCTCCTTCCTCGTCCTCG
rJMSF024H19- GAGAAG-AAAAACTAGAATCATCTGATTAGAAGTGTTTCTTCTCTCCTTCCTCGTCCTCG
rJMFF040M15- GAGAAG-AAAAACTAGAATCATCTGATTAGAAGTGTTTCTTCTCTCCTTCCTCGTCCTCG
rJMFF024H12- GAGAAG-AAAAACTAGAATCATCTGATTAGAAGTGTTTCTTCTCTCCTTCCTCGTCCTCG
rJMFF038F03- GAGAAG-AAAAACTAGAATCATCTGATTAGAAGTGTTTCTTCTCTCCTTCCTCGTCCTCG
rJMSF024D02- GAGAAG-AAAAACTAGAATCATCTGATTAGAAGTGTTTCTTCTCTCCTTCCTCGTCCTCG
rJMSF035L10- GAGAAG-AAAAACTAGAATCATCTGATTAGAAGTGTTTCTTCTCTCCTTCCTCGTCCTCG
rJMFF016K04- GAGAAG-AAAAACTAGAATCATCTGATTAGAAGTGTTTCTTCTCTCCTTCCTCGTCCTCG
rJMSF036O04- GAGAAG-AAAAACTAGAATCATCTGATTAGAAGTGTTTCTTCTCTCCTTCCTCGTCCTCG
rJMFF024N03- GAGAAG-AAAAACTAGAATCATCTGATTAGAAGTGTTTCTTCTCTCCTTCCTCGTCCTCG
rJMFF002F07- GAGAAG-AAAAACTAGAATCATCTGATTAGAAGTGTTTCTTCTCTCCTTCCTCGTCCTCG
rJMFF019H23- GAGAAG-AAAAACTAGAATCATCTGATTAGAAGTGTTTCTTCTCTCCTTCCTCGTCCTCG
rJMFF020J13- GAGAAG-AAAAACTAGAATCATCTGATTAGAAGTGTTTCTTCTCTCCTTCCTCGTCCTCG
rJMFF022I03- GAGAAG-AAAAACTAGAATCATCTGATTAGAAGTGTTTCTTCTCTCCTTCCTCGTCCTCG
rJMFF014G05- GAGAAG-AAAAACTAGAATCATCTGATTAGAAGTGTTTCTTCTCTCCTTCCTCGTCCTCG
rJMSF032J09- GAGAAG-AAAAACTAGAATCATCTGATTAGAAGTGTTTCTTCTCTCCTTCCTCGTCCTCG
rJMSF032B24- GAGAAG-AAAAACTAGAATCATCTGATTAGAAGTGTCTCTTCTCTCCTTCCTCGTCCTCG
rJMSF008A16- GAGAAG-AAAAACTAGAATCATCTGATTAGAAGTGTTTCTTCTCTCCTTCCTCGTCCTCG
rJMSF050E12- GAGAAG-AAAAACTAGAATCATCTGATTAGAAGTGTTTCTTCTCTCCTTCCTCGTCCTCG
rJMSF017E19- GAGAAG-AAAAACTAGAATCATCTGATTAGAAGTGTTTCTTCTCTCCTTCCTCGTCCTCG
rJMSF050D12- GAGAAG-AAAAACTAGAATCATCTGATTAGAAGTGTTTCTTCTCTCCTTCCTCGTCCTCG
rJMFF008K11- GAGAAG-AAAAACTAGAATCATCTGATTAGAAGTGTTTCTTCTCTCCTTCCTCGTCCTCG
rJMSF045C12- GAGAAG-AAAAACTAGAATCATCTGATTAGAAGTGTTTCTTCTCTCCTTCCTCGTCCTCG
rJMFF020D24- GAGAAG-AAAAACTAGAATCATCTGATTAGAAGTGTTTCTTCTCTCCTTCCTCGTCCTCG
rJMFF040P16- GAGAAG-AAAAACTAGAATCATCTGATTAGAAGTGTTTCTTCTCTCCTTCCTCGTCCTCG
rJMFF003K21- GAGAAG-AAAAACTTGAATCATCTGATTAGAAGTGTTTCTTCTCTCCTTCCTCGTCCTCG
rJMFF018L18- GAGAAG-AAAAACTAGAATCATCTGATTAGAAGTGTTTCTTCTCTCCTTCCTCGTCCTCG
rJMFF012K01- GAGAAG-AAAAACTAG-ATCATCTGGTTAGAAGTGTTTCTTCACTCTTTCCTCGTCCTCG
rJMSF015J07- GAGAAG-AAAAACTAGAATCATCTGATTAGAAGTGTTTCTTCTCTCCTTCCTCGTCCTCG
rJMFF038H05- GAGAAG-AAAAACTAGAATCATCTGATTAGAAGTGTTTCTTCTCTCCTTCCTCGTCCTCG
rJMFF031E15- GAGAAG-AAAAACTAGAATCATCTGATTAGAAGTGTTTCTTCTCTCCTTCCTCGTCCTCG
rJMFF013K04- GAGAAG-AAAAACTAGAATCATCTGATTAGAAGTGTTTCTTCTCTCCTTCCTCGTCCTCG
rJMFF033B02- GAGAAG-AAAAACTAGAATCATCTGATTAGAAGTGTTTCTTCTCTCCTTCCTCGTCCTCG
                      ____________________________________________________________
consensus GAGAAG-AAAAACTAGAATCATCTGATTAGAAGTGTTTCTTCTCTCCTTCCTCGTCCTCG
 
. : . : . : . : . : . :
rJMFF049C23- TTTTCACTCCAACAGCAGAGCAGGGTTGATCTCGGAGATCCACAACTACCAGTACTAGTG
rJMFF041C04- TTTTCACTCCAACAGCAGAGCAGGGTTGATCTCGGAGATCCACAACTACCAGTACTAGTG
rJMFF048H10- TTTTCACTCCAACAGCAGAGCAGGGTTGATCTCGGAGATCCACAACTACCAGTACTAGTG
JMFS129C06- TTTTCACTCCAACAGCAGAGCAGGGTTGATCTCGGAGATCCACAACTACCAGTACTAGTG
rJMFF046E15- TTTTCACTCCAACAGCAGAGCAGGGTTGATCTCGGAGATCCACAACTACCAGTACTAGTG
rJMFF038E23- TTTTCACTCCAACAGCAGAGCAGGGTTGATCTCGGAGATCCACAACTACCAGTACTAGTG
rJMFF014I09- TTTTCACTCCAACAGCAGAGCAGGGTTGATCTCGGAGATCCACAACTACCAGTACTAGTG
rJMFF007E07- TTTTCACTCCAACAGCAGAGCAGGGTTGATCTCGGAGATCCACAACTACCAGTACTAGTG
rJMFF038K02- TTTTCACTCCAACAGCAGAGCAGGGTTGATCTCGGAGATCCACAACTACCAGTACTAGTG
rJMFF022G08- TTTTCACTCCAACAGCAGAGCAGGGTTGATCTCGGAGATCCACAACTACCAGTACTAGTG
rJMFF002C05- TTTTCACTCCAACAGCAGAGCAGGGTTGATCTCGGAGATCCACAACTACCAGTACTAGTG
rJMFF033K01- TTTTCACTCCAACAGCAGAGCAGGGTTGATCTCGGAGATCCACAACTACCAGTACTAGTG
rJMFF018O13- TTTTCACTCCAACAGCAGAGCAGGGTTGATCTCGGAGATCCACAACTACCAGTACTAGTG
rJMFF024G10- TTTTCACTCCAACAGCAGAGCAGGGTTGATCTCGGAGATCCACAACTACCAGTACTAGTG
rJMFF036A04- TTTTCACTCCAACAGCAGAGCAGGGTTGATCTCGGAGATCCACAACTACCAGTACTAGTG
rJMFF015K19- TTTTCACTCCAACAGCAGAGCAGGGTTGATCTCGGAGATCCACAACTACCAGTACTAGTG
rJMFF044M03- TTTTCACTCCAACAGCAGAGCAGGGTTGATCTCGGAGATCCACAACTACCAGTACTAGTG
rJMFF049C08- TTTTCACTCCAACAGCAGAGCAGGGTTGATCTCGGAGATCCACAACTACCAGTACTAGTG
rJMFF045B18- TTTTCACTCCAACAGCAGAGCAGGGTTGATCTCGGAGATCCACAACTACCAGTACTAGTG
rJMFF037M04- TTTTCACTCCAACAGCAGAGCAGGGTTGATCTCGGAGATCCACAACTACCAGTACTAGTG
rJMSF037A19- TTTTCACTCCAACAGCAGAGCANGGTTGATCTCGGAGATCCACAACTACCNGTACTAGTG
JMFS085E05- TTTNCACTCCAACAGCAGAGCAGGGTTGATCTCGGAGATCCACAACTACCAGTACTAGTG
JMFS120A09+ TTTTCACTCCAACAGCAGAGCAGGGTTGATCTCGGAGATCCACAACTACCAGTACTAGTG
JMFN015O09+ TTTTCACTCCAACAGCAGAGCAGGGTTGATCTCGGAGATCCACAATTACCAGTACTAGTG
rJMFF050G14- TTTTCACTCCAACAGCAGAGCAGGGTTGATCTCGGAGATCCACAACTACCAGTACTAGTG
rJMFF001K20- TTTTCACTCCAACAGCAGAGCAGGGTTGATCTCGGAGATCCACAACTACCAGTACTAGTG
rJMFF034N15- TTTTCACTCCAACAGCAGAGCAGGGTTGATCTCGGAGATCCACAACTACCAGTACTAGTG
rJMFF047P12- TTTTCACTCCNACAGCAGAGCAGGGTTGATCTCGGAGATCCACAACTACCAGTACTAGTG
rJMFF007F17- TTTTCACTCCAACAGCAGAGCAGGGTTGATCTCGGAGATCCACAACTACCAGTACTAGTG
rJMFF035P13- TTTTCACTCCAACAGCAGAGCAGGGTTGATCTCGGAGATCCACAACTACCAGTACTAGTG
rJMFF020E21- TTTTCACTCCAACAGCAGAGCAGGGTTGATCTCGGAGATCCACAACTACCAGTACTAGTG
rJMFF012F14- TTTTCACTCCAACAGCAGAGCAGGGTTGATCTCGGAGATCCACAACTACCAGTACTAGTG
rJMFF004H09- TTTTCACTCCAACAGCAGAGCAGGGTTGATCTCGGAGATCCACAACTACCAGTACTAGTG
rJMFF032P21- TTTTCACTCCAACAGCAGAGCAGGGTTGATCTCGGAGATCCACAACTACCAGTACTAGTG
rJMFF023F22- TTTTCACTCCAACAGCAGAGCAGGGTTGATCTCGGAGATCCACAACTACCAGTACTAGTG
rJMFF005K17- TTTTCACTCCAACAGCAGAGCAGGGTTGATCTCGGAGATCCACAACTACCAGTACTAGTG
rJMSF019L05- TTTTCACTCCAACAGCAGAGCAGGGTTGATCTCGGAGATCCACAACTACCNGTACTAGTG
rJMFF034N04- TTTTCACTCCAACAGCAGAGCAGGGTTGATCTCGGAGATCCACAACTACCAGTACTAGTG
rJMFF001M19- TTTTCACTCCAACAGCAGAGCAGGGTTGATCTCGGAGATCCACAACTACCAGTACTAGTG
rJMFF001L19- TTTTCACTCCAACAGCAGAGCAGGGTTGATCTCGGAGATCCACAACTACCAGTACTAGTG
JMFN044I10+ TTTTCACTCCAACAGCAGAGCAGGGTTGATCTCGGAGATCCACAACTACCAGTACTAGTG
rJMFF050E04- TTTTCACTCCAACAGCAGAGCAGGGTTGATCTCGGAGATCCACAACTACCAGTACTAGTG
JMFN012C15+ TTTTCACTCCAACAGCAGAGCAGGGTTGATCTCGGAGATCCACAACTACCAGTACTAGTG
JMFN018E14+ TTTTCACTCCAACAGCAGAGCAGGGTTGATCTCGGAGATCCACAACTACCAGTACTAGTG
rJMFF013C19- TTTTCACTCCAACAGNAGAGNAGGGNTGATCTCGNAGATCCACNACTACCAGTACTAGTG
rJMFF001K14- TTTTCACTCCAACAGCAGAGCAGGGTTGATCTCGGAGATCCACAACTACCAGTACTAGTG
rJMFF028C05- TTTTCACTCCAACAGCAGAGCAGGGTTGATCTCGGAGATCCACAACTACCAGTACTAGTG
rJMFF008E17- TTTTCACTCCAACAGCAGAGCAGGGTTGATCTCGGAGATCCACAACTACCAGTACTAGTG
rJMFF028M07- TTTTCACTCCAACAGCAGAGCAGGGTTGATCTCGGAGATCCACAACTACCAGTACTAGTG
JMFN039M17+ TTTTCACTCCAACAGCAGAGCAGGGTTGATCTCGGAGATCCACAACTACCAGTACTAGTG
rJMFF039E24- TTTTCACTCCAACAGCAGAGCAGGGTTGATCTCGGAGATCCACAACTACCAGTACTAGTG
rJMSF045N14- TTCTCACTCCAACAGCAGAGCAGGGTTGATCTCGGAGATCCACAACTACCAGTACTAGTG
rJMFF023F17- TTTTCACTCCAACAGCAGAGCAGGGTTGATCTCGGAGATCCACAACTACCAGTACTAGTG
rJMSF024H19- TTTTCACTCCAACAGCAGAGCAGGGTTGATCTCGGAGATCCACAACTACCAGTACTAGTG
rJMFF040M15- TTTTCACTCCAACAGCAGAGCAGGGTTGATCTCGGAGATCCACAACTACCAGTACTAGTG
rJMFF024H12- TTTTCACTCCAACAGCAGAGCAGGGTTGATCTCGGAGATCCACAACTACCAGTACTAGTG
rJMFF038F03- TTTTCACTCCAACAGCAGAGCAGGGTTGATCTCGGAGATCCACAACTACCAGTACTAGTG
rJMSF024D02- TTTTCACTCCAACAGCAGAGCAGGGTTGATCTCGGAGATCCACAACTACCAGTACTAGTG
rJMSF035L10- TTTTCACTCCAACAGCAGAGCAGGGTTGATCTCGGAGATCCACAACTACCAGTACTAGTG
rJMFF016K04- TTTTCACTCCAACAGCAGAGCAGGGTTGATCTCGGAGATCCACAACTACCAGTACTAGTG
rJMSF036O04- TTTTCACTCCAACAGCAGAGCAGGGTTGATCTCGGAGATCCACAACTACCAGTACTAGTG
rJMFF024N03- TTTTCACTCCAACAGCAGAGCAGGGTTGATCTCGGAGATCCACAACTACCAGTACTAGTG
rJMFF002F07- TTTTCACTCCAACAGCAGAGCAGGGTTGATCTCGGAGATCCACAACTACCAGTACTAGTG
rJMFF019H23- TTTTCACTCCAACAGCAGAGCAGGGTTGATCTCGGAGATCCACAACTACCAGTACTAGTG
rJMFF020J13- TTTTCACTCCAACAGCAGAGCAGGGTTGATCTCGGAGATCCACAACTACCAGTACTAGTG
rJMFF022I03- TTTTCACTCCAACAGCAGAGCAGGGTTGATCTCGGAGATCCACAACTACCAGTACTAGTG
rJMFF014G05- TTTTCACTCCAACAGCAGAGCAGGGTTGATCTCGGAGATCCACAACTACCAGTACTAGTG
rJMSF032J09- TTTTCACTCCAACAGCAGAGCAGGGTTGATCTCGGAGATCCACAACTACCAGTACTAGTG
rJMSF032B24- TTTTCACTCCAACAGCAGAGCAGGGTTGATCTCGGAGATCCACAACTACCAGTACTAGTG
rJMSF008A16- TTTTCACTCCAACAGCAGAGCAGGGTTGATCTCGGAGATCCACAACTACCAGTACTAGTG
rJMSF050E12- TTTTCACTCCAACAGCAGAGCAGGGTTGATCTCGGAGATCCACAACTACCAGTACTAGTG
rJMSF017E19- TTTTCACTCCAACAGCAGAGCAGGGTTGATCTCGGAGATCCACAACTACCAGTACTAGTG
rJMSF050D12- TTTTCACTCCAACAGCAGAGCAGGGTTGATCTCGGAGATCCACANCTACCAGTACTAGTG
rJMFF008K11- TTTTCACTCCAACAGCAGAGCAGGGTTGATCTCGGAGATCCACAACTACCAGTACTAGTG
rJMSF045C12- TTTTCACTCCAACAGCAGAGCAGGGTTGATCTCGGAGATCCACAACTACCAGTACTAGTG
rJMFF020D24- TTTTCACTCCAACAGCAGAGCAGGGTTGATCTCGGAGATCCACAACTACCAGTACTAGTG
rJMFF040P16- TTTTCACTCCAACAGCAGAGCAGGGTTGATCTCGGAGATCCACAACTACCAGTACTAGTG
rJMFF003K21- TTTTCACTCCAACAGCAGAGCAGGGTTGATCTCGGAGATCCACAACTACCAGTACTAGTG
rJMFF018L18- TTTTCACTCCAACAGCAGAGCAGGGTTGATCTCGGAGATCCACAACTACCAGTACTAGTG
rJMFF012K01- TTTTCACTCCAACAGCAGAGTAGGGTTGATCTGGGAGATCCACAACTACCAGTACTAGTG
rJMSF015J07- TTTTCACTCCAACAGCAGAGCAGGGTTGATCTCGGAGATCCACAACTACCAGTACTAGTG
rJMFF038H05- TTTTCACTCCAACAGCAGAGCAGGGTTGATCTCGGAGATCCACAACTACCAGTACTAGTG
rJMFF031E15- TTTTCACTCCAACAGCAGAGCAGGGTTGATCTCGGAGATCCACAACTACCAGTACTAGTG
rJMFF013K04- TTTTCACTCCAACAGCAGAGCAGGGTTGATCTCGGAGATCCACAACTACCAGTACTAGTG
rJMFF033B02- TTTTCACTCCAACAGCAGAGCAGGGTTGATCTCGGAGATCCACAACTACCAGTACTAGTG
                      ____________________________________________________________
consensus TTTTCACTCCAACAGCAGAGCAGGGTTGATCTCGGAGATCCACAACTACCAGTACTAGTG
 
. : . : . : . : . : . :
rJMFF049C23- AAGCCACAGTACATAATTGAGCCTCCCTTGCCAAGGGCTTC-ATAGCTCCTTTCTCCACA
rJMFF041C04- AAGCCACAGTACATAATTGAGCCTCCCTTGCCAAGGGCTTC-ATAGCTCCTTTCTCCACA
rJMFF048H10- AAGCCACAGTACATAATTGAGCCTCCCTTGCCAAGGGCTTC-ATAGCTCCTTTCTCCACA
JMFS129C06- AAGCCACAGTACATAATTGAGCCTCCCTTGCCAAGGGCTTC-ATAGCTCCTTTCTCCACA
rJMFF046E15- AAGCCACAGTACATAATTGAGCCTCCCTTGCCAAGGGCTTC-ATAGCTCCTTTCTCCACA
rJMFF038E23- AAGCCACAGTACATAATTGAGCCTCCCTTGCCAAGGGCTTC-ATAGCTCCTTTCTCCACA
rJMFF014I09- AAGCCACAGTACATAATTGAGCCTCCCTTGCCAAGGGCTTC-ATAGCTCCTTTCTCCACA
rJMFF007E07- AAGCCACAGTACATAATTGAGCCTCCCTTGCCAAGGGCTTC-ATAGCTCCTTTCTCCACA
rJMFF038K02- AAGCCACAGTACATAATTGAGCCTCCCTTGCCAAGGGCTTC-ATAGCTCCTTTCTCCACA
rJMFF022G08- AAGCCACAGTACATAATTGAGCCTCCCTTGCCAAGGGCTTC-ATAGCTCCTTTCTCCACA
rJMFF002C05- AAGCCACAGTACATAATTGAGCCTCCCTTGCCAAGGGCTTC-ATAGCTCCTTTCTCCACA
rJMFF033K01- AAGCCACAGTACATAATTGAGCCTCCCTTGCCAAGGGCTTC-ATAGCTCCTTTCTCCACA
rJMFF018O13- AAGCCACAGTACATAATTGAGCCTCCCTTGCCAAGGGCTTC-ATAGCTCCTTTCTCCACA
rJMFF024G10- AAGCCACAGTACATAATTGAGCCTCCCTTGCCAAGGGCTTC-ATAGCTCCTTTCTCCACA
rJMFF036A04- AAGCCACAGTA-ATAATTGAGCCTCCCTTGCCAAGGGCTTC-ATAGCTCCTTTCTCCACA
rJMFF015K19- AAGCCACAGTACATAATTGAGCCTCCCTTGCCAAGGGCTTC-ATAGCTCCTTTCTCCACA
rJMFF044M03- AAGCCACAGTACATAATTGAGCCTCCCTTGCCAAGGGCTTC-ATAGCTCCTTTCTCCACA
rJMFF049C08- AAGCCACAGTACATAATTGAGCCTCCCTTGCCAAGGGCTTC-ATAGCTCCTTTCTCCACA
rJMFF045B18- AAGCCACAGTACATAATTGAGCCTCCCTTGCCAAGGGCTTC-ATAGCTCCTTTCTCCACA
rJMFF037M04- AAGCCACAGTACATAATTGAGCCTCCCTTGCCAAGGGCTTC-ATAGCTCCTTTCTCCACA
rJMSF037A19- AAGCCNCAGTACATANTTGAGCCTCCCTTGCCAAGGGCTTC-ATAGCTCCTTTCTCCACA
JMFS085E05- AAGCCACAGTACATAATTGAGCCTCCCTTGCCAAGGGCTTC-ATAGCTCCTTTCTCCACA
JMFS120A09+ AAGCCACAGTACATAATTGAGCCTCCCTTGCCAAGGGCTTC-ATAGCTCCTTTCTCCACA
JMFN015O09+ AAGCCACAGTACATAATTGAGCCTCCCTTGCCAAGGGCTTC-ATAGCTCCTTTCTCCACA
rJMFF050G14- AAGCCACAGTACATAATTGAGCCTCCCTTGCCAAGGGCTTC-ATAGCTCCTTTCTCCACA
rJMFF001K20- AAGCCACAGTACATAATTGAGCCTCCCTTGCCAAGGGCTTC-ATAGCTCCTTTCTCCACA
rJMFF034N15- AAGCCACAGTACATAATTGAGCCTCCCTTGCCAAGGGCTTC-ATAGCTCCTTTCTCCACA
rJMFF047P12- AAGCCACAGTACATAATTGAGCCTCCCTTGCCAAGGGCTTC-ATAGCTCCTTTCTCCACA
rJMFF007F17- AAGCCACAGTACATAATTGAGCCTCCCTTGCCAAGGGCTTC-ATAGCTCCTTTCTCCACA
rJMFF035P13- AAGCCACAGTACATAATTGAGCCTCCCTTGCCAAGGGCTTC-ATAGCTCCTTTCTCCACA
rJMFF020E21- AAGCCACAGTACATAATTGAGCCTCCCTTGCCAAGGGCTTC-ATAGCTCCTTTCTCCACA
rJMFF012F14- AAGCCACAGTACATAATTGAGCCTCCCTTGCCAAGGGCTTC-ATAGCTCCTTTCTCCACA
rJMFF004H09- AAGCCACAGTACATAATTGAGCCTCCCTTGCCAAGGGCTTC-ATAGCTCCTTTCTCCACA
rJMFF032P21- AAGCCACAGTACATAATTGAGCCTCCCTTGCCAAGGGCTTC-ATAGCTCCTTTCTCCACA
rJMFF023F22- AAGCCACAGTACATAATTGAGCCTCCCTTGCCAAGGGCTTC-ATAGCTCCTTTCTCCACA
rJMFF005K17- AAGCCACAGTACATAATTGAGCCTCCCTTGCCAAGGGCTTC-ATAGCTCCTTTCTCCACA
rJMSF019L05- AAGCCACAGTACATAATTGAGCCTCCCTTGCCNAGGGCTTC-ATAGCTCCTTTCTCCACA
rJMFF034N04- AAGCCACAGTACATAATTGAGCCTCCCTTGCCAAGGGCTTC-ATAGCTCCTTTCTCCACA
rJMFF001M19- AAGCCACAGTACATAATTGAGCCTCCCTTGCCAAGGGCTTC-ATAGCTCCTTTCTCCACA
rJMFF001L19- AAGCCACAGTACATAATTGAGCCTCCCTTGCCAAGGGCTTC-ATAGCTCCTTTCTCCACA
JMFN044I10+ AAGCCACAGTACATAATTGAGCCTCCCTTGCCAAGGGCTTC-ATAGCTCCTTTCTCCACA
rJMFF050E04- AAGCCACAGTACATAATTGAGCCTCCCTTGCCAAGGGCTTC-ATAGCTCCTTTCTCCACA
JMFN012C15+ AAGCCACAGTACATAATTGAGCCTCCCTTGCCAAGGGCTTC-ATAGCTCCTTTCTCCACA
JMFN018E14+ AAGCCACAGTACATAATTGAGCCTCCCTTGCCAAGGGCTTC-ATAGCTCCTTTCTCCACA
rJMFF013C19- AAGCCACAGTACATAATTGAGCCTCCCTTGCCNAGGGCTTC-ATAGCTCCTTTCTCCANA
rJMFF001K14- AAGCCACAGTACATAATTGAGCCTCCCTTGCCAAGGGCTTC-ATAGCTCCTTTCTCCACA
rJMFF028C05- AAGCCACAGTACATAATTGAGCCTCCCTTGCCAAGGGCTTC-ATAGCTCCTTTCTCCACA
rJMFF008E17- AAGCCACAGTACATAATTGAGCCTCCCTTGCCAAGGGCTTC-ATAGCTCCTTTCTCCACA
rJMFF028M07- AAGCCACAGTACATAATTGAGCCTCCCTTGCCAAGGGCTTC-ATAGCTCCTTTCTCCACA
JMFN039M17+ AAGCCACAGTACATAATTGAGCCTCCCTTGCCAAGGGCTTC-ATAGCTCCTTTCTCCACA
rJMFF039E24- AAGCCACAGTACATAATTGAGCCTCCCTTGCCAAGGGCTTC-ATAGCTCCTTTCTCCACA
rJMSF045N14- AAGCCACAGTACATAATTGAGCCTCCCTTGCCAAGGGCTTC-ATAGCTCCTTTCTCCACA
rJMFF023F17- AAGCCACAGTACATAATTGAGCCTCCCTTGCCAAGGGCTTC-ATAGCTCCTTTCTCCACA
rJMSF024H19- AAGCCACAGTACATAATTGAGCCTCCCTTGCCAAGGGCTTC-ATAGCTCCTTTCTCCACA
rJMFF040M15- AAGCCACAGTACATAATTGAGCCTCCCTTGCCAAGGGCTTC-ATAGCTCCTTTCTCCACA
rJMFF024H12- AAGCCACAGTACATAATTGAGCCTCCCTTGCCAAGGGCTTC-ATAGCTCCTTTCTCCACA
rJMFF038F03- AAGCCACAGTACATAATTGAGCCTCCCTTGCCAAGGGCTTC-ATAGCTCCTTTCTCCACA
rJMSF024D02- AAGCCACAGTACATAATTGAGCCTCCCTTGCCAAGGGCTTCAATAGCTCCTTTCTCCACA
rJMSF035L10- AAGCCACAGTACATAATTGAGCCTCCCTTGCCAAGGGCTTC-ATAGCTCCTTTCTCCACA
rJMFF016K04- AAGCCACAGTACATAATTGAGCCTCCCTTGCCAAGGGCTTC-ATAGCTCCTTTCTCCACA
rJMSF036O04- AAGCCACAGTACATAATTGAGCCTCCCTTGCCAAGGGCTTC-ATAGCTCCTTTCTCCACA
rJMFF024N03- AAGCTACAGTACATAATTGAGCCTCCCTTGCCAAGGGCTTC-ATAGCTCCTTTCTCCACA
rJMFF002F07- AAGCCACAGTACATAATTGAGCCTCCCTTGCCAAGGGCTTC-ATAGCTCCTTTCTCCACA
rJMFF019H23- AAGCCACAGTACATAATTGAGCCTCCCTTGCCAAGGGCTTC-ATAGCTCCTTTCTCCACA
rJMFF020J13- AAGCCACAGTACATAATTGAGCCTCCCTTGCCAAGGGCTTC-ATAGCTCCTTTCTCCACA
rJMFF022I03- AAGCCACAGTACATAATTGAGCCTCCCTTGCCAAGGGCTTC-ATAGCTCCTTTCTCCACA
rJMFF014G05- AAGCCACAGTACATAATTGAGCCTCCCTTGCCAAGGGCTTC-ATAGCTCCTTTCTCCACA
rJMSF032J09- AAGCCACAGTACATAATTGAGCCTCCCTTGCCAAGGGCTTC-ATAGCTCCTTTCTCCACA
rJMSF032B24- AAGCCACAGTACATAATTGAGCCTCCCTTGCCAAGGGCTTC-ATAGCTCCTTTCTCCACA
rJMSF008A16- AAGCCACAGTACATAATTGAGCCTCCCTTGCCAAGGGCTTC-ATAGCTCCTTTCTCCACA
rJMSF050E12- AAGCCACAGTACATAATTGAGCCTCCCTTGCCAAGGGCTTC-ATAGCTCCTTTCTCCACA
rJMSF017E19- AAGCCACAGTACATAATTGAGCCTCCCTTGCCAAGGGCTTC-ATAGCTCCTTTCTCCACA
rJMSF050D12- AAGCCACAGTACATAATTGAGCCTCCCTTGCCAAGGGCTTC-ATAGCTCCTTTCTCCACA
rJMFF008K11- AAGCCACAGTACATAATTGAGCCTCCCTTGCCAAGGGCTTC-ATAGCTCCTTTCTCCACA
rJMSF045C12- AAGCCACAGTACATAATTGAGCCTCCCTTGCCAAGGGCTTC-ATAGCTCCTTTCTCCACA
rJMFF020D24- AAGCCACAGTACATAATTGAGCCTCCCTTGCCAAGGGCTTC-ATAGCTCCTTTCTCCACA
rJMFF040P16- AAGCCACAGTACATAATTGAGCCTCCCTTGCCAAGGGCTTC-ATAGCTCCTTTCTCCACA
rJMFF003K21- AAGCCACAGTACATAATTGAGCCTCCCTTGCCAAGGGCTTC-ATAGCTCCTTTCTCCACA
rJMFF018L18- AAGCCACAGTACATAATTGAGCCTCCCTTGCCAAGGGCTTC-ATAGCTCCTTTCTCCACA
rJMFF012K01- AAGCCACAGTACATAATTGATCCTCCCTTGCCAAGGTCTTC-ATAGCTCATTTCTCCACA
rJMSF015J07- AAGCCACAGTACATAATTGAGCCTCCCTTGCCAAGGGCTTC-ATAGCTCCTTTCTCCACA
rJMFF038H05- AAGCCACAGTACATAATTGAGCCTCCCTTGCCAAGGGCTTC-ATAGCTCCTTTCTCCACA
rJMFF031E15- AAGCCACAGTACATAATTGAGCCTCCCTTGCCAAGGGCTTC-ATAGCTCCTTTCTCCACA
rJMFF013K04- AAGCCACAGTACATAATTGAGCCTCCCTTGCCAAGGGCTTC-ATAGCTCCTTTCTCCACA
rJMFF033B02- AAGCCACAGTACATAATTGAGCCTCCCTTGCCAAGGGCTTC-ATAGCTCCTTTCTCCACA
                      ____________________________________________________________
consensus AAGCCACAGTACATAATTGAGCCTCCCTTGCCAAGGGCTTC-ATAGCTCCTTTCTCCACA
 
. : . : . : . : . : . :
rJMFF049C23- GGCATATCCTTTCACATCAAGTTCGAACACAGAATCGAGCTTCTCTCCNATGGAGTCACA
rJMFF041C04- GGCATATCCTTTCACATCAAGTTCGAACACAGAATCGAGCTTCTCTCCAATGGAGTCACA
rJMFF048H10- GGCATATCCTTTCACATCAAGTTCGAACACAGAATCGAGCTTCTC
JMFS129C06- GGCATATCCTTTCACATCAAGTTCGAACACAGAATCGAGCTTCTCTCCAATGGAGTCACA
rJMFF046E15- GGCATATCCTTTCACATCAAGTTCGAACACAGAATCGAGCTTCTCTCCNATGGAGTCACA
rJMFF038E23- GGCATATCCTTTCACATCAAGTTCGAACACAGAATCGAGCTTCTCTCCAATGGAGTCACA
rJMFF014I09- GGCATATCCTTTCACATCAAGTTCGAACACAGAATCGAGCTTCTCTCCAATGGAGTCACA
rJMFF007E07- GGCATATCCTTTCACATCAAGTTCGAACACAGAATCGAGCTTCTCTCCAATGGAGTCACA
rJMFF038K02- GGCATATCCTTTCACATCAAGTTCGAACACAGAATCGAGCTTCTCTCCAATGGAGTCACA
rJMFF022G08- GGCATATCCTTTCACATCAAGTTCGAACACAGAATCGAGCTTCTCTCCNATGGAGTCACA
rJMFF002C05- GGCATATCCTTTCACATCAAGTTCGAACACAGAATCGAGCTTCTCTCCAATGGAGTCACA
rJMFF033K01- GGCATATCCTTTCACATCAAGTTCGAACACAGAATCGAGCTTCTCTCCAATGGAGTCACA
rJMFF018O13- GGCATATCCTTTCACATCAAGTTCGAACACAGAATCGAGCTTCTCTCCAATGGAGTCACA
rJMFF024G10- GGCATATCCTTTCACATCAAGTTCGAACACAGAATCGAGCTTCTCTCCAATGGAGTCACA
rJMFF036A04- GGCATATCCTTTCACATCAAGTTCGAACACAGAATCGAGCTTCTCTCCAATGGAGTCACA
rJMFF015K19- GGCATATCCTTTCACATCAAGTTCGAACACAGAATCGAGCTTCTCTCCAATGGAGTCACA
rJMFF044M03- GGCATATCCTTTCACATCAAGTTCGAACACAGAATCGAGCTTCTCTCCAATGGAGTCACA
rJMFF049C08- GGCATATCCTTTCACATCAAGTTCGAACACAGAATCGAGCTTCTCTCCAATGGAGTCACA
rJMFF045B18- GGCATATCCTTTCACATCAAGTTCGAACACAGAATCGAGCTTCTCTCCNATGGAGTCACA
rJMFF037M04- GGCATATCCTTTCACATCAAGTTCGAACACAGAATCGAGCTTCTCTCCAATGGAGTCACA
rJMSF037A19- GGCATATCCTTTCACATCAAGTTCGAACACAGAATCGAGCTTCTCTCNNATGGAGTCACA
JMFS085E05- GGCATATCCTTTCACATGAAGTTCGAACACAGAATCGAGCTTCTCTCCAATGGAGTCACA
JMFS120A09+ GGCATATCCTTTCACATCAAGTTCGAACACAGAATCGAGCTTCTCTCCAATGGAGTCACA
JMFN015O09+ GGCATATCCTTTCACATCAAGTTCGAACACAGAATCGAGCTTCTCTCCAATGGAGTCACA
rJMFF050G14- GGCATATCCTTTCACATCAAGTTCGAACACAGAATCGAGCTTCTCTCCAATGGAGTCACA
rJMFF001K20- GGCATATCCTTTCACATCAAGTTCGAACACAGAATCGAGCTTCTCTCCAATGGAGTCACA
rJMFF034N15- GGCATATCCTTTCACATCAAGTTCGAACACAGAATCGAGCTTCTCTCCAATGGAGTCACA
rJMFF047P12- GGCATATCCTTTCACATCAAGTTCGAACACAGAATCGAGCTTCTCTCCNATGGAGTCACA
rJMFF007F17- GGCATATCCTTTCACATCAAGTTCGAACACAGAATCGAGCTTCTCTCCAATGGAGTCACA
rJMFF035P13- GGCATATCCTTTCACATCAAGTTCGAACACAGAATCGAGCTTCTCTCCAATGGAGTCACA
rJMFF020E21- GGCATATCCTTTCACATCAAGTTCGAACACAGAATCGAGCTTCTCTCCAATGGAGTCACA
rJMFF012F14- GGCATATCCTTTCACATCAAGTTCGAACACAGAATCGAGCTTCTCTCCAATGGAGTCACA
rJMFF004H09- GGCATATCCTTTCACATCAAGTTCGAACACAGAATCGAGCTTCTCTCCAATGGAGTCACA
rJMFF032P21- GGCATATCCTTTCACATCAAGTTCGAACACAGAATCGAGCTTCTCTCCAATGGAGTCACA
rJMFF023F22- GGCATATCCTTTCACATCAAGTTCGAACACAGAATCGAGCTTCTCTCCAATGGAGTCACA
rJMFF005K17- GGCATATCCTTTCACATCAAGTTCGAACACAGAATCGAGCTTCTCTCCAATGGAGTCACA
rJMSF019L05- GGCATATCCTTTCACATCAAGTTCGAACACAGAATCGAGCTTCTCTCCAATGGAGTCACA
rJMFF034N04- GGCATATCCTTTCACATCAAGTTCGAACACAGAATCGAGCTTCTCTCCAATGGAGTCACA
rJMFF001M19- GGCATATCCTTTCACATCAAGTTCGAACACAGAATCGAGCTTCTCTCCAATGGAGTCACA
rJMFF001L19- GGCATATCCTTTCACATCAAGTTCGAACACAGAATCGAGCTTCTCTCCAATGGAGTCACA
JMFN044I10+ GGCATATCCTTTCACATCAAGTTCGAACACAGAATCGAGCTTCTCTCCAATGGAGTCACA
rJMFF050E04- GGCATATCCTTTCACATCAAGTTCGAACACAGAATCGAGCTTCTCTCCAATGGAGTCACA
JMFN012C15+ GGCATATCCTTTCACATCAAGTTCGAACACAGAATCGAGCTTCTCTCCAATGGAGTCACA
JMFN018E14+ GGCATATCCTTTCACATCAAGTTCGAACACAGAATCGAGCTTCTCTCCAATGGAGTCACA
rJMFF013C19- GGNATATCCTTTCNCATCAAGTTCGAACACAGAATCNAGCTTCTCTCCNATGGAGTCACN
rJMFF001K14- GGCATATCCTTTCACATCAAGTTCGAACACAGAATCGAGCTTCTCTCCAATGGAGTCACA
rJMFF028C05- GGCATATCCTTTCACATCAAGTTCGAACACAGAATCGAGCTTCTCTCCAATGGAGTCACA
rJMFF008E17- GGCATATCCTTTCACATCAAGTTCGAACACAGAATCGAGCTTCTCTCCAATGGAGTCACA
rJMFF028M07- GGCATATCCTCTCACATCAAGTTCGAACACAGAATCGAGCTTCTCTCCAATGGAGTCACA
JMFN039M17+ GGCATATCCTTTCACATCAAGTTCGA--ACAGAATCGAGCTTCTCTCCAATGGAGTCACA
rJMFF039E24- GGCATATCCTTTCACATCAAGTTCGAACACAGAATCGAGCTTCTCTCCAATGGAGTCACA
rJMSF045N14- GGCATATCCTTTCACATCAAGTTCGAACACAGAATCGAGCTTCTCTCCAATGGAGTCACA
rJMFF023F17- GGCATATCCTTTCACATCAAGTTCGAACACAGAATCGAGCTTCTCTCCAATGGAGTCACA
rJMSF024H19- GGCATATCCTTTCACATCAAGTTCGAACACAGAATCGAGCTTCTCTCCAATGGAGTCACA
rJMFF040M15- GGCATATCCTTTCACATAAAGTTCGAACACAGAATCGAGCTTCTCTCCAATGGAGTCACA
rJMFF024H12- GGCATATCCTTTCACATCAAGTTCGAACACAGAATCGAGCTTCTCTCCAATGGAGTCACA
rJMFF038F03- GGCATATCCTTTCACATCAAGTTCGAACACAGAATCGAGCTTCTCTCCAATGGAGTCACA
rJMSF024D02- GGCATATCCTTTCACATCAAGTTCGAACACAGAATCGAGCTTCTCTCCAATGGAGTCACA
rJMSF035L10- GGCATATCCTTTCACATCAAGTTCGAACACAGAATCGAGCTTCTCTCCAATGGAGTCACA
rJMFF016K04- GGCATATCCTTTCACATCAAGTTCGAACACAGAATCGAGCTTCTCTCCAATGGAGTCACA
rJMSF036O04- GGCATATCCTTTCACATCAAGTTCGAACACAGAATCGAGCTTCTCTCCAATGGAGTCACA
rJMFF024N03- GGCATATCCTTTCACATCAAGTTCGAACACAGAATCGAGCTTCTCTCCAATGGAGTCACA
rJMFF002F07- GGCATATCCTTTCACATCAAGTTCGAACACAGAATCGAGCTTCTCTCCAATGGAGTCACA
rJMFF019H23- GGCATATCCTTTCACATCAAGTTCGAACACAGAATCGAGCTTCTCTCCAATGGAGTCACA
rJMFF020J13- GGCATATCCTTTCACATCAAGTTCGAACACAGAATCGAGCTTCTCTCCAATGGAGTCACA
rJMFF022I03- GGCATATCCTTTCACATCAAGTTCGAACACAGAATCGAGCTTCTCTCCAATGGAGTCACA
rJMFF014G05- GGCATATCCTTTCACATCAAGTTCGAACACAGAATCGAGCTTCTCTCCAATGGAGTCACA
rJMSF032J09- GGCATATCCTTTCACATCAAGTTCGAACACAGAATCGAGCTTCTCTCCAATGGAGTCACA
rJMSF032B24- GGCATATCCTTTCACATCAAGTTCGAACACAGAATCGAGCTTCTCTCCAATGGAGTCACA
rJMSF008A16- GGCATATCCTTTCACATCAAGTTCGAACACAGAATCGAGCTTCTCTCCAATGGAGTCACA
rJMSF050E12- GGCATATCCTTTCACATCAAGTTCGAACACAGAATCGAGCTTCTCTCCAATGGAGTCACA
rJMSF017E19- GGCATATCCTTTCACATCAAGTTCGAACACAGAATCGAGCTTCTCTCCAATGGAGTCACA
rJMSF050D12- GGCATATCCTTTCACATCAAGTTCGAACACAGAATCGAGCTTCTCTCCNATGGAGTCACA
rJMFF008K11- GGCATATCCTTTCACATCAAGTTCGAACACAGAATCGAGCTTCTCTCCAATGGAGTCACA
rJMSF045C12- GGCATATCCTTCCACATCAAGTTCGAACACAGAATCGAGCTTCTCTCCAATGGAGTCACA
rJMFF020D24- GGCATATCCTTTCACATCAAGTTCGAACACAGAATCGAGCTTCTCTCCAATGGAGTCACA
rJMFF040P16- GGCATATCCTTTCACATCAAGTTCGAACACAGAATCGAGCTTCTCTCCAATGGAGTCACA
rJMFF003K21- GGCATATCCTTTCACATCAAGTTCGAACACAGAATCGAGCTTCTCTCCAATGGAGTCACA
rJMFF018L18- GGCATATCCTTTCACATCAAGTTCGAACACAGAATCGAGCTTCTCTCCAATGGAGTCACA
rJMFF012K01- GGCATATCCTTTCACATCGAGTTTGAACACAGAATCAAGCTTCTCTCCAATGGAGTCACA
rJMSF015J07- GGCATATCCTTTCACATCAAGTTCGAACACAGAATCGAGCTTCTCTCCAATGGAGTCACA
rJMFF038H05- GGCATATCCTTTCACATCAAGTTCGAACACAGAATCGAGCTTCTCTCCAATGGAGTCACA
rJMFF031E15- GGCATATCCTTTCACATCAAGTTCGAACACAGAATCGAGCTTCTCTCCAATGGAGTCACA
rJMFF013K04- GGCATATCCTTTCACATCAAGTTCGAACACAGAATCGAGCTTCTCTCCAATGGAGTCACA
rJMFF033B02- GGCATATCCTTTCACATCAAGTTCGAACACAGAATCGAGCTTCTCTCCAATGGAGTCACA
                      ____________________________________________________________
consensus GGCATATCCTTTCACATCAAGTTCGAACACAGAATCGAGCTTCTCTCCAATGGAGTCACA
 
. : . : . : . : . : . :
rJMFF049C23- GTGCAAAGCAACA
rJMFF041C04- G
JMFS129C06- GTGCAAAGCAACAGAGAATTCAGCAGGTTGGAAGCAGGACAACACTCTCTGGATAAGGGC
rJMFF046E15- GTGCAAAGCAACAGAGAATTCAGCAGGTTGGAAGCAGGACAACACTCTCTGGATAAGGGC
rJMFF038E23- GTGCAAAGCAACAGAGAATTCAGCAGGTTGGAAGCAGGACAACACTCTCTGGATAAGGGC
rJMFF014I09- GCGCAAAGCAACAGAGAATTCAGCAGGTTGGAAGCAGGACAACACTCTCTGGATAAGGGC
rJMFF007E07- GTGCAAAGCAACAGAGAATTCAGCAGGTTGGAAGCAGGACAACACTCTCTGGATAAGGGC
rJMFF038K02- GTGCAAAGCAACAGAGAATTCAGCAGGTTGGAAGCAGGACAACACTCTCTGGATAAGGGC
rJMFF022G08- GTGCAAAGCAACAGAGAATTCAGCAGGTTGGAAGCAGGACAACACTCTCTGGATAAGGGC
rJMFF002C05- GTGCAAAGCAACAGAGAATTCAGCAGGTTGGAAGCAGGACAACACTCTCTGGATAAGGGC
rJMFF033K01- GTGCAAAGCAACAGAGAATTCAGCAGGTTGGAAGCAGGACAACACTCTCTGGATAAGGGC
rJMFF018O13- GTGCAAAGCAACAGAGAATTCAGCAGGTTGGAAGCAGGACAACACTCTCTGGATAAGGGC
rJMFF024G10- GTGCAAAGCAACAGAGAATTCAGCAGGTTGGAAGCAGGACAACACTCTCTGGATAAGGGC
rJMFF036A04- GTGCAAAGCAACAGAGAATTCAGCAGGTTGGAAGCAGGACAACACTCTCTGGATAAGGGC
rJMFF015K19- GTGCAAAGCAACAGAGAATTCAGCAGGTTGGAAGCAGGACAACACTCTCTGGATAAGGGC
rJMFF044M03- GTGCAAAGCAACAGAGAATTCAGCAGGTTGGAAGCAGGACAACACTCTCTGGATAAGGGC
rJMFF049C08- GTGCAAAGCAACAGAGAATTCAGCAGGTTGGAAGCAGGACAACACTCTCTGGATAAGGGC
rJMFF045B18- GTGCAAAGCAACAGAGAATTCAGCAGGTTGGAAGCAGGACAACACTCTCTGGATAAGGGC
rJMFF037M04- GTGCAAAGCAACAGAGAATTCAGCAGGTTGGAAGCAGGACAACACTCTCTGGATAAGGGC
rJMSF037A19- GTGCAAAGCA
JMFS085E05- GTG
JMFS120A09+ GTGCAAAGCAACAGAGAATTCAGCAGGTTGGAAGCAGGACAACACTCTCTGGATAAGGGC
JMFN015O09+ GTGCAAAGCAACAGAGAATTCAGCAGGTTGGAAGCAGGACAACACTCTCTGGATAAGGGC
rJMFF050G14- GTGCAAAGCAACAGAGAATTCAGCAGGTTGGAAGCAGGACAACACTCTCTGGATAAGGGC
rJMFF001K20- GTGCAAAGCAACAGAGAATTCAGCAGGTTGGAAGCAGGACAACACTCTCTGGATAAGGGC
rJMFF034N15- GTGCAAAGCAACAGAGAATTCAGCAGGTTGGAAGCAGGACAACACTCTCTGGATAAGGGC
rJMFF047P12- GTGCANAGCAACAGAGAATTCAGCAGGTTGGAAGCAGGACAACACTCTCTGGATAAGGGC
rJMFF007F17- GTGCAAAGCAACAGAGAATTCAGCAGGTTGGAAGCAGGACAACACTCTCTGGATAAGGGC
rJMFF035P13- GTGCAAAGCAACAGAGAATTCAGCAGGTTGGAAGCAGGACAACACTCTCTGGATAAGGGC
rJMFF020E21- GTGCAAAGCAACAGAGAATTCAGCAGGTTGGAAGCAGGACAACACTCTCTGGATAAGGGC
rJMFF012F14- GTGCAAAGCAACAGAGAATTCAGCAGGTTGGAAGCAGGACAACACTCTCTGGATAAGGGC
rJMFF004H09- GTGCAAAGCAACAGAGAATTCAGCAGGTTGGAAGCAGGACAACACTCTCTGGATAAGGGC
rJMFF032P21- GTGCAAAGCAACAGAGAATTCAGCAGGTTGGAAGCAGGACAACACTCTCTGGATAAGCGC
rJMFF023F22- GTGCAAAGCAACAGAGAATTCAGCAGGTTGGAAGCAGGACAACACTCTCTGGATAAGGGC
rJMFF005K17- GTGCAAAGCAACAGAGAATTCAGCAGGTTGGAAGCAGGACAACACTCTCTGGATAAGGGC
rJMSF019L05- GTGCAAAGCAACAGAGAATTCAGCAGGTTGGAAGCAGGACAACACTCTCTGGATAAGGGC
rJMFF034N04- GTGCAAAGCAACAGAGAATTCAGCAGGTTGGAAGCAGGACAACACTCTCTGGATAAGGGC
rJMFF001M19- GTGCAAAGCAACAGAGAATTCAGCAGGTTGGAAGCAGGACAACACTCTCTGGATAAGGGC
rJMFF001L19- GTGCAAAGCAACAGAGAATTCAGCAGGTTGGAAGCAGGACAACACTCTCTGGATAAGGGC
JMFN044I10+ GTGCAAAGCAACAGAGAATTCAGCAGGTTGGAAGCAGGACAACACTCTCTGGATAAGGGC
rJMFF050E04- GTGCAAAGCAACAG
JMFN012C15+ GTGCAAAGCAACAGAGAATTCAGCAGGTTGGAAGCAGGACAACACTCTCTGGATAAGGGC
JMFN018E14+ GTGCAAAGCAACAGAGAATTCAGCAGGTTGGAAGCAGGACAACACTCTCTGGATAAGGGC
rJMFF013C19- GTGCAAAGCAACAGANAATTCAGCAGGTTGGAAGCAGGACAACNCTCTCTGGATNAGGGC
rJMFF001K14- GTGCAAAGCAACAGAGAATTCAGCAGGTTGGAAGCAGGACAACACTCTCTGGATAAGGGC
rJMFF028C05- GTGCAAAGCAACAGAGAATTCAGCAGGTTGGAAGCAGGACAACACTCTCTGGATAAGGGC
rJMFF008E17- GTGCAAAGCAACAGAGAATTCAGCAGGTTGGAAGCAGGACAACACTCTCTGGATAAGGGC
rJMFF028M07- GTGCAAAGCAACAGAGAATTCAGCAGGTTGGAAGCAGGACAACACTCTCTGGATAAGGGC
JMFN039M17+ GTGCAAAGCAACAGAGAATTCAGCAGGTTGGAAGCAGGACAACACTCTCTGGATAAGGGC
rJMFF039E24- GTGCAAAGCAACAGAGAATTCAGCAGGTTGGAAGCAGGACAACACTCTCTGGATAAGGGC
rJMSF045N14- GTGCAAAGCAACAGAGAATTCAGCAGGTTGGAAGCAGGACAACACTCTCTGGATAAGGGC
rJMFF023F17- GTGCAAAGCAACAGAGAATTCAGCAGGTTGGAAGCAGGACAACACTCTCTGGATAAGGGC
rJMSF024H19- GTGCAAAGCAACAGAGAATTCAGCAGGTTGGAAGCAGGACAACACTCTCTGGATAAGGGC
rJMFF040M15- GTGCAAAGCAACAGAGAATTCAGCAGGTTGGAAGCAGGACAACACTCTCTGGATAAGGGC
rJMFF024H12- GTGCAAAGCAACAGAGAATTCAGCAGGTTGGAAGCAGGACAACACTCTCTGGATAAGGGC
rJMFF038F03- GTGCAAAGCAACAGAGAATTCAGCAGGTTGGAAGCAGGACAACACTCTCTGGATAAGGGC
rJMSF024D02- GTGCAAAGCAACAGAGAATTCAGCAGGTTGGAAGCAGGACAACACTCTCTGGATAAGGGC
rJMSF035L10- GTGCAAAGCAACAGAGAATTCAGCAGGTTGGAAGCAGGACAACACTCTCTGGATAAGGGC
rJMFF016K04- GTGCAAAGCAACAGAGAATTCAGCAGGTTGGAAGCAGGACAACACTCTCTGGATAAGGGC
rJMSF036O04- GTGCAAAGCAACAGAGAATTCAGCAGGTTGGAAGCAGGACAACACTCTCTGGATAAGGGC
rJMFF024N03- GTGCAAAGCAACAGAGAATTCAGCAGGTTGGAAGCAGGACAACACTCTCTGGATAAGGGC
rJMFF002F07- GTGCAAAGCAACAGAGAATTCAGCAGGTTGGAAGCAGGACAACACTCTCTGGATAAGGGC
rJMFF019H23- GCGCAAAGCAACAGAGAATTCAGCAGGTTGGAAGCAGGACAACACTCTCTGGATAAGGGC
rJMFF020J13- GTGCAAAGCAACAGAGAATTCAGCAGGTTGGAAGCAGGACAACACTCTCTGGATAAGGGC
rJMFF022I03- GTGCAAAGCAACAGAGAATTCAGCAGGTTGGAAGCAGGACAACACTCTCTGGATAAGGGC
rJMFF014G05- GTGCAAAGCAACAGAGAATTCAGCAGGTTGGAAGCAGGACAACACTCTCTGGATAAGGGC
rJMSF032J09- GTGCAAAGCAACAGAGAATTCAGCAGGTTGGAAGCAGGACAACACTCTCTGGATAAGGGC
rJMSF032B24- GTGCAAAGCAACAGAGAATTCAGCAGGTTGGAAGCAGGACAACACTCTCTGGATAAGGGC
rJMSF008A16- GTGCAAAGCAACAGAGAATTCAGCAGGTTGGAAGCAGGACAACACTCTCTGGATAAGGGC
rJMSF050E12- GTGCAAAGCAACAGAGAATTCAGCAGGTTGGAAGCAGGACAACACTCTCTGGATAAGGGC
rJMSF017E19- GTGCAAAGCAACAGAGAATTCAGCAGGTTGGAAGCAGGACAACACTCTCTGGATAAGGGC
rJMSF050D12- GTGCAAAGCAACAGAGAATTCAGCAGGTTGGAAGCAGGACAACACTCTCTGGATAAGGGC
rJMFF008K11- GTGCAAAGCAACAGAGAATTCAGCAGGTTGGAAGCAGGACAACACTCTCTGGATAAGGGC
rJMSF045C12- GTGCAAAGCAACAGAGAATTCAGCAGGTTGGAAGCAGGACAACACTCTCTGGATAAGGGC
rJMFF020D24- GTGCAAAGCAACAGAGAATTCAGCAGGTTGGAAGCAGGACAACACTCTCTGGATAAGGGC
rJMFF040P16- GTGCAAAGCAACAGAGAATTCAGCAGGTTGGAAGCAGGACAACACTCTCTGGATAAGGGC
rJMFF003K21- GTGCAAAGCAACAGAGAATTCAGCAGGTTGGAAGCAGGACAACACTCTCTGGATAAGGGC
rJMFF018L18- GTGCAAAGCAACAGAGAATTCAGCAGGTTGGAAGCAGGACAACACTCTCTGGATAAGGGC
rJMFF012K01- GTGCAAAGCAACAGAGAATTCAGCAGGTTGGAAGCAGGACAACACTCTCTGGATAAGGGC
rJMSF015J07- GTGCAAAGCAACAGAGAATTCAGCAGGTTGGAAGCAGGACAACACTCTCTGGATAAGGGC
rJMFF038H05- GTGCAAAGCAACAGAGAATTCAGCAGGTTGGAAGCAGGACAACACTCTCTGGATAAGGGC
rJMFF031E15- GTGCAAAGCAACAGAGAATTCAGCAGGTTGGAAGCAGGACAACACTCTCTGGATAAGGGC
rJMFF013K04- GTGCAAAGCAACAGAGAATTCAGCAGGTTGGAAGCAGGACAACACTCTCTGGATAAGGGC
rJMFF033B02- GTGCAAAGCAACAGAGAATTCAGCAGGTTGGAAGCAGGACAACACTCTCTGGATAAGGGC
                      ____________________________________________________________
consensus GTGCAAAGCAACAGAGAATTCAGCAGGTTGGAAGCAGGACAACACTCTCTGGATAAGGGC
 
. : . : . : . : . : . :
JMFS129C06- ATCCAAGTTCACATCTTTGAAATCATAACCCATGGCTTCAAAACTTGCATAGCTGAAGCC
rJMFF046E15- ATCCAAGTTCACATCTTTGAAATCATAACCCATGGCTTCAAAACTTGCATAGCTGAAGCC
rJMFF038E23- ATCCAAGTTCACATCTTTGAAATCATAACCCATGGCTTCAAAACTTGCATAGCTGAAGCC
rJMFF014I09- ATCCAAGTTCACATCTTTGAAATCATAACCCATGGCTTCAAAACTTGCATAGCTGAAGCC
rJMFF007E07- ATCCAAGTTCACATCTTTGAAATCATAACCCATGGCTTCAAAACTTGCATAGCTGAAGCC
rJMFF038K02- ATCCAAGTTCACATCTTTGAAATCATAACCCATGGCTTCAAAACTTGCATAGCTGAAGCC
rJMFF022G08- ATCCAAGTTCACATCTTTGAAATCATAACCCATGGCTTCAAAACTTGCATAGCTGAAGCC
rJMFF002C05- ATCCAAGTTCACATCTTTGAAATCATAACCCATGGCTTCAAAACTTGCATAGCTGAAGCC
rJMFF033K01- ATCCAAGTTCACATCTTTGAAATCATAACCCATGGCTTCAAAACTTGCATAGCTGAAGCC
rJMFF018O13- ATCCAAGTTCACATCTTTGAAATCATAACCCATGGCTTCAAAACTTGCATAGCTGAAGCC
rJMFF024G10- ATCCAAGTTCACATCTTTGAAATCATAACCCATGGCTTCAAAACTTGCATAGCTGAAGCC
rJMFF036A04- ATCCAAGTTCACATCTTTGAAATCATAACCCATGGCTTCAAAACTTGCATAGCTGAAGCC
rJMFF015K19- ATCCAAGTTCACATCTTTGAAATCATAACCCATGGCTTCAAAACTTGCATAGCTGAAGCC
rJMFF044M03- ATCCAAGTTCACATCTTTGAAATCATAACCCATGGCTTCAAAACTTGCATAGCTGAAGCC
rJMFF049C08- ATCCAAGTTCACATCTTTGAAATCATAACCCATGGCTTCAAAACTTGCATAGCTGAAGCC
rJMFF045B18- ATCCAAGTTCACATCTTTGAAATCATAACCCATGGCTTCAAAACTTGCATAGCTGAAGCC
rJMFF037M04- ATCCAAGTTCACATCTTTGAAATCATAACCCATGGCTTCAAAACTTGCATAGCT
JMFS120A09+ ATCCAAGTTCACATCTTTGAAATCATAACCCATGGCTTCAAAACTTGCATAGCTGAAGCC
JMFN015O09+ ATCCAAGTTCACATCTTTGAAATCATAACCCATGGCTTCAAAACTTGCATAGCTGAAGCC
rJMFF050G14- ATCCAAGTTCACATCTTTGAAATCATAACCCATGGCTTCAAAACTTGCATAGCTGAAGCC
rJMFF001K20- ATCCAAGTTCACATCTTTGAAATCATAACCCATGGCTTCAAAACTTGCATAGCTGAAGCC
rJMFF034N15- ATCCAAGTTCACATCTTTGAAATCATAACCCATGGCTTCAAAACTTGCATAGCTGAAGCC
rJMFF047P12- ATCCNAGTTCACATCTTTGAAATCATAACCCATGGCTTCAAAACTTGCATAGCTGAAGCC
rJMFF007F17- ATCCAAGTTCACATCTTTGAAATCATAACCCATGGCTTCAAAACTTGCATAGCTGAAGCC
rJMFF035P13- ATCCAAGTTCACATCTTTGAAATCATAACCCATGGCTTCAAAACTTGCATAGCTGAAGCC
rJMFF020E21- ATCCAAGTTCACATCTTTGAAATCATAACCCATGGCTTCAAAACTTGCATAGCTGAAGCC
rJMFF012F14- ATCCAAGTTCACATCTTTGAAATCATAACCCATGGCTTCAAAACTTGCATAGCTGAAGCC
rJMFF004H09- ATCCAAGTTCACATCTTTGAAATCATAACCCATGGCTTCAAAACTTGCATAGCTGAAGCC
rJMFF032P21- ATCCAAGTTCACATCTTTGAAATCATAACCCATGGCTTCAAAACTTGCATAGCTGAAGCC
rJMFF023F22- ATCCAAGTTCACATCTTTGAAATCATAACCCATGGCTTCAAAACTTGCATAGCTGAAGCC
rJMFF005K17- ATCCAAGTTCACATCTTTGAAATCATAACCCATGGCTTCAAAACTTGCATAGCTGAAGCC
rJMSF019L05- ATCCAAGTTCACATCTTTGAAATCATAACCCATGGCTTCAAAACTTGCATAGCTGAAGCC
rJMFF034N04- ATCCAAGTTCACATCTTTGAAATCATAACCCATGGCTTCAAAACTTGCATAGCTGAAGCC
rJMFF001M19- ATCCAAGTTCACATCTTTGAAATCATAACCCATGGCTTCAAAACTTGCATAGCTGAAGCC
rJMFF001L19- ATCCAAGTTCACATCTTTGAAATCATAACCCATGGCTTCAAAACTTGCATAGCTGAAGCC
JMFN044I10+ ATCCAAGTTCACATCTTTGAAATCATAACCCATGGCTTCAAAACTTGCATAGCTGAAGCC
JMFN012C15+ ATCCAAGTTCACATCTTTGAAATCATAACCCATGGCTTCAAAACTTGCATAGCTGAAGCC
JMFN018E14+ ATCCAAGTTCACATCTTTGAAATCATAACCCATGGCTTCAAAACTTGCATAGCTGAAGCC
rJMFF013C19- ATCCAAGTTCACATCTTTGAAATCATAACCCATGGCTTCAAAACTTGCATAGCTGAAGNC
rJMFF001K14- ATCCAAGTTCACATCTTTGAAATCATAACCCATGGCTTCAAAACTTGCATAGCTGAAGCC
rJMFF028C05- ATCCAAGTTCACATCTTTGAAATCATAACCCATGGCTTCAAAACTTGCATAGCTGAAGCC
rJMFF008E17- ATCCAAGTTCACATCTTTGAAATCATAACCCATGGCTTCAAAACTTGCATAGCTGAAGCC
rJMFF028M07- ATCCAAGTTCACATCTTTGAAATCATAACCCATGGCTTCAAAACTTGCATAGCTGAAGCC
JMFN039M17+ ATCCAAGTTCACATCTTTGAAATCATAACCCATGGCTTCAAAACTTGCATAGCTGAAGCC
rJMFF039E24- ATCCAAGTTCACATCTTTGAAATCATAACCCATGGCTTCAAAACTTGCATAGCTGAAGCC
rJMSF045N14- ATCCAAGTTCACATCTTTGAAATCATAACCCATGGCTTCAAAACTTGCATAGCTGAAGCC
rJMFF023F17- ATCCAAGTTCACATCTTTGAAATCATAACCCATGGCTTCAAAACTTGCATAGCTGAAGCC
rJMSF024H19- ATCCAAGTTCACATCTTTGAAATCATAACCCATGGCTTCAAAACTTGCATAGCTGAAGCC
rJMFF040M15- ATCCAAGTTCACATCTTTGAAATCATAACCCATGGCTTCAAAACTTGCATAGCTGAAGCC
rJMFF024H12- ATCCAAGTTCACATCTTTGAAATCATAACCCATGGCTTCAAAACTTGCATAGCTGAAGCC
rJMFF038F03- ATCCAAGTTCACATCTTTGAAATCATAACCCATGGCTTCAAAACTTGCATAGCTGAAGCC
rJMSF024D02- ATCCAAGTTCACATCTTTGAAATCATAACCCATGGCTTCAAAACTTGCATAGCTGAAGCC
rJMSF035L10- ATCCAAGTTCACATCTTTGAAATCATAACCCATGGCTTCAAAACTTGCATAGCTGAAGCC
rJMFF016K04- ATCCAAGTTCACATCTTTGAAATCATAACCCATGGCTTCAAAACTTGCATAGCTGAAGCC
rJMSF036O04- ATCCAAGTTCACATCTTTGAAATCATAACCCATGGCTTCAAAACTTGCATAGCTGAAGCC
rJMFF024N03- ATCCAAGTTCACATCTTTGAAATCATAACCCATGGCTTCAAAACTTGCATAGCTGAAGCC
rJMFF002F07- ATCCAAGTTCACATCTTTGAAATCATAACCCATGGCTTCAAAACTTGCATAGCTGAAGCC
rJMFF019H23- ATCCAAGTTCACATCTTTGAAATCATAACCCATGGCTTCAAAACTTGCATAGCTGAAGCC
rJMFF020J13- ATCCAAGTTCACATCTTTGAAATCATAACCCATGGCTTCAAAACTTGCATAGCTGAAGCC
rJMFF022I03- ATCCAAGTTCACATCTTTGAAATCATAACCCATGGCTTCAAAACTTGCATAGCTGAAGCC
rJMFF014G05- ATCCAAGTTCACATCTTTGAAATCATAACCCATGGCTTCAAAACTTGCATAGCTGAAGCC
rJMSF032J09- ATCCAAGTTCACATCTTTGAAATCATAACCCATGGCTTCAAAACTTGCATAGCTGAAGCC
rJMSF032B24- ATCCAAGTTCACATCTTTGAAATCATAACCCATGGCTTCAAAACTTGCATAGCTGAAGCC
rJMSF008A16- ATCCAAGTTCACATCTTTGAAATCATAACCCATGGCTTCAAAACTTGCATAGCTGAAGCC
rJMSF050E12- ATCCAAGTTCACATCTTTGAAATCATAACCCATGGCTTCAAAACTTGCATAGCTGAAGCC
rJMSF017E19- ATCCAAGTTCACATCTTTGAAATCATAACCCATGGCTTCAAAACTTGCATAGCTGAAGCC
rJMSF050D12- ATCCAAGTTCACATCTTTGAAATCATAACCCATGGCTTCAAAACTTGCATAGCTGAAGCC
rJMFF008K11- ATCCAAGTTCACATCTTTGAAATCATAACCCATGGCTTCAAAACTTGCATAGCTGAAGCC
rJMSF045C12- ATCCAAGTTCACATCTTTGAAATCATAACCCATGGCTTCAAAACTTGCATAGCTGAAGCC
rJMFF020D24- ATCCAAGTTCACATCTTTGAAATCATAACCCATGGCTTCAAAACTTGCATAGCTGAAGCC
rJMFF040P16- ATCCAAGTTCACATCTTTGAAATCATAACCCATGGCTTCAAAACTTGCATAGCTGAAGCC
rJMFF003K21- ATCCAAGTTCACATCTTTGAAATCATAACCCATGGCTTCAAAACTTGCATAGCTGAAGCC
rJMFF018L18- ATCCAAGTTCACATCTTTGAAATCATAACCCATGGCTTCAAAACTTGCATAGCTGAAGCC
rJMFF012K01- ATCCAAGTTCACATCTTTGAAATCATAACCCATGGCTTCAAAACTTGCATAGCTGAAGCC
rJMSF015J07- ATCCAAGTTCACATCTTTGAAATCATAACCCATGGCTTCAAAACTTGCATAGCTGAAGCC
rJMFF038H05- ATCCAAGTTCACATCTTTGAAATCATAACCCATGGCTTCAAAACTTGCATAGCTGAAGCC
rJMFF031E15- ATCCAAGTTCACATCTTTGAAATCATAACCCATGGCTTCAAAACTTGCATAGCTGAAGCC
rJMFF013K04- ATCCAAGTTCACATCTTTGAAATCATAACCCATGGCTTCAAAACTTGCATAGCTGAAGCC
rJMFF033B02- ATCCAAGTTCACATCTTTGAAATCATAACCCATGGCTTCAAAACTTGCATAGCTGAAGCC
                      ____________________________________________________________
consensus ATCCAAGTTCACATCTTTGAAATCATAACCCATGGCTTCAAAACTTGCATAGCTGAAGCC
 
. : . : . : . : . : . :
JMFS129C06- ATCTTCTGGGGTCACATGAATTGTAGAAATTGTGCCACCCTCAACAGCATTCAT
rJMFF046E15- ATCTTCTGGGGTCACATGAATTGTAGAAATTGTGCCACCCCTCACAGCATTCATTG
rJMFF038E23- ATCTTCTGGGGTCACATGAATTGTAGAAATTGTGCCACCCTCAACAGCATTCATTGAGTA
rJMFF014I09- ATCTTCTGGGGTCACATGAATTGTAGAAATTGTGCCACCCTCAACAGCATTCATTGAGTA
rJMFF007E07- ATCTTCTGGGGTCACATGAATTGTAGAAATTGTGCCACCCTCAACAGCATTCATTGAGTA
rJMFF038K02- ATCTTCTGGGGTCACATGAATTGTAGAAATTGTGCCACCCTCAACAGCATTCATTGAGTA
rJMFF022G08- ATCTTCTGGGGTCACATGAATTGTAGAAATTGTGCCACCCTCAACAGCATTCATTGAGTA
rJMFF002C05- ATCTTCTGGGGTCACATGAATTGTAGAAATTGTGCCACCCTCAACAGCATTCATTGAGTA
rJMFF033K01- ATCTTCTGGGGTCACATGAATTGTAGAAATTGTGCCACCCTCAACAGCATTCATTGAGTA
rJMFF018O13- ATCTTCTGGGGTCACATGAATTGTAGAAATTGTGCCACCCTCAACAGCATTCATTGAGTA
rJMFF024G10- ATCTTCTGGGGTCACATGAATTGTAGAAATTGTGCCACCCTCAACAGCATTCATTGAGTA
rJMFF036A04- ATCTTCTGGGGTCACATGAATTGTAGAAATTGTGCCACCCTCAACAGCATTCATTGAGTA
rJMFF015K19- ATCTTCTGGGGTCACATGAATTGTAGAAATTGTGCCACCCTCAACAGCATTCATTGAGTA
rJMFF044M03- ATCTTCTGGGGTCACATGAATTGTAGAAATTGTGCCACCCTCAACAGCATTCATTGAGTA
rJMFF049C08- ATCTTCTGGGGTCACATGAATTGTAGAAATTGTGCCACCCTCAACAGCATTCATTGAGTA
rJMFF045B18- ATCTTCTGGGGTCACATGAATTGTAGAAATTGTGCCACCCTCAACAGCATTCATTGAGTA
JMFS120A09+ ATCTTCTGGGGTCACATGAATTGTAGAAATTGTGCCACCCTCAACAGCATTCATTGAGTA
JMFN015O09+ ATCTTCTGGGGTAACATGAATTGTAGAAATTGTGCCACCCTCAACAGCATTCATTGAGTA
rJMFF050G14- ATCTTCTGGGGTCACATGAATTGTAGAAATTGTGCCACCCCTCACAGCATTCATTGAGTA
rJMFF001K20- ATCTTCTGGGGTCACATGAATTGTAGAAATTGTGCCACCCTCAACAGCATTCATTGAGTA
rJMFF034N15- ATCTTCTGGGGTCACATGAATTGTAGAAATTGTGCCACCCTCAACAGCATTCATTGAGTA
rJMFF047P12- ATCTTCTGGGGTCACATGAATTGTAGAAATTGTGCCACCCTCAACAGCATTCATTGAGTA
rJMFF007F17- ATCTTCTGGGGTCACATGAATTGTAGAAATTGTGCCACCCTCAACAGCATTCATTGAGTA
rJMFF035P13- ATCTTCTGGGGTCACATGAATTGTAGAAATTGTGCCACCCTCAACAGCATTCATTGAGTA
rJMFF020E21- ATCTTCTGGGGTCACATGAATTGTAGAAATTGTGCCACCCTCAACAGCATTCATTGAGTA
rJMFF012F14- ATCTTCTGGGGTCACATGAATTGTAGAAATTGTGCCACCCTCAACAGCATTCATTGAGTA
rJMFF004H09- ATCTTCTGGGGTCACATGAATTGTAGAAATTGTGCCACCCTCAACAGCATTCATTGAGTA
rJMFF032P21- ATCTTCTGGGGTCACATGAATTGTAGAAATTGTGCCACCCTCAACAGCATTCATTGAGTA
rJMFF023F22- ATCTTCTGGGGTCACATGAATTGTAGAAATTGTGCCACCCTCAACAGCATTCATTGAGTA
rJMFF005K17- ATCTTCTGGGGTCACATGAATTGTAGAAATTGTGCCACCCTCAACAGCATTCATTGAGTA
rJMSF019L05- ATCTTCTGGGGTCACATGAATTGTAGAAATTGTGCCACCCTCAACAGCATTCATTGAGTA
rJMFF034N04- ATCTTCTGGGGTCACATGAATTGTAGAAATTGTGCCACCCTCAACAGCATTCATTGAGTA
rJMFF001M19- ATCTTCTGGGGTCACATGAATTGTAGAAATTGTGCCACCCTCAACAGCATTCATTGAGTA
rJMFF001L19- ATCTTCTGGGGTCACATGAATTGTAGAAATTGTGCCACCCTCAACAGCATTCATTGAGTA
JMFN044I10+ ATCTTCTGGGGTCACATGAATTGTAGAAATTGTGCCACCCTCAACAGCATTCATTAAGTA
JMFN012C15+ ATCTTCTGGGGTCACATGAATTGTAGAAATTGTGCCACCCTCAACAGCATTCATTGAGTA
JMFN018E14+ ATCTTCTGGGGTCACATGAATTGTAGAAATTGTGCCACCCTCAACAGCATTCATTGAGTA
rJMFF013C19- ATCTTCTGGGGTCACATGANTTGTAAAAATTGTGCCACCCTCAACAGCATTCNTTGAGTA
rJMFF001K14- ATCTTCTGGGGTCACATGAATTGTAGAAATTGTGCCACCCTCAACAGCATTCATTGAGTA
rJMFF028C05- ATCTTCTGGGGTCACATGAATTGTAGAAATTGTGCCACCCTCAACAGCATTCATTGAGTA
rJMFF008E17- ATCTTCTGGGGTCACATGAATTGTAGAAATTGTGCCACCCTCAACAGCATTCATTGAGTA
rJMFF028M07- ATCTTCTGGGGTCACATGAATTGTAGAAATTGTGCCACCCTCAACAGCATTCATTGAGTA
JMFN039M17+ ATCTTCTGGGGTCACATGAATTGTAGAAATTGTGCCACCCTCAACAGCATTCATTGAGTA
rJMFF039E24- ATCTTCTGGGGTCACATGAATTGTAGAAATTGTGCCACCCTCAACAGCATTCATTGAGTA
rJMSF045N14- ATCTTCTGGGGTCACATGAATTGTAGAAATTGTGCCACCCTCAACAGCATTCATTGAGTA
rJMFF023F17- ATCTTCTGGGGTCACATGAATTGTAGAAATTGTGCCACCCTCAACAGCATTCATTGAGTA
rJMSF024H19- ATCTTCTGGGGTCACATGAATTGTAGAAATTGTGCCACCCTCAACAGCATTCATTGAGTA
rJMFF040M15- ATCTTCTGGGGTCACATGAATTGTAGAAATTGTGCCACCCTCAACAGCATTCATTGAGTA
rJMFF024H12- ATCTTCTGGGGTCACATGAATTGTAGAAATTGTGCCACCCTCAACAGCATTCATTGAGTA
rJMFF038F03- ATCTTCTGGGGTCACATGAATTGTAGAAATTGTGCCACCCTCAACAGCATTCATTGAGTA
rJMSF024D02- ATCTTCTGGGGTCACATGAATTGTAGAAATTGTGCCACCCTCAACAGCATTCATTGAGTA
rJMSF035L10- ATCTTCTGGGGTCACATGAATTGTAGAAATTGTGCCACCCTCAACAGCATTCATTGAGTA
rJMFF016K04- ATCTTCTGGGGTCACATGAATTGTAGAAATTGTGCCACCCTCAACAGCATTCATTGAGTA
rJMSF036O04- ATCTTCTGGGGTCACATGAATTGTAGAAATTGTGCCACCCTCAACAGCATTCATTGAGTA
rJMFF024N03- ATCTTCTGGGGTCACATGAATTGTAGAAATTGTGCCACCCTCAACAGCATTCATTGAGTA
rJMFF002F07- ATCTTCTGGGGTCACATGAATTGTAGAAATTGTGCCACCCTCAACAGCATTCATTGAGTA
rJMFF019H23- ATCTTCTGGGGTCACATGAATTGTAGAAATTGTGCCACCCTCAACAGCATTCATTGAGTA
rJMFF020J13- ATCTTCTGGGGTCACATGAATTGTAGAAATTGTGCCACCCTCAACAGCATTCATTGAGTA
rJMFF022I03- ATCTTCTGGGGTCACATGAATTGTANAAATTGTGCCACCCTCAACAGCATTCATTGAGTA
rJMFF014G05- ATCTTCTGGGGTCACATGAATTGTAGAAATTGTGCCACCCTCAACAGCATTCATTGAGTA
rJMSF032J09- ATCTTCTGGGGTCACATGAATTGTAGAAATTGTGCCACCCTCAACAGCATTCATTGAGTA
rJMSF032B24- ATCTTCTGGGGTCACATGAATTGTAGAAATTGTGCCACCCTCAACAGCATTCATTGAGTA
rJMSF008A16- ATCTTCTGGGGTCACATGAATTGTAGAAATTGTGCCACCCTCAACAGCATTCATTGAGTA
rJMSF050E12- ATCTTCTGGGGTCACATGAATTGTAGAAATTGTGCCACCCTCAACAGCATTCATTGAGTA
rJMSF017E19- ATCTTCTGGGGTCACATGAATTGTAGAAATTGTGCCACCCTCAACAGCATTCATTGAGTA
rJMSF050D12- ATCTTCTGGGGTCACATGAATTGTAGAAATTGTGCCACCCTCAACAGCATTCATTGAGTA
rJMFF008K11- ATCTTCTGGGGTCACATGAATTGTAGAAATTGTGCCACCCTCAACAGCATTCATTGAGTA
rJMSF045C12- ATCTTCTGGGGTCACATGAATTGTAGAAATTGTGCCACCCTCAACAGCATTCATTGAGTA
rJMFF020D24- ATCTTCTGGGGTCACATGAATTGTAGAAATTGTGCCACCCTCAACAGCATTCATTGAGTA
rJMFF040P16- ATCTTCTGGGGTCACATGAATTGTAGAAATTGTGCCACCCTCAACAGCATTCATTGAGTA
rJMFF003K21- ATCTTCTGGGGTCACATGAATTGTAGAAATTGTGCCACCCTCAACAGCATTCATTGAGTA
rJMFF018L18- ATCTTCTGGGGTCACATGAATTGTAGAAATTGTGCCACCCTCAACAGCATTCATTGAGTA
rJMFF012K01- ATCCTCTGGGGTCACATGAATTGTAGAAATTGCGCCGCCCTCAACAGCATTCATTGAGTA
rJMSF015J07- ATCTTCTGGGGTCACATGAATTGTAGAAATTGTGCCACCCTCAACAGCATTCATTGAGTA
rJMFF038H05- ATCTTCTGGGGTCACATGAATTGTAGAAATTGTGCCACCCTCAACAGCATTCATTGAGTA
rJMFF031E15- ATCTTCTGGGGTCACATGAATTGTAGAAATTGTGCCACCCTCAACAGCATTCATTGAGTA
rJMFF013K04- ATCTTCTGGGGTCACATGAATTGTAGAAATTGTGCCACCCTCAACAGCATTCATTGAGTA
rJMFF033B02- ATCTTCTGGGGTCACATGAATTGTAGAAATTGTGCCACCCTCAACAGCATTCATTGAGTA
                      ____________________________________________________________
consensus ATCTTCTGGGGTCACATGAATTGTAGAAATTGTGCCACCCTCAACAGCATTCATTGAGTA
 
. : . : . : . : . : . :
rJMFF038E23- TCCACATGGTTCG-AAATCAAAATCACATATATCTGATCCAGGAAGAATTTT-CCTAAT-
rJMFF014I09- TCCACATGGTTCG-AAATCAAAATCACATATATCTGATCCAGGAAGAATTTT-CCTAAT-
rJMFF007E07- TCCACATGGTTCG-AAATCAAAATCACATATATCTGATCCAGGAAGAATTTT-CCTAAT-
rJMFF038K02- TCCACATGGTTCG-AAATCAAAATCACATATATCTGATCCAGGAAGAATTTT-CCTAAT-
rJMFF022G08- TCCACATGGTTCG-AAATCAAAATCACATATATCTGATCCAGGAAGAATTTT-CCTAAT-
rJMFF002C05- TCCACATGGTTCG-AAATCAAAATCACATATATCTGATCCAGGAAGAATTTT-CCTAAT-
rJMFF033K01- TCCACATGGTTCG-AAATCAAAATCACATATATCTGATCCAGGAAGAATTTT-CCTAAT-
rJMFF018O13- TCCACATGGTTCG-AAATCAAAATCACATATATCTGATCCAGGAAGAATTTT-CCTAAT-
rJMFF024G10- TCCACATGGTTCG-AAATCAAAATCACATATATCTGATCCANGAAGAATTTT-CCTAAT-
rJMFF036A04- TCCACATGGTTCG-AAATCAAAATCACATATATCTGATCCAGGAAGAATTTT-CCTAAT-
rJMFF015K19- TCCACATGGTTCG-AAATCAAAATCACATATATCTGATCCAGG
rJMFF044M03- TCCACATGGTTCG-AAATC
rJMFF049C08- TCCACATGATTTG-AAATCAAA
rJMFF045B18- TCCACATGGTTCG-AAATCAA
JMFS120A09+ TCCACATGGTTCG-AAATCAAAATCACATATATCTGA
JMFN015O09+ TCCACATGGTTCG-AAATCAAAATCACATATATCTGATCCAGGAAGAATTTT-C
rJMFF050G14- TCCACATGGTTC
rJMFF001K20- TCCACATGGTTCG-AAATCAAAATCACATATATCTGATCCAGGAAGAATTTT-CCTAAT-
rJMFF034N15- TCCACATGGTTCG-AAATCAAAATCACATATATCTGATCCAGGAAGAATTTTCCCTAATG
rJMFF047P12- TCCACATGGTTCG-AAATC
rJMFF007F17- TCCACATGGTTCG-AAATCAAAATCACATATATCTGATCCAGGAAGAATTTT-CCTAAT-
rJMFF035P13- TCCACATGGTTCG-AAATCAAAATCACATATATCTGATCCAGGAAGAATTTT-CCTAAT-
rJMFF020E21- TCCACATGGTTCG-AAATCAAAATCACATATATCTGATCCAGGAAGAATTTT-CCTAAT-
rJMFF012F14- TCCACATGGTTCG-AAATCAAAATCACATATATCTGATCCAGGAAGAATTTT-CCTAAT-
rJMFF004H09- TCCACATGGTTCG-AAATCAAAATCACATATATCTGATCCAGGAAGAATTTT-CCTAAT-
rJMFF032P21- TCCACATGGTTCG-AAATCAAAATCACATATATCTGATCCAGGAAGAATTTT-CCTAAT-
rJMFF023F22- TCCACATGGTTCG-AAATCAAAATCACATATATCTGATCCAGGAAGAATTTT-CCTAAT-
rJMFF005K17- TCCACATGGTTCG-AAATCAAAATCACATATATCTGATCCAGGAAGAATTTT-CCTAAT-
rJMSF019L05- TCCACATGGTTCG-AAATCAAAATCNCATATATCTGATCCAGGAAGAATTTT-CCTAAT-
rJMFF034N04- TCCACATGGTTCG-AAATCAAAATCACATATATCTGATCCAGGAAGAATTTT-CCTAAT-
rJMFF001M19- TCCACATGGTTCG-AAATCAAAATCACATATATCTGATCCAGGAAGAATTTT-CCTAAT-
rJMFF001L19- TCCACATGGTTCG-AAATCAAAATCACATATATCTGATCCAGGAAGAATTTT-CCTAAT-
JMFN044I10+ TCCA
JMFN012C15+ TCCACATGGTTCG-AAATCAAAATCACATATATCTGATCCAGGAAGAATTTT-CCTAAT-
JMFN018E14+ TCCACATGGTTCG-AAATCAAAATCACATATATCTGATCCAGGAAGAATTTT-CCTAAT-
rJMFF013C19- TCCACATGGTTCG-AAATCAAAATCACATATATCTGATC
rJMFF001K14- TCCACATGGTTCG-AAATCAAAATCACATATATCTGATCCAGGAAGAATTTT-CCTAAT-
rJMFF028C05- TCCACATGGTTCG-AAATCAAAATCACATATATCTGATCCAGGAAGAATTTT-CCTAAT-
rJMFF008E17- TCCACATGGTTCG-AAATCAAAATCACATATATCTGATCCAGGAAGAATTTT-CCTAAT-
rJMFF028M07- TCCACATGGTTCG-AAATCAAAATCACATATATCTGATCCAGGAAGAATTTT-CCTAAT-
JMFN039M17+ TCCACATGGTTCG-AAATCAAAATCACATATATCTGATCCAGGAAGAATTTT-CCTAAT-
rJMFF039E24- TCCACATGGTTCG-AAATCAAAATCACATATATCTGATCCAGGAAGAATTTT-CCTAAT-
rJMSF045N14- TCCACATGGTTCG-AAATCAAAATCACATATATCTGATCCAGGAAGAATTTT-CCTAAT-
rJMFF023F17- TCCACATGGTTCG-AAATCAAAATCACATATATCTGATCCAGGAAGAATTTT-CCTAAT-
rJMSF024H19- TCCACATGGTTCG-AAATCAAAATCACATATATCTGATCCAGGAAGAATTTT-CCTAAT-
rJMFF040M15- TCCACATGGTTCG-AAATCAAAATCACATATATCTGATCCAGGAAGAATTTT-CCTAAT-
rJMFF024H12- TCCACATGGTTCG-AAATCAAAATCACATATATCTGATCCAGGAAGAATTTT-CCTAAT-
rJMFF038F03- TCCACATGGTTCG-AAATCAAAATCACATATATCTGATCCAGGAAGAATTTT-CCTAAT-
rJMSF024D02- TCCACATGGTTCG-AAATCAAAATCACATATATCTGATCCAGGAAGAATTTT-CCTAAT-
rJMSF035L10- TCCACATGGTTCG-AAATCAAAATCACATATATCTGATCCAGGAAGAATTTT-CCTAAT-
rJMFF016K04- TCCACATGGTTCG-AAATCAAAATCACATATATCTGATCCAGGAAGAATTTT-CCTAAT-
rJMSF036O04- TCCACATGGTTCG-AAATCAAAATCACATATATCTGATCCAGGAAGAATTTT-CCTAAT-
rJMFF024N03- TCCACATGGTTCG-AAATCAAAATCACATATATCTGATCCAGGAAGAATTTT-CCTAAT-
rJMFF002F07- TCCACATGGTTCG-AAATCAAAATCACATATATCTGATCCAGGAAGAATTTT-CCTAAT-
rJMFF019H23- TCCACATGGTTCG-AAATCAAAATCACATATATCTGATCCAGGAAGAATTTT-CCTAAT-
rJMFF020J13- TCCACATGGTTCG-AAATCAAAATCACATATATCTGATCCAGGAAGAATTTT-CCTAAT-
rJMFF022I03- TCCACATGGTTCGAAAATCAAAATCACATATATCTGATCCAGGAAGAATTTT-CCTAAT-
rJMFF014G05- TCCACATGGTTCG-AAATCAAAATCACATATATCTGATCCAGGAAGAATTTT-CCTAAT-
rJMSF032J09- TCCACATGGTTCG-AAATCAAAATCACATATATCTGATCCAGGAAGAATTTT-CCTAAT-
rJMSF032B24- TCCACATGGTTCG-AAATCAAAATCACATATATCTGATCCAGGAAGAATTTT-CCTAAT-
rJMSF008A16- TCCACATGGTTCG-AAATCAAAATCACATATATCTGATCCAGGAAGAATTTT-CCTAAT-
rJMSF050E12- TCCACATGGTTCG-AAATCAAAATCACATATATCTGATCCAGGAAGAATTTT-CCTAAT-
rJMSF017E19- TCCACATGGTTCG-AAATCAAAATCACATATATCTGATCCAGGAAGAATTTT-CCTAAT-
rJMSF050D12- TCCACATGGTTCG-AAATCANAATCACATATATCTGATCCAGGAAGAATTTT-CCTAAT-
rJMFF008K11- TCCACATGGTTCG-AAATCAAAATCACATATATCTGATCCAGGAAGAATTTT-CCTAAT-
rJMSF045C12- TCCACATGGTTCG-AAATCAAAATCACATATATCTGATCCAGGAAGAATTTT-CCTAAT-
rJMFF020D24- TCCACATGGTTCG-AAATCAAAATCACATATATCTGATCCAGGAAGAATTTT-CCTAAT-
rJMFF040P16- TCCACATGGTTCG-AAATCAAAATCACATATATCTGATCCAGGAAGAATTTT-CCTAAT-
rJMFF003K21- TCCACATGGTTCG-AAATCAAAATCACATATATCTGATCCAGGAAGAATTTT-CCTAAT-
rJMFF018L18- TACACATGGTTCG-AAATCAAAATCACATATATCTGATCCAGGAAGAATTTT-CCTAAT-
rJMFF012K01- TCCGCATGGTTCG-AAATCAAAATCACATATCTCTGATCCAGGAAGAATTTT-GCTAAT-
rJMSF015J07- TCCACATGGTTCG-AAATCAAAATCACATATATCTGATCCAGGAAGAATTTT-CCTAAT-
rJMFF038H05- TCCACATGGTTCG-AAATCAAAATCACATATATCTGATCCAGGAAGAATTTT-TCTAAT-
rJMFF031E15- TCCACATGGTTCG-AAATCAAAATCACATATATCTGATCCAGGAAGAATTTT-CCTAAT-
rJMFF013K04- TCCACATGGTTCG-AAATCAAAATCACATATATCTGATCCAGGAAGAATTTT-CCTAAT-
rJMFF033B02- TCCACATGGTTCG-AAATCAAAATCACATATATCTGATCCAGGAAGAATTTT-CCTAAT-
                      ____________________________________________________________
consensus TCCACATGGTTCG-AAATCAAAATCACATATATCTGATCCAGGAAGAATTTT-CCTAAT-
 
. : . : . : . : . : . :
rJMFF038E23- GCCTGAAGCATCAGTCATCACAGCAGCAGAACTA
rJMFF014I09- GCCTGAAGCATCAGTCATCACAGCAGCAGAACTAGATTGTGTCTT-GAAAAACACAGATG
rJMFF007E07- GCCTGAAGCATCAGTCATCACAGCAGCAGAACTAGATTGTGTCTTGAAAAAACACAGATG
rJMFF038K02- GCCTGAAGCATCAGTCATCACAGCAGCAGAACTAGATTGTGTCTT-GAAAAACACAGATG
rJMFF022G08- GCCTGAAGCATCAGTCATCACAGCAGCAGAACTAGATTGTGTCTT-GAAAAACACAGATG
rJMFF002C05- GCCTGAAGCATCAGTCATCACAGCAGCAGAACTAGATTGTGTCTT-GAAAAACACAGATG
rJMFF033K01- GCCTGAAGCATCAGTCATCACAGCAGCAGAACTAGATTGTGTCTT-GAAAAACACAGATG
rJMFF018O13- GCCTGAAGCATCAGTCATCACAGCAGCAGAACTAGATTGTGTCTT-GAAAAACACAGATG
rJMFF024G10- GCCTGAAGCATCAGTCATCACAGCAGCAGAACTAGATTGTGTCTT-GAAAAACACAGATG
rJMFF036A04- GCCTGAAGCATCAGTCATCACAGCAGCAGAACTAGATTGTGTCTT-GAAAAACACAGATG
rJMFF001K20- GCCTGAAGCATCAGTCATCACAGCAGC
rJMFF034N15- GCCTGAAGCATCAGTCATCACAGCAGCAGAACTAGATTGTGTCTT-GAAAAACACAGATG
rJMFF007F17- GCCTGAAGCATCAGTCATCACAGCAGCAGAACTAGATTGTGTCTT-GAAAAACACAGATG
rJMFF035P13- GCCTGAAGCATCAGTCATCACAGCAGCAGAACTAGATTGTGTCTT-GAAAAACACAGATG
rJMFF020E21- GCCTGAAGCATCAGTCATCACAGCAGCAGAACTAGATTGTGTCTT-GAAAAACACAGATG
rJMFF012F14- GCCTGAAGCATCAGTCATCACAGCAGCAGAACTAGATTGTGTCTT-GAAAAACACAGATG
rJMFF004H09- GCCTGAAGCATCAGTCATCACAGCAGCAGAACTAGATTGTGNCTT-GAAAAACACAGATG
rJMFF032P21- GCCTGAAGCATCAGTCATCACAGCAGCAGAACTAGATTGTGTCTT-GAAAAACACAGATG
rJMFF023F22- GCCTGAAGCATCAGTCATCACAGCAGCAGAACTAGATTGTGTCTT-GAAAAACACAGATG
rJMFF005K17- GCCTGAAGCATCAGTCATCACAGCAGCAGAACTAGATTGTGTCTT-GAAAAACACAGATG
rJMSF019L05- GCCTGAAGCATCAGTCATCACAGCAGCAGAACTAGATTGTGTCTT-GAAAAACACAGATG
rJMFF034N04- GNCTGAAGCATCAGTCATCACAGCAGCAGAACTAGATTGTGTCTT-GAAAAAC
rJMFF001M19- GCCTGAAGCATCAGTCATCACAGCAGCAGAACTAG
rJMFF001L19- GCCTGAAGCATCAGTCATCACAGCAGCAGAACTAGATTGT
JMFN012C15+ GCCTGAAGCATCAGTCATCA
JMFN018E14+ GCCTGAAGCATCAGTCATCACAGCAGCAGAACTAGATTGTGTCTT-GAAAAACACAGATG
rJMFF001K14- GCCTGAAGCATCAGTCATCACAGCAGCAGAACTAGATTGTGTCTT-GAAAAACACAGATG
rJMFF028C05- GCCTGAAGCATCAGTCATCACAGCAGCAGAACTAGATTGTGTCTT-GAAAAACACAGATG
rJMFF008E17- GCCTGAAGCATCAGTCATCACAGCAGCAGAACTAGATTGTGTCTT-GAAAAACACAGATG
rJMFF028M07- GCCTGAAGCATCAGTCATCACAGCAGCAGAACTAGATTGTGTCTT-GAAAAACACAGATG
JMFN039M17+ GCCTGAAGCATCAGTCATCACAGCAGCAGAACTAG
rJMFF039E24- GCCTGAAGCATCAGTCATCACAGCAGCAGAACTAGATTGTGTCTT-GAAAAACACAGATG
rJMSF045N14- GCCTGAAGCATCAGTCATCACAGCAGCAGAACTAGATTGTGTCTTGGAAAAACACAGATG
rJMFF023F17- GCCTGAAGCATCAGTCATCACAGCAGCAGAACTAGATTGTGTCTT-GAAAAACACAGATG
rJMSF024H19- GCCTGAAGCATCAGTCATCACAGCAGCAGAACTAGATTGTGTCTT-GAAAAACACAGATG
rJMFF040M15- GCCTGAAGCATCAGTCATCACAGCAGCAGAACTAGATTGTGTCTT-GAAAAACACAGATG
rJMFF024H12- GCCTGAAGCATCAGTCATCACAGCAGCAGAACTAGATTGTGTCTT-GAAAAACACAGATG
rJMFF038F03- GCCTGAAGCATCAGTCATCACAGCAGCAGAACTAGATTGTGTCTT-GAAAAACACAGATG
rJMSF024D02- GCCTGAAGCATCAGTCATCACAGCAGCAGAACTAGATTGTGTCTT-GAAAAACACAGATG
rJMSF035L10- GCCTGAAGCATCAGTCATCACAGCAGCAGAACTAGATTGTGTCTT-GAAAAACACAGATG
rJMFF016K04- GCCTGAAGCATCAGTCATCACAGCAGCAGAACTAGATTGTGTCTT-GAAAAACACAGATG
rJMSF036O04- GCCTGAAGCATCAGTCATCACAGCAGCAGAACTAGATTGTGTCTT-GAAAAACACAGATG
rJMFF024N03- GCCTGAAGCATCAGTCATCACAGCAGCAGAACTAGATTGTGTCTT-GAAAAACACAGATG
rJMFF002F07- GCCTGAAGCATCAGTCATCACAGCAGCAGAACTAGATTGTGTCTT-GAAAAACACAGATG
rJMFF019H23- GCCTGAAGCATCAGTCATCACAGCAGCAGAACTAGATTGTGTCTT-GAAAAACACAGATG
rJMFF020J13- GCCTGAAGCATCAGTCATCACAGCAGCAGAACTAGATTGTGTCTT-GAAAAACACAGATG
rJMFF022I03- GCCTGAAGCATCAGTCATCACAGCAGCAGAACTAGATTGTGTCTT-GAAAAACACAGATG
rJMFF014G05- GCCTGAAGCATCAGTCATCACAGCAGCAGAACTAGATTGTGTCTT-GAAAAACACAGATG
rJMSF032J09- GCCTGAAGCATCAGTCATCACAGCAGCAGAACTAGATTGTGTCTT-GAAAAACACAGATG
rJMSF032B24- GCCTGAAGCATCAGTCATCACAGCAGCAGAACTAGATTGTGTCTT-GAAAAACACAGATG
rJMSF008A16- GCCTGAAGCATCAGTCATCACAGCAGCAGAACTAGATTGTGTCTT-GAAAAACACAGATG
rJMSF050E12- GCCTGAAGCATCAGTCATCACAGCAGCAGAACTAGATTGTGTCTT-GAAAAACACAGATG
rJMSF017E19- GCCTGAAGCATCAGTCATCACAGCAGCAGAACTAGATTGTGTCTT-GAAAAACACAGATG
rJMSF050D12- GNCTGAAGCATCAGTCATCACAGCAGCAGANCTAGATTGTGTCTT-GAAAAACACAGATG
rJMFF008K11- GCCTGAAGCATCAGTCATCACAGCAGCAGAACTAGATTGTGTCTT-GAAAAACACAGATG
rJMSF045C12- GCCTGAAGCATCAGTCATCACAGCAGCAGAACTAGATTGTGTCTT-GAAAAACACAGATG
rJMFF020D24- GCCTGAAGCATCAGTCATCACAGCAGCAGAACTAGATTGTGTCTT-GAAAAACACAGATG
rJMFF040P16- GCCTGAAGCATCAGTCATCACAGCAGCAGAACTAGATTGTGTCTT-GAAAAACACAGATG
rJMFF003K21- GCCTGAAGCATCAGTCATCACAGCAGCAGAACTAGATTGTGTCTT-GAAAAACACAGATG
rJMFF018L18- GCCTGAAGCATCAGTCATCACAGCAGCAGAACTAGAT--TGTCTT-GAAAAACACAGATG
rJMFF012K01- GCCAGAAGCATCAGTCATCACAGCAGCAGAACTAGATTGTGTCTT-GAAAAACACAGATG
rJMSF015J07- GCCTGAAGCATCAGTCATCACAGCAGCAGAACTAGATTGTGTCTT-GAAAAACACAGATG
rJMFF038H05- GCCTGAAGCATCAGTCATCACAGCAGCAGAACTAGATTGTGTCTT-GAAAAACACAGATG
rJMFF031E15- GCCTGAAGCATCAGTCATCACAGCAGCAGAACTAGATTGTGTCTT-GAAAAACACAGATG
rJMFF013K04- GCCTGAAGCATCAGTCATCACAGCAGCAGAACTAGATTGTGTCTT-GAAAAACACAGATG
rJMFF033B02- GCCTGAAGCATCAGTCATCACAGCAGCAGAACTAGATTGTGTCTT-GAAAAACACAGATG
                      ____________________________________________________________
consensus GCCTGAAGCATCAGTCATCACAGCAGCAGAACTAGATTGTGTCTT-GAAAAACACAGATG
 
. : . : . : . : . : . :
rJMFF014I09- CACTCTTCTTGTCCAAGCCAGTCATGCACATCTC
rJMFF007E07- CACTCTTCTTGTCCAAGCCAGTCATGCACATCTC
rJMFF038K02- CACTCTTCTTGTCCAAGCCAGTCATGCACATCTC
rJMFF022G08- CACTCTTCTTGT
rJMFF002C05- CACTCTTCTTGTCCAAGCCAGTCATGCACATCTC
rJMFF033K01- CACTCTTCTTGTCCAAGCCAGTCATGCACATCTCC
rJMFF018O13- CACTCTTCTTGTCCAAGCCAGTCATGCACATCTCC
rJMFF024G10- CACTCTTCTTGTCCAAGCCAGTCATGCACATCTCC
rJMFF036A04- CACTCTTCTTGTCCAAGCCAGTCATGCACATCTC
rJMFF034N15- CACTCTTCTTGTCCAAGCCAGTCATGCACATCTC
rJMFF007F17- CACTCTTCTTGTCCAAGCCAGTCATGCACATCTCC
rJMFF035P13- CACTCTTCTTGTCCAAGCCAGTCATGCACATCTCCA
rJMFF020E21- CACTCTTCTTGTCCNAGCCAGTCATGCACATCTCCA
rJMFF012F14- CACTCTTCTTGTCCAAGCCAGTCATGCACATCTCCA
rJMFF004H09- CACTCTTCTTGTCCAAGCCAGTCATGCACATCTCCAAG
rJMFF032P21- CACTCTTCTTGTCCAAGCCAGTCATGCACATCTCC
rJMFF023F22- CACTCTTCTTGTCCAAGCCAGTCATGCACATCTCC
rJMFF005K17- CACTCTTCTTGTCCAAGCCAGTCATGCACATCTCC
rJMSF019L05- CACTCTTCTTGTCCNAGNCAGTCATGCACA
JMFN018E14+ CACTCTTCTTG
rJMFF001K14- CACTCTTCTTGTCCAAGCCAGTCATGCACATCTCC
rJMFF028C05- CACTCTTCTTGTCCAAGCCAGTCATGCACATCTCCA
rJMFF008E17- CACTCTTCTTGTCCNAGNCAGTCATGCACATCTCC
rJMFF028M07- CACTCTTCTTGTCCAAGCCAGTCATGCACATCTCC
rJMFF039E24- CACTCTTCTTGTCCNAGCCAGTCATGCACATCTCCAAGGTATAGAT-GGGAAA
rJMSF045N14- CACTCTTCTTGTCCANGCCAGTCATGCACATCTCCNAGGTATAGAT-GGGAAATGTGTTT
rJMFF023F17- CACTCTTCTTGTCCAAGCCAGTCATGCACATCTCCAAGGTATAGAT-GGGAAATGTGTTT
rJMSF024H19- CACTCTTCTTGTCCAAGCCAGTCATGCACATCTCCAAGGTATAGAT-GGGAAATGTGTTT
rJMFF040M15- CACTCTTCTTGTCCAAGCCAGTCATGCACATCTCCNAGGTATAGAT-GGGAAATGTGTTT
rJMFF024H12- CACTCTTCTTGTCCAAGCCAGTCATGCACATCTCCAAGGTATAGAT-GGGAAATGTGTTT
rJMFF038F03- CACTCTTCTTGTCCAAGCCAGTCATGCACATCTCCAAGGTATAGAT-GGGAAATGTGTTT
rJMSF024D02- CACTCTTCTTGTCCAAGCCAGTCATGCACATCTCCAAGGTATAGAT-GGGAAATGTGTTT
rJMSF035L10- CACTCTTCTTGTCCAAGCCAGTCATGCACATCTCCAAGGTATAGAT-GGGAAATG
rJMFF016K04- CACTCTTCTTGTCCAAGCCAGTCATGCACATCTCCAAG
rJMSF036O04- CACTCTTCTTGTCCAAGCCAGTCATGCACATCTCCAAGG
rJMFF024N03- CACTCTTCTTGTCCAAGCCAGTCATGCACATCTCCAA
rJMFF002F07- CACTCTTCTTGTCCAAGCCAGTCATGCACATCTCCAA
rJMFF019H23- CACTCTTCTTGTCCAAGCCAGTCATGCACATCTCCAAGG
rJMFF020J13- CACTCTTCTTGTCCNAGCCAGTCATGCACATCTCCAAG
rJMFF022I03- CACTCTTCTTGTCCAAGCCAGTCATGCACATCTCCCAGGTATAGA
rJMFF014G05- CACTCTTCTTGTCCAAGCCAGTCATGCACATCTCCAAGGTATAGAT-GGGAAATGTGTTT
rJMSF032J09- CACTCTTCTTGTCCAAGCCAGTCATGCACATCTCCNAGGTATAGAT-GGGAAATGTGTTT
rJMSF032B24- CACTCTTCTTGTCCAAGCCAGTCATGCACATCTCC
rJMSF008A16- CACTCTTCTTGTCCAAGCCAGTCATGCACATCTCCAAGGTATAGAT-GGGAAATGTGTTT
rJMSF050E12- CACTCTTCTTGTCCAAGCCAGTCATGCACATCTCCAAGGTATAGAT-GGGAAATGTGTTT
rJMSF017E19- CACTCTTCTTGTCCAAGCCAGTCATGCACATCTCCAAGGTATAGAT-GGGAAATGTGTTT
rJMSF050D12- CACTCTTCTTGTCCAAGCCAGTCATGCACATCTCCCANGTATAGAT-GGNAAATGTGTTT
rJMFF008K11- CACTCTTCTTGTCCAAGCCAGTCATGCACATCTCCAAGGTATAGAT-GGGAAATGTGTTT
rJMSF045C12- CACTCTTCTTGTCCAAGCCAGTCATGCACATCTCCAAGGTATAGAT-GGGAAATGTGTTT
rJMFF020D24- CACTCTTCTTGTCCAAGCCAGTCATGCACATCTCCAAGGTATAGAT-GGGAAATGTGTTT
rJMFF040P16- CACTCTTCTTGTCCAAGCCAGTCATGCACATCTCCAAGGTATAGAT-GGGAAATGTGTTT
rJMFF003K21- CACTCTTCTTGTCCAAGCCAGTCATGCACATCTCCAAGGTATAGAT-GGGAAATGTGTTT
rJMFF018L18- CACTCTTCTTGTCCAAGCCAGTCATGCACATCTCCAAGGTATAGAT-GGGAAATGTGTTT
rJMFF012K01- CACTCTTCTTGTCCAAGCCAGTCATGCACATCTCCAAGGTATAGAT-GGGAAATGTGTTT
rJMSF015J07- CACTCTTCTTGTCCAAGCCAGTCATGCACATCTCCAAGGTATAGAT-GGGAAATGTGTTT
rJMFF038H05- CACTCTTCTTGTCCAAGCCAGTCATGCACATCTCCAAGGTATAGAT-GGGAAATGTGTTT
rJMFF031E15- CACTCTTCTTGTCCAAGCCAGTCATGCACATCTCCAAGGTATAGATGGGGAAATGTGTTT
rJMFF013K04- CACTCTTCTTGTCCAAGCCAGTCATGCACATCTCCAAGGTATAGAT-GGGAAATGTGTTT
rJMFF033B02- CACTCTTCTTGTCCAAGCCAGTCATGCACATCTCCAAGGTATAGAT-GGGAAATGTGTTT
JMFF008E17+ CCAAGCCAGTCATGCACATCTCCAAGGTATAGAT-GGGAAATGTGTTT
                      ____________________________________________________________
consensus CACTCTTCTTGTCCAAGCCAGTCATGCACATCTCCAAGGTATAGAT-GGGAAATGTGTTT
 
. : . : . : . : . : . :
rJMSF045N14- T
rJMFF023F17- TCTGCAGATT
rJMSF024H19- TCTGCAGATTCAGCAGATGCAGAGTAAACATG-CCATTGCTGCTG
rJMFF040M15- TCTGCAGATTCAGCAGATGCAGAGTAAACATG-CCATTGCTGCTG
rJMFF024H12- TCTGCAGATTCAGCAGATGCAGAGTA
rJMFF038F03- TCTGCAGATTC
rJMSF024D02- TCTGCAGATTCAGC
rJMFF014G05- TCTGCAGATTCAGCAGATGCAGAGTAAACATG-CCATTGCTGCTGNTTCCCAGCACCACC
rJMSF032J09- TCTGCAGATTCAGCAG
rJMSF008A16- TCTGCAGATTCAGCAGATGCAGAGTAAACATG-CCATTGCTGCTGTT
rJMSF050E12- TCTGCAGATTCAGCAGATGCAGAGTAAACATG-CCATTGCTGCTGTTT-CCAGCACCACC
rJMSF017E19- TCTGCAGATTCAGCAGATGCAGAGTAAACATG-CCATTGCTGCTGNTTCCNAGCACCACC
rJMSF050D12- TCTGCAGA
rJMFF008K11- TCTGCAGATTCAGCAGATGCAGAGTAAACATG-CCATTGCTGCTGNTTCCCAGCACCACC
rJMSF045C12- TCTGCAGATTCAGCAGATGCAGAGTAAACATG-CCATTGCTGCTGTTTCCCAGCACCACC
rJMFF020D24- TCTGCAGATTCAGCAGATGCAGAGTAAACATG-CCATTGCTGCTGTTTCCCAGCACCACC
rJMFF040P16- TCTGCAGATTCAGCAGATGCAGAGTAAACATG-CCATTGCTGCTGNTTCCCAGCACCACC
rJMFF003K21- TCTGCAGATTCAGCAGATGCAGAGTAAACATG-CCATTGCTGCTGTTTNCCAGCACCACC
rJMFF018L18- TCTGCAGATTCAGCAGATGCAGAGTAAACATG-CCATTGCTGCTGTTTCCCAGCACCACC
rJMFF012K01- TCTGCAGATTCAGCAGATGCAGAGTAAACATG-CCATTGCTGCTGTTTTCCAGCACCACC
rJMSF015J07- TCTGCAGATTCAGCAGATGCAGAGTAAACATG-CCATTGCTGCTGTTTCCCAGCACCCCC
rJMFF038H05- TCTGCAGATTCAGCAGATGCAGAGTAAACATG-CCATTGCTGCTGNTTCCCAGCACCACC
rJMFF031E15- TCTGCAGATTCAGCAGATGCAGAGTAAACATGCCCATTGCTGCTGTTTC
rJMFF013K04- TCTGCAGATTCAGCAGATGCAGAGTAAACATG-CCATTGCTGCTGTTTCCCAGCACCACC
rJMFF033B02- TCTGCAGATTCAGCAGATGCAGAGTAAACATG-CCATTGCTGCTGTTTCCCAGCACCACC
JMFF008E17+ TCTGCAGATTCAGCAGATGCAGAGTAAACATG-CCATTGCTGCTGTTTCCCAGCACCACC
                      ____________________________________________________________
consensus TCTGCAGATTCAGCAGATGCAGAGTAAACATG-CCATTGCTGCTGTTTCCCAGCACCACC
 
. : . : . : . : . : . :
rJMFF014G05- CATCACA
rJMSF050E12- CATCACATAG
rJMSF017E19- CATCACATAGGC
rJMFF008K11- CATCACATA
rJMSF045C12- CATCACATAG
rJMFF020D24- CATCACATAGGCTT
rJMFF040P16- CATCACATANGCTTTGCTA
rJMFF003K21- CATCACATANGCTTTGCTACCT
rJMFF018L18- CATCACATANGCTTTGCTACCTG
rJMFF012K01- CATCACATAGGCTTTGCTACCTGT
rJMSF015J07- CATCACATAGGCTTTGCTACCTGTG
rJMFF038H05- CATCACATAGGCTTTGCTAC
rJMFF013K04- CATCACATAGGCTTTGCTACCTGTG
rJMFF033B02- CATCACATAGGCTTTGCTACCTGTGCCGAGTTTACCAAAGTAACCGTCAAGAATGGCAAC
JMFF008E17+ CATCACATAGGCTTTGCTACCTGTGCCGAGTTTACCAAAGTAACCGTCAAGAATGGCAAC
                      ____________________________________________________________
consensus CATCACATAGGCTTTGCTACCTGTGCCGAGTTTACCAAAGTAACCGTCAAGAATGGCAAC
 
. : . : . : . : . : . :
rJMFF033B02- TCCTTC
JMFF008E17+ TTCTTCAGAGAAATTACGATGCGGATATGGCTGAACCTCAGGAAAGTTAAAACTCCCACG
                      ____________________________________________________________
consensus TTCTTCAGAGAAATTACGATGCGGATATGGCTGAACCTCAGGAAAGTTAAAACTCCCACG
 
. : . : . : . : . : . :
JMFF008E17+ AGTGTATTTCACAGATTTCACTTTGAGGCTGAGTCCATCCGCCAACTCTAGGATGGGAGG
                      ____________________________________________________________
consensus AGTGTATTTCACAGATTTCACTTTGAGGCTGAGTCCATCCGCCAACTCTAGGATGGGAGG
 
. : . : . : . : . : . :
JMFF008E17+ GATAGAGAGTAGGAGCTTTGTAGTGCCACAAGTTTTAATGATAATCTTGTATGGGTACAC
                      ____________________________________________________________
consensus GATAGAGAGTAGGAGCTTTGTAGTGCCACAAGTTTTAATGATAATCTTGTATGGGTACAC
 
. : . : . : . : . : . :
JMFF008E17+ AAAGAGGCTGGATTCAGAAAGAACATAGGAATCAACTTCATTATTTGATAATGATGAGAC
JMSF045N14+ AGAAAGAACATAGGAATCAACTTCATTATTTGATAATGATGAGAC
                      ____________________________________________________________
consensus AAAGAGGCTGGATTCAGAAAGAACATAGGAATCAACTTCATTATTTGATAATGATGAGAC
 
. : . : . : . : . : . :
JMFF008E17+ AATAGTGCACTCAGCTGGTTTAAGAACTTTGTCCAATTGCTCCTTAGAAAGAGCTCGGAG
JMFN043G12+ GAACTTTGTCCAATGNCTCCTTAGAAAGAGCTCGGAG
JMSF045C12+ TCAGCTGGTTTAAGAACTTTGTCCAATTGCTCCTTAGAAAGAGCTCGGAG
JMSF045N14+ AATAGTGCACTCAGCTGGTTTAAGAACTTTGTCCAATTGCTCCTTAGAAAGAGCTCGGAG
                      ____________________________________________________________
consensus AATAGTGCACTCAGCTGGTTTAAGAACTTTGTCCAATTGCTCCTTAGAAAGAGCTCGGAG
 
. : . : . : . : . : . :
JMFF008E17+ ACCCCGGCCTTCAGGGTCAGAAAATATTCCAGCCTCAAAGAATGAGATCTCAAGC
JMFN043G12+ ACCCCGGCCTTCAGGGTCAGAAAATATTCCAGCCTCAAAGAATGAGATCTCAAGCCTCTT
JMSF045C12+ ACCCCGGCCTTCAGGGTCAGAAAATATTCCAGCCTCAAAGAATGAGATCTCAAGCCTCTT
JMSF045N14+ ACCCCGGCCTTCAGGGTCAGAAAATATTCCAGCCTCAAAGAATGAGATCTCAAGCCTCTT
JMSF032J09+ TCAGAAAATATTCCAGCCTCAAAGAATGAGATCTCAAGCCTCTT
JMSF032B24+ TTCAGGGTCAGAAAATATTCCAGCCTCAAAGAATGAGATCTCAAGCCTCTT
JMSF035L10+ CCTCAAAGAATGAGATCTCAAGCCTCTT
JMSF024H19+ AATATTCCAGCCTCAAAGAATGAGATCTCAAGCCTCTT
JMSF050E12+ TCAAAGAATGAGATCTCAAGCCTCTT
JMSF024D02+ CTCAAAGAATGAGATCTCAAGCCTCTT
                      ____________________________________________________________
consensus ACCCCGGCCTTCAGGGTCAGAAAATATTCCAGCCTCAAAGAATGAGATCTCAAGCCTCTT
 
. : . : . : . : . : . :
JMFN043G12+ TTCATAGCCTTCAAATCCAATTGCAGAGGTTGACAAGGCCATCTTGACTTCAATCAAACA
JMSF045C12+ TTCATAGCCTTCAAATCCAATTGCAGAGGTTGACAAGGCCATCTTGACTTCAATCAAACA
JMSF045N14+ TTCATAGCCTTCAAATCCAATTGCAGAGGTTGACAAGGCCATCTTGACTTCAATCAAACA
JMSF032J09+ TTCATAGCCTTCAAATCCAATTGCAGAGGTTGACAAGGCCATCTTGACTTCAATCAAACA
JMSF032B24+ TTCATAGCCTTCAAATCCAATTGCAGAGGTTGACAAGGCCATCTTGACTTCAATCAAACA
JMSF035L10+ TTCATAGCCTTCAAATCCAATTGCAGAGGTTGACAAGGCCATCTTGACTTCAATCAAACA
JMSF024H19+ TTCATAGCCTTCAAATCCAATTGCAGAGGTTGACAAGGCCATCTTGACTTCAATCAAACA
JMSF050E12+ TTCATAGCCTTCAAATCCAATTGCAGAGGTTGACAAGGCCATCTTGACTTCAATCAAACA
JMFF037M04+ CCTTCAAATCCAATTGCAGAGGTTGACAAGGCCATCTTGACTTCAATCAAACA
JMFS051G03+ AGCCTTCAAATCCAATTGCAGAGGTTGACAAGGCCATCTTGACTTCAATCAAACA
JMFS098H01+ TCAAATCCAATTGCAGAGGTTGACAAGGCCATCTTGACTTCAATCAAACA
JMFS075H01+ GCCTTCAAATCCAATTGCAGAGGTTGACAAGGCCATCTTGACTTCAATCAAACA
JMFS076B03+ AGCCTTCAAATCCAATTGCAGAGGTTGACAAGGCCATCTTGACTTCAATCAAACA
JMFF041C04+ AGCCTTCAAATCCAATTGCAGAGGTTGACAAGGCCATCTTGACTTCAATCAAACA
JMFF016K04+ TGCAGAGGTTGACAAGGCCATCTTGACTTCAATCAAACA
JMFF007F17+ TGCAGAGGTTGACAAGGCCATCTTGACTTCAATCAAACA
JMFF044M03+ AGGCCATCTTGACTTCAATCAAACA
JMFF013K04+ TCTTGACTTCAATCAAACA
JMFF008K11+ ATTGCAGAGGTTGACAAGGCCATCTTGACTTCAATCAAACA
JMFF047P12+ CATAGCCTTCAAATCCAATGNCAGAGGTTGACAAGGCCATCTTGACTTCAATCAAACA
JMFF018L18+ CTTGACTTCAATCAAACA
JMFF038H05+ CTTGACTTCAATCAAACA
JMFF020E21+ CTTGACTTCAATCAAACA
JMFF034N04+ ACTTCAATCAAACA
JMFF032P21+ CTTCAATCAAACA
JMFF028C05+ AAACA
JMFS002C05+ CA
JMFF001K14+ TCAATCAAACA
JMFF036A04+ ACTTCAATCAAACA
JMFF031E15+ AACA
JMFF014G05+ A
JMFF028M07+ AAACA
JMFF002F07+ CTTGACTTCAATCAAACA
JMFF015K19+ ATCAAACA
JMFF019H23+ AACA
JMSF024D02+ TTCATAGCCTTCAAATCCAATTGCAGAGGTTGACAAGGCCATCTTGACTTCAATCAAACA
JMFF007E07+ TGACTTCAATCAAACA
JMFF049C08+ GGCCATCTTGACTTCAATCAAACA
JMSF019L05+ AAACA
JMFF045B18+ TCAATCAAACA
JMFF046E15+ TTCAATCAAACA
JMFF050G14+ AATCCAATTGCAGAGGTGACAAAGGCCATCTTGACTTCAATCAAACA
                      ____________________________________________________________
consensus TTCATAGCCTTCAAATCCAATTGCAGAGGTTGACAAGGCCATCTTGACTTCAATCAAACA
 
. : . : . : . : . : . :
JMFN043G12+ CAGAGATGTTTGTGTTGCTCCAAAAGAGAGGTTTTTGTTGTTTCAAAAGAGAAAATGCTT
JMSF045C12+ CAGAGATGTTTGTGTTGCTCCAAAAGAGAGGTTTTTGTTGTTTCAAAAGAGAAAATGCTT
JMSF045N14+ CAGAGATGTTTGTGTTGCTCCAAAAGAGAGGTTTTTGTTGTTTCAAAAGAGAAAATGCTT
JMSF032J09+ CAGAGATGTTTGTGTTGCTCCAAAAGAGAGGTTTTTGTTGTTTCAAAAGAGAAAATGCTT
JMSF032B24+ CAGAGATGTTTGTGTTGCTCCAAAAGAGAGGTTTTTGTTGTTTCAAAAGAGAAAATGCTT
JMSF035L10+ CAGAGATGTTTGTGTTGCTCCAAAAGAGAGGTTTTTGTTGTTTCAAAAGAGAAAATGCTT
JMSF024H19+ CAGAGATGTTTGTGTTGCTCCAAAAGAGAGGTTTTTGTTGTTTCAAAAGAGAAAATGCTT
JMSF050E12+ CAGAGATGTTTGTGTTGCTCCAAAAGAGAGGTTTTTGTTGTTTCAAAAGAGAAAATGCTT
JMFF037M04+ CAGAGATGTTTGTGTTGCTCCAAAAGAGAGGTTTTTGTTGTTTCAAAAGAGAAAATGCTT
JMFS051G03+ CAGAGATGTTTGTGTTGCTCCAAAAGAGAGGTTTTTGTTGTTTCAAAAGAGAAAATGCTT
JMFS098H01+ CAGAGATGTTTGTGTTGCTCCAAAAGAGAGGTTTTTGTTGTTTCAAAAGAGAAAATGCTT
JMFS075H01+ CAGAGATGTTTGTGTTGCTCCAAAAGAGAGGTTTTTGTTGTTTCAAAAGAGAAAATGCTT
JMFS076B03+ CAGAGATGTTTGTGTTGCTCCAAAAGAGAGGTTTTTGTTGTTTCAAAAGAGAAAATGCTT
JMFF041C04+ CAGAGATGTTTGTGTTGCTCCAAAAGAGAGGTTTTTGTTGTTTCAAAAGAGAAAATGCTT
JMFF016K04+ CAGAGATGTTTGTGTTGCTCCAAAAGAGAGGTTTTTGTTGTTTCAAAAGAGAAAATGCTT
JMFF038E23+ AAGAGAAAATGCTT
JMFF007F17+ CAGAGATGTTTGTGTTGCTCCAAAAGAGAGGTTTTTGTTGTTTCAAAAGAGAAAATGCTT
JMFF044M03+ CAGAGATGTTTGTGTGCTNCCAAAAGAGAGGTTTTTGTTGTTTCAAAAGAGAAAATGCTT
JMFF013K04+ CAGAGATGTTTGTGTTGCTCCAAAAGAGAGGTTTTTGTTGTTTCAAAAGAGAAAATGCTT
JMFF008K11+ CAGAGATGTTTGTGTTGCTCCAAAAGAGAGGTTTTTGTTGTTTCAAAAGAGAAAATGCTT
JMFF047P12+ CAGAGATGTNTGTGTTGCTCCAAAAGAGAGGTTTTTGTTGTTTCAAAAGAGAAAATGCTT
JMFF018L18+ CAGAGATGTTTGTGTTGCTCCAAAAGAGAGGTTTTTGTTGTTTCAAAAGAGAAAATGCTT
JMFF038H05+ CAGAGATGTTTGTGTTGCTCCAAAAGAGAGGTTTTTGTTGTTTCAAAAGAGAAAATGCTT
JMFF020E21+ CAGAGATGTTTGTGTTGCTCCAAAAGAGAGGTTTTTGTTGTTTCAAAAGAGAAAATGCTT
JMFF034N04+ CAGAGATGTTTGTGTTGCTCCAAAAGAGAGGTTTTTGTTGTTTCAAAAGAGAAAATGCTT
JMFF032P21+ CAGAGATGTTTGTGTTGCTCCAAAAGAGAGGTTTTTGTTGTTTCAAAAGAGAAAATGCTT
JMFF028C05+ CAGAGATGTTTGTGTTGCTCCAAAAGAGAGGTTTTTGTTGTTTCAAAAGAGAAAATGCTT
JMFS002C05+ CAGAGATGTTTGTGTTGCTCCAAAAGAGAGGTTTTTGTTGTTTCAAAAGAGAAAATGCTG
JMFF001K14+ CAGAGATGTTTGTGTTGCTCCAAAAGAGAGGTTTTTGTTGTTTCAAAAGAGAAAATGCTT
JMFF036A04+ CAGAGATGTTTGTGTTGCTCCAAAAGAGAGGTTTTTGTTGTTTCAAAAGAGAAAATGCTT
JMFF031E15+ CAGAGATGTTTGTGTTGCTCCAAAAGAGAGGTTTTTGTTGTTTCAAAAGAGAAAATGCTT
JMFF014G05+ CAGAGATGTTTGTGTTGCTCCAAAAGAGAGGTTTTTGTTGTTTCAAAAGAGAAAATGCTT
JMFF028M07+ CAGAGATGTTTGTGTTGCTCCAAAAGAGAGGTTTTTGTTGTTTCAAAAGAGAAAATGCTT
JMFF033K01+ TCAAAAGAGAAAATGCTT
JMFF004H09+ GTTTCAAAAGAGAAAATGCTT
JMFF002F07+ CAGAGATGTTTGTGTTGCTCCAAAAGAGAGGTTTTTGTTGTTTCAAAAGAGAAAATGCTT
JMFF015K19+ CAGAGANGTTTGTGTTGCTCCAAAAGAGAGGTTTTTGTTGTTTCAAAAGAGAAAATGCTT
JMFF019H23+ CAGAGATGTTTGTGTTGCTCCAAAAGAGAGGTTTTTGTTGTTTCAAAAGAGAAAATGCTT
JMFF018O13+ TTCAAAAGAGAAAATGCTT
JMFF012F14+ AAAAGAGAAAATGCTT
JMFF001M19+ AAAATGCTT
JMFF002C05+ TTCAAAAGAGAAAATGCTT
JMFF035P13+ TTCAAAAGAGAAAATGCTT
JMSF024D02+ CAGAGATGTTTGTGTTGCTCCAAAAGAGAGGTTTTTGTTGTTTCAAAAGAGAAAATGCTT
JMFF023F17+ TGTTTCAAAAGAGAAAATGCTT
JMFF007E07+ CAGAGATGTTTGTGTTGCTCCAAAAGAGAGGTTTTTGTTGTTTCAAAAGAGAAAATGCTT
JMFF049C08+ CAGAGATGTTTGTGTTGCTCCAAAAGAGAGGTTTTTGTTGTTTCAAAAGAGAAAATGCTT
JMSF019L05+ CAGAGATGTTTGTGNTGCTCCAAAAGAGAGGTTTTTGTTGTTTCAAAAGAGAAAATGCTT
JMFF045B18+ CAGAGATGTNTGTGTTGCTCCAAAAGAGAGGTTTTGNTTGTTTCAAAAGAGAAAATGCTT
JMFF020J13+ CAGAGATGTTTGTGTTGCTCCAAAAGAGAGGTTTTTGTTGTTTCAAAAGAGAAAATGCTT
JMFF046E15+ CAGAGATGTNTGTGTTGCTCCAAAAGAGAGGTTTTGTGTNNTTCAAAAGAGAAAATGCTT
JMFF050G14+ CAGAGATGTTTGTGTGNCTCC-AAAGAGAGGTTTTTGTTGTTTCAAAAGAGAAAATGCTT
JMFF039E24+ CAGAGATGTTTGTGTTGCTCCAAAAGAGAGGTTTTTGTTGTTTCAAAAGAGAAAATGCTT
JMFF033B02+ TTCAAAAGAGAAAATGCTT
JMFF024N03+ TTTCAAAAGAGAAAATGCTT
JMFF020D24+ GCTCCAAAAGAGAGGTTTTTGTTGTTTCAAAAGAGAAAATGCTT
JMFF023F22+ CAAAAGAGAAAATGCTT
JMFF050E04+ AAAAGAGAAAATGCTT
JMFF005K17+ TCAAAAGAGAAAATGCTT
                      ____________________________________________________________
consensus CAGAGATGTTTGTGTTGCTCCAAAAGAGAGGTTTTTGTTGTTTCAAAAGAGAAAATGCTT
 
. : . : . : . : . : . :
JMFN043G12+ GCTGTTTTAAATTAGAG-AATAGCGAGGACGAGTGAAGAAGGAAAGTATGAAAGAGCAGA
JMSF045C12+ GCTGTTTTAAATTAGAG-AATAGCGAGGACGAGTGAAGAAGGAAAGTATGAAAGAGCAGA
JMSF045N14+ GCTGTTTTAAATTAGAG-AATAGCGAGGACGAGTGAAGAAGGAAAGTATGAAAGAGCAGA
JMSF032J09+ GCTGTTTTAAATTAGAG-AATAGCGAGGACGAGTGAAGAAGGAAAGTATGAAAGAGCAGA
JMSF032B24+ GCTGTTTTAAATTAGAG-AATAGCGAGGACGAGTGAAGAAGGAAAGTATGAAAGAGCAGA
JMSF035L10+ GCTGTTTTAAATTAGAG-AATAGCGAGGACGAGTGAAGAAGGAAAGTATGAAAGAGCAGA
JMSF024H19+ GCTGTTTTAAATTAGAG-AATAGCGAGGACGAGTGAAGAAGGAAAGTATGAAAGAGCAGA
JMSF050E12+ GCTGTTTTAAATTAGAG-AATAGCGAGGACGAGTGAAGAAGGAAAGTATGAAAGAGCAGA
JMFF037M04+ GCTGTTTTAAATTAGAG-AATAGCGAGGACGAGTGAAGAAGGAAAGTATGAAAGAGCAGA
JMFS051G03+ GCTGTTTTAAATTAGAG-AATAGCGAGGACGAGTGAAGAAGGAAAGTATGAAAGAGCAGA
JMFS098H01+ GCTGTTTTAAATTAGAG-AATAGCGAGGACGAGTGAAGAAGGAAAGTATGAAAGAGCAGA
JMFS075H01+ GCTGTTTTAAATTAGAG-AATAGCGAGGACGAGTGAAGAAGGAAAGTATGAAAGAGCAGA
JMFS076B03+ GCTGTTTTAAATTAGAG-AATAGCGAGGACGAGTGAAGAAGGAAAGTATGAAAGAGCAGA
JMFF041C04+ GCTGTTTTAAATTAGAG-AATAGCGAGGACGAGTGAAGAAGGAAAGTATGAAAGAGCAGA
JMFF016K04+ GCTGTTTTAAATTAGAG-AATAGCGAGGACGAGTGAAGAAGGAAAGTATGAAAGAGCAGA
JMFF038E23+ GCTGTTTTAAATTAGAG-AATAGCGAGGACGAGTGAAGAAGGAAAGTATGAAAGAGCAGA
JMFF007F17+ GCTGTTTTAAATTAGAG-AATAGCGAGGACGAGTGAAGAAGGAAAGTATGAAAGAGCAGA
JMFF044M03+ GCTGTTTTAAATTAGAG-AATAGCGAGGACGAGTGAAGAAGGAAAGTATGAAAGAGCAGA
JMFF013K04+ GCTGTTTTAAATTAGAG-AATAGCGAGGACGAGTGAAGAAGGAAAGTATGAAAGAGCAGA
JMFF008K11+ GCTGTTTTAAATTAGAG-AATAGCGAGGACGAGTGAAGAAGGAAAGTATGAAAGAGCAGA
JMFF047P12+ GCTGTTTTAAATTAGAG-AATAGCGAGGACGAGTGAAGAAGGAAAGTATGAAAGAGCAGA
JMFF018L18+ GCTGTTTTAAATTAGAG-AATAGCGAGGACGAGTGAAGAAGGAAAGTATGAAAGAGCAGA
JMFF038H05+ GCTGTTTTAAATTAGAG-AATAGCGAGGACGAGTGAAGAAGGAAAGTATGAAAGAGCAGA
JMFF020E21+ GCTGTTTTAAATTAGAG-AATAGCGAGGACGAGTGAAGAAGGAAAGTATGAAAGAGCAGA
JMFF034N04+ GCTGTTTTAAATTAGAG-AATAGCGAGGACGAGTGAAGAAGGAAAGTATGAAAGAGCAGA
JMFF032P21+ GCTGTTTTAAATTAGAG-AATAGCGAGGACGAGTGAAGAAGGAAAGTATGAAAGAGCAGA
JMFF028C05+ GCTGTTTTAAATTAGAG-AATAGCGAGGACGAGTGAAGAAGGAAAGTATGAAAGAGCAGA
JMFS002C05+ NCTGTTTTAAATTAGAG-AATAGCGAGGACGAGTGAAGAAGGAAAGTATGAAAGAGCAGA
JMFF001K14+ GCTGTTTTAAATTAGAG-AATAGCGAGGACGAGTGAAGAAGGAAAGTATGAAAGAGCAGA
JMFF036A04+ GCTGTTTTAAATTAGAG-AATAGCGAGGACGAGTGAAGAAGGAAAGTATGAAAGAGCAGA
JMFF031E15+ GCTGTTTTAAATTAGAG-AATAGCGAGGACGAGTGAAGAAGGAAAGTATGAAAGAGCAGA
JMFF014G05+ GCTGTTTTAAATTAGAG-AATAGCGAGGACGAGTGAAGAAGGAAAGTATGAAAGAGCAGA
JMFF028M07+ GCTGTTTTAAATTAGAG-AATAGCGAGGACGAGTGAAGAAGGAAAGTATGAAAGAGCAGA
JMFF033K01+ GCTGTTTTAAATTAGAG-AATAGCGAGGACGAGTGAAGAAGGAAAGTATGAAAGAGCTGA
JMFF004H09+ GCTGTTTTAAATTAGAG-AATAGCGAGGACGAGTGAAGAAGGAAAGTATGAAAGAGCTGA
JMFF002F07+ GCTGTTTTAAATTAGAG-AATAGCGAGGACGAGTGAAGAAGGAAAGTATGAAAGAGCAGA
JMFF015K19+ GCTGTTTTAAATTAGAG-AATAGCGAGGACGAGTGAAGAAGGAAAGTATGAAAGAGCAGA
JMFF019H23+ GCTGTTTTAAATTAGAG-AATAGCGAGGACGAGTGAAGAAGGAAAGTATGAAAGAGCAGA
JMFF018O13+ GCTGTTTTAAATTAGAG-AATAGCGAGGACGAGTGAAGAAGGAAAGTATGAAAGAGCAGA
JMFF012F14+ GCTGTTTTAAATTAGAG-AATAGCGAGGACGAGTGAAGAAGGAAAGTATGAAAGAGCAGA
JMFF001M19+ GCTGTTTTAAATTAGAG-AATAGCGAGGACGAGTGAAGAAGGAAAGTATGAAAGAGCAGA
JMFF040M15+ AATTAGAG-AATAGCGAGGACGAGTGAAGAAGGAAAGTATGAAAGAGCAGA
JMFF002C05+ GCTGTTTTAAATTAGAG-AATAGCGAGGACGAGTGAAGAAGGAAAGTATGAAAGAGCAGA
JMFF035P13+ GCTGTTTTAAATTAGAG-AATAGCGAGGACGAGTGAAGAAGGAAAGTATGAAAGAGCAGA
JMSF024D02+ GCTGTTTTAAATTAGAG-AATAGCGAGGACGAGTGAAGAAGGAAAGTATGAAAGAGCAGA
JMFF023F17+ GCTGTTTTAAATTAGAG-AATAGCGAGGACGAGTGAAGAAGGAAAGTATGAAAGAGCAGA
JMFF007E07+ GCTGTTTTAAATTAGAG-AATAGCGAGGACGAGTGAAGAAGGAAAGTATGAAAGAGCAGA
JMFF049C08+ GCTGTTTTAAATTAGAG-AATAGCGAGGACGAGTGAAGAAGGAAAGTATGAAAGAGCAGA
JMSF019L05+ GCTGTTTTAAATTAGAG-AATAGCGAGGACGAGTGAAGAAGGAAAGTATGAAAGAGCAGA
JMFF045B18+ GCTGTTTTAAATTAGAG-AATAGCGAGGACGAGTGAAGAAGGAAAGTATGAAAGAGCAGA
JMFF020J13+ GCTGTTTTAAATTAGAG-AATAGCGAGGACGAGTGAAGAAGGAAAGTATGAAAGAGCAGA
JMFF046E15+ GCTGTTTTAAATTAGAG-AATAGCGAGGACGAGTGAAGAAGGAAAGTATGAAAGAGCAGA
JMFF050G14+ GCTGTTTTAAATTAGAG-AATAGCGAGGACGAGTGAAGAAGGAAAGTATGAAAGAGCAGA
JMFF039E24+ GCTGTTTTAAATTAGAG-AATAGCGAGGACGAGTGAAGAAGGAAAGTATGAAAGAGCAGA
JMFF033B02+ GCTGTTTTAAATTAGAG-AATAGCGAGGACGAGTGAAGAAGGAAAGTATGAAAGAGCAGA
JMFF024N03+ GCTGTTTTAAATTAGAG-AATAGCGAGGACGAGTGAAGAAGGAAAGTATGAAAGAGCAGA
JMFF020D24+ GCTGTTTTAAATTAGAG-AATAGCGAGGACGAGTGAAGAAGGAAAGTATGAAAGAGCAGA
JMFF023F22+ GCTGTTTTAAATTAGAG-AATAGCGAGGACGAGTGAAGAAGGAAAGTATGAAAGAGCAGA
JMFF050E04+ GCTGTTTTAAATTAGAG-AATAGCGAGGACGAGTGAAGAAGGAAAGTATGAAAGAGCAGA
JMFF022G08+ AAATTAGAG-AATAGCGAGGACGAGTGAAGAAGGAAAGTATGAAAGAGCAGA
JMFF049C23+ TTTAAATTAGAGAAATAGCGAGGACGAGTGAAGAAGGAAAGTATGAAAGAGCAGA
JMFF013C19+ TGAAGAAGGAAAGTATGAAAGAGCAGA
JMFF005K17+ GCTGTTTTAAATTAGAG-AATAGCGAGGACGAGTGAAGAAGGAAAGTATGAAAGAGCAGA
                      ____________________________________________________________
consensus GCTGTTTTAAATTAGAG-AATAGCGAGGACGAGTGAAGAAGGAAAGTATGAAAGAGCAGA
 
. : . : . : . : . : . :
JMFN043G12+ TGATATCTTCTAACTAACTATAATTTAACCACTGATTGTGGTTATCAAAAAGCCCCGGGG
JMSF045C12+ TGATATCTTCTAACTAACTATAATTTAACCACTGATTGTGGTTATCAAAAAGCCCCGGGG
JMSF045N14+ TGATATCTTCTAACTAACTATAATTTAACCACTGATTGTGGTTATCAAAAAGCCCCGGGG
JMSF032J09+ TGATATCTTCTAACTAACTATAATTTAACCACTGATTGTGGTTATCAAAAAGCCCCGGGG
JMSF032B24+ TGATATCTTCTAACTAACTATAATTTAACCACTGATTGTGGTTATCAAAAAGCCCCGGGG
JMSF035L10+ TGATATCTTCTAACTAACTATAATTTAACCACTGATTGTGGTTATCAAAAAGCCCCGGGG
JMSF024H19+ TGATATCTTCTAACTAACTATAATTTAACCACTGATTGTGGTTATCAAAAAGCCCCGGGG
JMSF050E12+ TGATATCTTCTAACTAACTATAATTTAACCACTGATTGTGGTTATCAAAAAGCCCCGGGG
JMFF037M04+ TGATATCTTCTAACTAACTATAATTTAACCACTGATTGTGGTTATCAAAAAGCCCCGGGG
JMFS051G03+ TGATATCTTCTAACTAACTATAATTTAACCACTGATTGTGGTTATCAAAAAGCCCCGGGG
JMFS098H01+ TGATATCTTCTAACTAACTATAATTTAACCACTGATTGTGGTTATCAAAAAGCCCCGGGG
JMFS075H01+ TGATATCTTCTAACTAACTATAATTTAACCACTGATTGTGGTTATCAAAAAGCCCCGGGG
JMFS076B03+ TGATATCTTCTAACTAACTATAATTTAACCACTGATTGTGGTTATCAAAAAGCCCCGGGG
JMFF041C04+ TGATATCTTCTAACTAACTATAATTTAACCACTGATTGTGGTTATCAAAAAGCCCCGGGG
JMFF016K04+ TGATATCTTCTAACTAACTATAATTTAACCACTGATTGTGGTTATCAAAAAGCCCCGGGG
JMFF038E23+ TGATATCTTCTAACTAACTATAATTTAACCACTGATTGTGGTTATCAAAAAGCCCCGGGG
JMFF007F17+ TGATATCTTCTAACTAACTATAATTTAACCACTGATTGTGGTTATCAAAAAGCCCCGGGG
JMFF044M03+ TGATATCTTCTAACTAACTATAATTTAACCACTGATTGTGGTTATCAAAAAGCCCCGGGG
JMFF013K04+ TGATATCTTCTAACTAACTATAATTTAACCACTGATTGTGGTTATCAAAAAGCCCCGGGG
JMFF008K11+ TGATATCTTCTAACTAACTATAATTTAACCACTGATTGTGGTTATCAAAAAGCCCCGGGG
JMFF047P12+ TGATATCTTCTAACTAACTATAATTTAACCACTGATTGTGGTTATCAAAAAGCCCCGGGG
JMFF018L18+ TGATATCTTCTAACTAACTATAATTTAACCACTGATTGTGGTTATCAAAAAGCCCCGGGG
JMFF038H05+ TGATATCTTCTAACTAACTATAATTTAACCACTGATTGTGGTTATCAAAAAGCCCCGGGG
JMFF020E21+ TGATATCTTCTAACTAACTATAATTTAACCACTGATTGTGGTTATCAAAAAGCCCCGGGG
JMFF034N04+ TGATATCTTCTAACTAACTATAATTTAACCACTGATTGTGGTTATCAAAAAGCCCCGGGG
JMFF032P21+ TGATATCTTCTAACTAACTATAATTTAACCACTGATTGTGGTTATCAAAAAGCCCCGGGG
JMFF028C05+ TGATATCTTCTAACTAACTATAATTTAACCACTGATTGTGGTTATCAAAAAGCCCCGGGG
JMFS002C05+ TGATATCTTCTAACTAACTATAATTTAACCACTGATTGTGGTTATCAAAAAGCCCCGGGG
JMFF022I03+ CTATAATTTAACCACTGATTGTGGTTATCAAAAAGCCCCGGGG
JMFF001K14+ TGATATCTTCTAACTAACTATAATTTAACCACTGATTGTGGTTATCAAAAAGCCCCGGGG
JMFF036A04+ TGATATCTTCTAACTAACTATAATTTAACCACTGATTGTGGTTATCAAAAAGCCCCGGGG
JMFF031E15+ TGATATCTTCTAACTAACTATAATTTAACCACTGATTGTGGTTATCAAAAAGCCCCGGGG
JMFF014G05+ TGATATCTTCTAACTAACTATAATTTAACCACTGATTGTGGTTATCAAAAAGCCCCGGGG
JMFF028M07+ TGATATCTTCTAACTAACTATAATTTAA-CACTGATTGTGGTTATCAAAAAGCCCCGGGG
JMFF033K01+ TGATATCTTCTAACTAACTATAATTTAACCACTGATTGTGGTTATCAAAAAGCCCCGGGG
JMFF004H09+ TGATATCTTCTAACTAACTATAATTTAACCACTGATTGTGGTTATCAAAAAGCCCCGGGG
JMFF002F07+ TGATATCTTCTAACTAACTATAATTTAACCACTGATTGTGGTTATCAAAAAGCCCCGGGG
JMFF015K19+ TGATATCTTCTAACTAACTATAATTTAACCACTGATTGTGGTTATCAAAAAGCCCCGGGG
JMFF019H23+ TGATATCTTCTAACTAACTATAATTTAACCACTGATTGTGGTTATCAAAAAGCCCCGGGG
JMFF018O13+ TGATATCTTCTAACTAACTATAATTTAACCACTGATTGTGGTTATCAAAAAGCCCCGGGG
JMFF012F14+ TGATATCTTCTAACTAACTATAATTTAACCACTGATTGTGGTTATCAAAAAGCCCCGGGG
JMFF001M19+ TGATATCTTCTAACTAACTATAATTTAACCACTGATTGTGGTTATCAAAAAGCCCCGGGG
JMFF040M15+ TGATATCTTCTAACTAACTATAATTTAACCACTGATTGTGGTTATCAAAAAGCCCCGGGG
JMFF038F03+ TGATTGTGGTTATCAAAAAGCCCCGGGG
JMFF002C05+ TGATATCTTCTAACTAACTATAATTTAACCACTGATTGTGGTTATCAAAAAGCCCCGGGG
JMFF035P13+ TGATATCTTCTAACTAACTATAATTTAACCACTGATTGTGGTTATCAAAAAGCCCCGGGG
JMSF024D02+ TGATATCTTCTAACTAACTATAATTTAACCACTGATTGTGGTTATCAAAAAGCCCCGGGG
JMFF023F17+ TGATATCTTCTAACTAACTATAATTTAACCACTGATTGTGGTTATCAAAAAGCCCCGGGG
JMFF007E07+ TGATATCTTCTAACTAACTATAATTTAACCACTGATTGTGGTTATCAAAAAGCCCCGGGG
JMFF049C08+ TGATATCTTCTAACTAACTATAATTTAACCACTGATTGTGGTTATCAAAAAGCCCCGGGG
JMSF050D12+ TTCTAACTAACTATAATTTAACCACTGATTGTGGTTATCAAAAAGCCCCGGGG
JMSF019L05+ TGATATCTTCTAACTAACTATAATTTAACCACTGATTGTGGTTATCAAAAAGCCCCGGGG
JMFF045B18+ TGATATCTTCTAACTAACTATAATTTAACCACTGATTGTGGTTATCAAAAAGCCCCGGGG
JMFF020J13+ TGATATCTTCTAACTAACTATAATTTAACCACTGATTGTGGTTATCAAAAAGCCCCGGGG
JMFF046E15+ TGATATCTTATAACTAACTATAATTTAACCACTGATTGTGGTTATCAAAAAGCCCCGGGG
JMFF050G14+ TGATATCTTCTAACTAACTATAATTTAACCACTGATTGTGGTTATCAAAAAGCCCCGGGG
JMFF039E24+ TGATATCTTCTAACTAACTATAATTTAACCACTGATTGTGGTTATCAAAAAGCCCCGGGG
JMFF033B02+ TGATATCTTCTAACTAACTATAATTTAACCACTGATTGTGGTTATCAAAAAGCCCCGGGG
JMFF024N03+ TGATATCTTCTAACTAACTATAATTTAACCACTGATTGTGGTTATCAAAAAGCCCCGGGG
JMFF020D24+ TGATATCTTCTAACTAACTATAATTTAACCACTGATTGTGGTTATCAAAAAGCCCCGGGG
JMFF023F22+ TGATATCTTCTAACTAACTATAATTTAACCACTGATTGTGGTTATCAAAAAGCCCCGGGG
JMFF050E04+ TGATATCTTCTAACTAACTATAATTTAACCACTGATTGTGGTTATCAAAAAGCCCCGGGG
JMFF022G08+ TGATATCTTCTAACTAACTATAATTTAACCACTGATTGTGGTTATCAAAAAGCCCCGGGG
JMFF049C23+ TGATATCTTCTAACTAACTATAATTTAACCACTGATTGTGGTTATCAAAAAGCCCCGGGG
JMFF013C19+ TGATATCTTCTAACTAACTATAATTTAACCACTGATTGTGGTTATCAAAAAGCCCCGGGG
JMFF024G10+ CTAACTATAATTTAACCACTGATTGTGGTTATCAAAAAGCCCCGGGG
JMFF005K17+ TGATATCTTCTAACTAACTATAATTTAACCACTGATTGTGGTTATCAAAAAGCCCCGGGG
                      ____________________________________________________________
consensus TGATATCTTCTAACTAACTATAATTTAACCACTGATTGTGGTTATCAAAAAGCCCCGGGG
 
. : . : . : . : . : . :
JMFN043G12+ ACCTCAGGATGGTTTGCGAGCACAGTTGGAGTAAGCAGCAGATCTGAATTTCTTGATTCC
JMSF045C12+ ACCTCAGGATGGTTTGCGAGCACAGTTGGAGTAAGCAGCAGATCTGAATTTCTTGATTCC
JMSF045N14+ ACCTCAGGATGGTTTGCGAGCACAGTTGGAGTAAGCAGCAGATCTGAATTTCTTGATTCC
JMSF032J09+ ACCTCAGGATGGTTTGCGAGCACAGTTGGAGTAAGCAGCAGATCTGAATTTCTTGATTCC
JMSF032B24+ ACCTCAGGATGGTTTGCGAGCACAGTTGGAGTAAGCAGCAGATCTGAATTTCTTGATTCC
JMSF035L10+ ACCTCAGGATGGTTTGCGAGCACAGTTGGAGTAAGCAGCAGATCTGAATTTCTTGATTCC
JMSF024H19+ ACCTCAGGATGGTTTGCGAGCACAGTTGGAGTAAGCAGCAGATCTGAATTTCTTGATTCC
JMSF050E12+ ACCTCAGGATGGTTTGCGAGCACAGTTGGAGTAAGCAGCAGATCTGAATTTCTTGATTCC
JMFF037M04+ ACCTCAGGATGGTTTGCGAGCACAGTTGGGGTAAGCAGCAGATCTGAATTTCTTGATTCC
JMFS051G03+ ACCTCAGGATGGTTTGCGAGCACAGTTGGAGTAAGCAGCAGATCTGAATTTCTTGATTCC
JMFS098H01+ ACCTCAGGATGGTTTGCGAGCACAGTTGGAGTAAGCAGCAGATCTGAATTTCTTGATTCC
JMFS075H01+ ACCTCAGGATGGTTTGCGAGCACAGTTGGAGTAAGCAGCAGATCTGAATTTCTTGATTCC
JMFS076B03+ ACCTCAGGATGGTTTGCGAGCACAGTTGGAGTAAGCAGCAGATCTGAATTTCTTGATTCC
JMFF041C04+ ACCTCAGGATGGTTTGCGAGCACAGTTGGAGTAAGCAGCAGATCTGAATTTCTTGATTCC
JMFF016K04+ ACCTCAGGATGGTTTGCGAGCACAGTTGGAGTAAGCAGCAGATCTGAATTTCTTGATTCC
JMFF038E23+ ACCTCAGGATGGTTTGCGAGCACAGTTGGAGTAAGCAGCAGATCTGAATTTCTTGATTCC
JMFF007F17+ ACCTCAGGATGGTTTGCGAGCACAGTTGGAGTAAGCAGCAGATCTGAATTTCTTGATTCC
JMFF044M03+ ACCTCAGGATGGTTTGCGAGCACAGTTGGAGTAAGCAGCAGATCTGAATTTCTTGATTCC
JMFF013K04+ ACCTCAGGATGGTTTGCGAGCACAGTTGGAGTAAGCAGCAGATCTGAATTTCTTGATTCC
JMFF008K11+ ACCTCAGGATGGTTTGCGAGCACAGTTGGAGTAAGCAGCAGATCTGAATTTCTTGATTCC
JMFF047P12+ ACCTCAGGATGGTTTGCGAGCACAGTTGGAGTAAGCAGCAGATCTGAATTTCTTGATTCC
JMFF018L18+ ACCTCAGGATGGTTTGCGAGCACAGTTGGAGTAAGCAGCAGATCTGAATTTCTTGATTCC
JMFF038H05+ ACCTCAGGATGGTTTGCGAGCACAGTTGGAGTAAGCAGCAGATCTGAATTTCTTGATTCC
JMFF020E21+ ACCTCAGGATGGTTTGCGAGCACAGTTGGAGTAAGCAGCAGATCTGAATTTCTTGATTCC
JMFF034N04+ ACCTCAGGATGGTTTGCGAGCACAGTTGGAGTAAGCAGCAGATCTGAATTTCTTGATTCC
JMFF032P21+ ACCTCAGGATGGTTTGCGAGCACAGTTGGAGTAAGCAGCAGATCTGAATTTCTTGATTCC
JMFF028C05+ ACCTCAGGATGGTTTGCGAGCACAGTTGGAGTAAGCAGCAGATCTGAATTTCTTGATTCC
JMFS002C05+ ACCTCAGGATGGTTTGCGAGCACAGTTGGAGTAAGCAGCAGATCTGAATTTCTTGATTCC
JMFF022I03+ ACCTCAGGATGGTTTGCGAGCACAGTTGGAGTAAGCAGCAGATCTGAATTTCTTGATTCC
JMFF001K14+ ACCTCAGGATGGTTTGCGAGCACAGTTGGAGTAAGCAGCAGATCTGAATTTCTTGATTCC
JMFF036A04+ ACCTCAGGATGGTTTGCGAGCACAGTTGGAGTAAGCAGCAGATCTGAATTTCTTGATTCC
JMFF031E15+ ACCTCAGGATGGTTTGCGAGCACAGTTGGAGTAAGCAGCAGATCTGAATTTCTTGATTCC
JMFF014G05+ ACCTCAGGATGGTTTGCGAGCACAGTTGGAGTAAGCAGCAGATCTGAATTTCTTGATTCC
JMFF028M07+ ACCTCAGGATGGTTTGCGAGCACAGTTGGAGTAAGCAGCAGATCTGAATTTCTTGATTCC
JMFF033K01+ ACCTCAGGATGGTTTGCGAGCACAGTTGGAGTAAGCAGCAGATCTGAATTTCTTGATTCC
JMFF004H09+ ACCTCAGGATGGTTTGCGAGCACAGTTGGAGTAAGCAGCAGATCTGAATTTCTTGATTCC
JMFF002F07+ ACCTCAGGATGGTTTGCGAGCACAGTTGGAGTAAGCAGCAGATCTGAATTTCTTGATTCC
JMFF015K19+ ACCTCAGGATGGTTTGCGAGCACAGTTGGAGTAAGCAGCAGATCTGAATTTCTTGATTCC
JMFF019H23+ ACCTCAGGATGGTTTGCGAGCACAGTTGGAGTAAGCAGCAGATCTGAATTTCTTGATTCC
JMFF018O13+ ACCTCAGGATGGTTTGCGAGCACAGTTGGAGTAAGCAGCAGATCTGAATTTCTTGATTCC
JMFF012F14+ ACCTCAGGATGGTTTGCGAGCACAGTTGGAGTAAGCAGCAGATCTGAATTTCTTGATTCC
JMFF001M19+ ACCTCAGGATGGTTTGCGAGCACAGTTGGAGTAAGCAGCAGATCTGAATTTCTTGATTCC
JMFF040M15+ ACCTCAGGATGGTTTGCGAGCACAGTTGGAGTAAGCAGCAGATCTGAATTTCTTGATTCC
JMFF038F03+ ACCTCAGGATGGTTTGCGAGCACAGTTGGAGTAAGCAGCAGATCTGAATTTCTTGATTCC
JMFF002C05+ ACCTCAGGATGGTTTGCGAGCACAGTTGGAGTAAGCAGCAGATCTGAATTTCTTGATTCC
JMFF035P13+ ACCTCAGGATGGTTTGCGAGCACAGTTGGAGTAAGCAGCAGATCTGAATTTCTTGATTCC
JMSF024D02+ ACCTCAGGATGGTTTGCGAGCACAGTTGGAGTAAGCAGCAGATCTGAATTTCTTGATTCC
JMFF023F17+ ACCTCAGGATGGTTTGCGAGCACAGTTGGAGTAAGCAGCAGATCTGAATTTCTTGATTCC
JMFF007E07+ ACCTCAGGATGGTTTGCGAGCACAGTTGGAGTAAGCAGCAGATCTGAATTTCTTGATTCC
JMFF049C08+ ACCTCAGGATGGTTTGCGAGCACAGTTGGAGTAAGCAGCAGATCTGAATTTCTTGATTCC
JMSF050D12+ ACCTCAGGATGGTTTGCGAGCACAGTTGGAGTAAGCAGCAGATCTGAATTTCTTGATTCC
JMSF019L05+ ACCTCAGGATGGTTTGCGAGCACAGTTGGAGTAAGCAGCAGATCTGAATTTCTTGATTCC
JMFF045B18+ ACCTCAGGATGGTTTGCGAGCACAGTTGGAGTAAGCAGCAGATCTGAATTTCTTGATTCC
JMFF020J13+ ACCTCAGGATGGTTTGCGAGCACAGTTGGAGTAAGCAGCAGATCTGAATTTCTTGATTCC
JMFF046E15+ ACCTCAGGATGGTTTGCGAGCACAGTTGGAGTAAGCAGCAGATCTGAATTTCTTGATTCC
JMFF050G14+ ACCTCAGGATGGTTTGCGAGCACAGTTGGAGTAAGCAGCAGATCTGAATTTCTTGATTCC
JMFF039E24+ ACCTCAGGATGGTTTGCGAGCACAGTTGGAGTAAGCAGCAGATCTGAATTTCTTGATTCC
JMFF033B02+ ACCTCAGGATGGTTTGCGAGCACAGTTGGAGTAAGCAGCAGATCTGAATTTCTTGATTCC
JMFF024N03+ ACCTCAGGATGGTTTGCGAGCACAGTTGGAGTAAGCAGCAGATCTGAATTTCTTGATTCC
JMFF020D24+ ACCTCAGGATGGTTTGCGAGCACAGTTGGAGTAAGCAGCAGATCTGAATTTCTTGATTCC
JMFF023F22+ ACCTCAGGATGGTTTGCGAGCACAGTTGGAGTAAGCAGCAGATCTGAATTTCTTGATTCC
JMFF050E04+ ACCTCAGGATGGTTTGCGAGCACAGTTGGAGTAAGCAGCAGATCTGAATTTCTTGATTCC
JMFF022G08+ ACCTCAGGATGGTTTGCGAGCACAGTTGGAGTAAGCAGCAGATCTGAATTTCTTGATTCC
JMFF049C23+ ACCTCAGGATGGTTTGCGAGCACAGTTGGAGTAAGCAGCAGATCTGAATTTCTTGATTCC
JMFF013C19+ ACCTCAGGATGGTTTGCGAGCACAGTTGGAGTAAGCAGCAGATCTGAATTTCTTGATTCC
JMFF024G10+ ACCTCAGGATGGTTTGCGAGCACAGTTGGAGTAAGCAGCAGATCTGAATTTCTTGATTCC
JMFF040P16+ TTTGCGAGCACAGTTGGAGTAAGCAGCAGATCTGAATTTCTTGATTCC
JMFF005K17+ ACCTCAGGATGGTTTGCGAGCACAGTTGGAGTAAGCAGCAGATCTGAATTTCTTGATTCC
                      ____________________________________________________________
consensus ACCTCAGGATGGTTTGCGAGCACAGTTGGAGTAAGCAGCAGATCTGAATTTCTTGATTCC
 
. : . : . : . : . : . :
JMFN043G12+ TCCGTTTGGTCGAACGTCCTCTACAGTGTAACCCAGGGGAGCCTCGTAGAACAAGGATTT
JMSF045C12+ TCCGTTTGGTCGAACGTCCTCTACAGTGTAACCCAGGGGAGCCTCGTAGAACAAGGATTT
JMSF045N14+ TCCGTTTGGTCGAACGTCCTCTACAGTGTAACCCAGGGGAGCCTCGTAGAACAAGGATTT
JMSF032J09+ TCCGTTTGGTCGAACGTCCTCTACAGTGTAACCCAGGGGAGCCTCGTAGAACAAGGATTT
JMSF032B24+ TCCGTTTGGTCGAACGTCCTCTACAGTGTAACCCAGGGGAGCCTCGTAGAACAAGGATTT
JMSF035L10+ TCCGTTTGGTCGAACGTCCTCTACAGTGTAACCCAGGGGAGCCTCGTAGAACAAGGATTT
JMSF024H19+ TCCGTTTGGTCGAACGTCCTCTACAGTGTAACCCAGGGGAGCCTCGTAGAACAAGGATTT
JMSF050E12+ TCCGTTTGGTCGAACGTCCTCTACAGTGTAACCCAGGGGAGCCTCGTAGAACAAGGATTT
JMFF037M04+ TCCGTTTGGTCGAACGTCCTCTACAGTGTAACCCAGGGGAGCCTCGTAGAACAAGGATTT
JMFS051G03+ TCCGTTTGGTCGAACGTCCTCTACAGTGTAACCCAGGGGAGCCTCGTAGAACAAGGATTT
JMFS098H01+ TCCGTTTGGTCGAACGTCCTCTACAGTGTAACCCAGGGGAGCCTCGTAGAACAAGGATTT
JMFS075H01+ TCCGTTTGGTCGAACGTCCTCTACAGTGTAACCCAGGGGAGCCTCGTAGAACAAGGATTT
JMFS076B03+ TCCGTTTGGTCGAACGTCCTCTACAGTGTAACCCAGGGGAGCCTCGTAGAACAAGGATTT
JMFF041C04+ TCCGTTTGGTCGAACGTCCTCTACAGTGTAACCCAGGGGAGCCTCGTAGAACAAGGATTT
JMFF016K04+ TCCGTTTGGTCGAACGTCCTCTACAGTGTAACCCAGGGGAGCCTCGTAGAACAAGGATTT
JMFF038E23+ TCCGTTTGGTCGAACGTCCTCTACAGTGTAACCCAGGGGAGCCTCGTAGAACAAGGATTT
JMFF007F17+ TCCGTTTGGTCGAACGTCCTCTACAGTGTAACCCAGGGGAGCCTCGTAGAACAAGGATTT
JMFF044M03+ TCCGTTTGGTCGAACGTCCTCTACAGTGTAACCCAGGGGAGCCTCGTAGAACAAGGATTT
JMFF013K04+ TCCGTTTGGTCGAACGTCCTCTACAGTGTAACCCAGGGGAGCCTCGTAGAACAAGGATTT
JMFF008K11+ TCCGTTTGGTCGAACGTCCTCTACAGTGTAACCCAGGGGAGCCTCGTAGAACAAGGATTT
JMFF047P12+ TCCGTTTGGTCGAACGTCCTCTACAGTGTAACCCAGGGGAGCCTCGTAGAACAAGGATTT
JMFF018L18+ TCCGTTTGGTCGAACGTCCTCTACAGTGTAACCCAGGGGAGCCTCGTAGAACAAGGATTT
JMFF038H05+ TCCGTTTGGTCGAACGTCCTCTACAGTGTAACCCAGGGGAGCCTCGTAGAACAAGGATTT
JMFF020E21+ TCCGTTTGGTCGAACGTCCTCTACAGTGTAACCCAGGGGAGCCTCGTAGAACAAGGATTT
JMFF034N04+ TCCGTTTGGTCGAACGTCCTCTACAGTGTAACCCAGGGGAGCCTCGTAGAACAAGGATTT
JMFF032P21+ TCCGTTTGGTCGAACGTCCTCTACAGTGTAACCCAGGGGAGCCTCGTAGAACAAGGATTT
JMFF028C05+ TCCGTTTGGTCGAACGTCCTCTACAGTGTAACCCAGGGGAGCCTCGTAGAACAAGGATTT
JMFS002C05+ TCCGTTTGGTCGAACGTCCTCTACAGTGTAACCCAGGGGAGCCTCGTAGAACAAGGATTT
JMFF022I03+ TCCGTTTGGTCGAACGTCCTCTACAGTGTAACCCAGGGGAGCCTCGTAGAACAAGGATTT
JMFF001K14+ TCCGTTTGGTCGAACGTCCTCTACAGTGTAACCCAGGGGAGCCTCGTAGAACAAGGATTT
JMFF036A04+ TCCGTTTGGTCGAACGTCCTCTACAGTGTAACCCAGGGGAGCCTCGTAGAACAAGGATTT
JMFF031E15+ TCCGTTTGGTCGAACGTCCTCTACAGTGTAACCCAGGGGAGCCTCGTAGAACAAGGATTT
JMFF014G05+ TCCGTTTGGTCGAACGTCCTCTACAGTGTAACCCAGGGGAGCCTCGTAGAACAAGGATTT
JMFF028M07+ TCCGTTTGGTCGAACGTCCTCTACAGTGTAACCCAGGGGAGCCTCGTAGAACAAGGATTT
JMFF033K01+ TCCGTTTGGTCGAACGTCCTCTACAGTGTAACCCAGGGGAGCCTCGTAGAACAAGGATTT
JMFF004H09+ TCCGTTTGGTCGAACGTCCTCTACAGTGTAACCCAGGGGAGCCTCGTAGAACAAGGATTT
JMFF002F07+ TCCGTTTGGTCGAACGTCCTCTACAGTGTAACCCAGGGGAGCCTCGTAGAACAAGGATTT
JMFF015K19+ TCCGTTTGGTCGAACGTCCTCTACAGTGTAACCCAGGGGAGCCTCGTAGAACAAGGATTT
JMFF019H23+ TCCGTTTGGTCGAACGTCCTCTACAGTGTAACCCAGGGGAGCCTCGTAGAACAAGGATTT
JMFF018O13+ TCCGTTTGGTCGAACGTCCTCTACAGTGTAACCCAGGGGAGCCTCGTAGAACAAGGATTT
JMFF012F14+ TCCGTTTGGTCGAACGTCCTCTACAGTGTAACCCAGGGGAGCCTCGTAGAACAAGGATTT
JMFF001M19+ TCCGTTTGGTCGAACGTCCTCTACAGTGTAACCCAGGGGAGCCTCGTAGAACAAGGATTT
JMFF040M15+ TCCGTTTGGTCGAACGTCCTCTACAGTGTAACCCAGGGGAGCCTCGTAGAACAAGGATTT
JMFF038F03+ TCCGTTTGGTCGAACGTCCTCTACAGTGTAACCCAGGGGAGCCTCGTAGAACAAGGATTT
JMFF002C05+ TCCGTTTGGTCGAACGTCCTCTACAGTGTAACCCAGGGGAGCCTCGTAGAACAAGGATTT
JMFF035P13+ TCCGTTTGGTCGAACGTCCTCTACAGTGTAACCCAGGGGAGCCTCGTAGAACAAGGATTT
JMSF024D02+ TCCGTTTGGTCGAACGTCCTCTACAGTGTAACCCAGGGGAGCCTCGTAGAACAAGGATTT
JMFF023F17+ TCCGTTTGGTCGAACGTCCTCTACAGTGTAACCCAGGGGAGCCTCGTAGAACAAGGATTT
JMFF007E07+ TCCGTTTGGTCGAACGTCCTCTACAGTGTAACCCAGGGGAGCCTCGTAGAACAAGGATTT
JMFF049C08+ TCCGTTTGGTCGAACGTCCTCTACAGTGTAACCCAGGGGAGCCTCGTAGAACAAGGATTT
JMSF050D12+ TCCGTTTGGTCGAACGTCCTNTACAGTGTAACCCAGGGGAGCCTCGTAGAACAAGGATTT
JMSF019L05+ TCCGTTTGGTCGAACGTCCTCTACAGTGTAACCCAGGGGAGCCTCGTAGAACAAGGATTT
JMFF045B18+ TCCGTTTGGTCGAACGTCCTCTACAGTGTAACCCAGGGGAGCCTCGTAGAACAAGGATTT
JMFF020J13+ TCCGTTTGGTCGAACGTCCTCTACAGTGTAACCCAGGGGAGCCTCGTAGAACAAGGATTT
JMFF046E15+ TCCGTTTGGTCGAACGTCCTCTACAGTGTAACCCAGGGGAGCCTCGTAGAACAAGGATTT
JMFF050G14+ TCCGTTTGGTCGAACGTCCTCTACAGTGTAACCCAGGGGAGCCTCGTAGAACAAGGATTT
JMFF039E24+ TCCGTTTGGTCGAACGTCCTCTACAGTGTAACCCAGGGGAGCCTCGTAGAACAAGGATTT
JMFF033B02+ TCCGTTTGGTCGAACGTCCTCTACAGTGTAACCCAGGGGAGCCTCGTAGAACAAGGATTT
JMFF024N03+ TCCGTTTGGTCGAACGTCCTCTACAGTGTAACCCAGGGGAGCCTCGTAGAACAAGGATTT
JMFF020D24+ TCCGTTTGGTCGAACGTCCTCTACAGTGTAACCCAGGGGAGCCTCGTAGAACAAGGATTT
JMFF023F22+ TCCGTTTGGTCGAACGTCCTCTACAGTGTAACCCAGGGGAGCCTCGTAGAACAAGGATTT
JMFF050E04+ TCCGTTTGGTCGAACGTCCTCTACAGTGTAACCCAGGGGAGCCTCGTAGAACAAGGATTT
JMFF022G08+ TCCGTTTGGTCGAACGTCCTCTACAGTGTAACCCAGGGGAGCCTCGTAGAACAAGGATTT
JMFF049C23+ TCCGTTTGGTCGAACGTCCTCTACAGTGTAACCCAGGGGAGCCTCGTAGAACAAGGATTT
JMFF013C19+ TCCGTTTGGTCGAACGTCCTCTACAGTGTAACCCAGGGGAGCCTCGTAGAACAAGGATTT
JMFF024G10+ TCCGTTTGGTCGAACGTCCTCTACAGTGTAACCCAGGGGAGCCTCGTAGAACAAGGATTT
JMFF040P16+ TCCGTTTGGTCGAACGTCCTCTACAGTGTAACCCAGGGGAGCCTCGTAGAACAAGGATTT
JMFF005K17+ TCCGTTTGGTCGAACGTCCTCTACAGTGTAACCCAGGGGAGCCTCGTAGAACAAGGATTT
                      ____________________________________________________________
consensus TCCGTTTGGTCGAACGTCCTCTACAGTGTAACCCAGGGGAGCCTCGTAGAACAAGGATTT
 
. : . : . : . : . : . :
JMFN043G12+ ACTACTGCTAGACTTCTTTTTCCCACCTTTAGACTCCATCAGTTCATTACA-----C
JMSF045C12+ ACTACTGCTAGACTTCTTTTTCCCACCTTTAGACTCCATCAGTTCATTACA-----CAGA
JMSF045N14+ ACTACTGCTAGACTTCTTTTTCCCACCTTTAGACTCCATCAGTTCATTACA-----CAGA
JMSF032J09+ ACTACTGCTAGACTTCTTTTTCCCACCTTTAGACTCCATCAGTTCATTACA-----CAGA
JMSF032B24+ ACTACTGCTAGACTTCTTTTTCCCACCTTTAGACTCCATCAGTTCATTACA-----CAGA
JMSF035L10+ ACTACTGCTAGACTTCTTTTTCCCACCTTTAGACTCCATCAGTTCATTACA-----CAGA
JMSF024H19+ ACTACTGCTAGACTTCTTTTTCCCACCTTTAGACTCCATCAGTTCATTACA-----CAGA
JMSF050E12+ ACTACTGCTAGACTTCTTTTTCCCACCTTTAGACTCCATCAGTTCATTACA-----CAGA
JMFF037M04+ ACTACTGCTAGACTTCTTTTTCCCACCTTTAGACTCCATCAGTTCATTACA-----CAGA
JMFS051G03+ ACTACTGCTAGACTTCTTTTTCCCACCTTTAGACTCCATCAGTTCATTACA-----CAGA
JMFS098H01+ ACTACTGCTAGACTTCTTTTTCCCACCTTTAGACTCCATCAGTTCATTACA-----CAGA
JMFS075H01+ ACTACTGCTAGACTTCTTTTTCCCACCTTTAGACTCCATCAGTTCATTACA-----CAGA
JMFS076B03+ ACTACTGCTAGACTTCTTTTTCCCACCTTTAGACTCCATCAGTTCATTACA-----CAGA
JMFF041C04+ ACTACTGCTAGACTTCTTTTTCCCACCTTTAGACTCCATCAGTTCATTACA-----CAGA
JMFF016K04+ ACTACTGCTAGACTTCTTTTTCCCACCTTTAGACTCCATCAGTTCATTACA-----CAGA
JMFF038E23+ ACTACTGCTAGACTTCTTTTTCCCACCTTTAGACTCCATCAGTTCATTACA-----CAGA
JMFF007F17+ ACTACTGCTAGACTTCTTTTTCCCACCTTTAGACTCCATCAGTTCATTACA-----CAGA
JMFF044M03+ ACTACTGCTAGACTTCTTTTTCCCACCTTTAGACTCCACCAGTTCATTACA-----CAGA
JMFF013K04+ ACTACTGCTAGACTTCTTTTTCCCACCTTTAGACTCCATCAGTTCATTACA-----CAGA
JMFF008K11+ ACTACTGCTAGACTTCTTTTTCCCACCTTTAGACTCCATCAGTTCATTACA-----CAGA
JMFF047P12+ ACTACTGCTAGACTTCTTTTTCCCACCTTTAGACTCCATCAGTTCATTACACCTTACAGA
JMFF018L18+ ACTACTGCTAGACTTCTTTTTCCCACCTTTAGACTCCATCAGTTCATTACA-----CAGA
JMFF038H05+ ACTACTGCTAGACTTCTTTTTCCCACCTTTAGACTCCATCAGTTCATTACA-----CAGA
JMFF020E21+ ACTACTGCTAGACTTCTTTTTCCCACCTTTAGACTCCATCAGTTCATTACA-----CAGA
JMFF034N04+ ACTACTGCTAGACTTCTTTTTCCCACCTTTAGACTCCATCAGTTCATTACA-----CAGA
JMFF032P21+ ACTACTGCTAGACTTCTTTTTCCCACCTTTAGACTCCATCAGTTCATTACA-----CAGA
JMFF028C05+ ACTACTGCTAGACTTCTTTTTCCCACCTTTAGACTCCATCAGTTCATTACA-----CAGA
JMFS002C05+ ACTACTGCTAGACTTCTTTTTCCCACCTTTAGACTCCATCAGTTCATTACA-----CAGA
JMFF022I03+ ACTACTGCTAGACTTCTTTTTCCCACCTTTAGACTCCATCAGTTCATTACA-----CAGA
JMFF001K14+ ACTACTGCTAGACTTCTTTTTCCCACCTTTAGACTCCATCAGTTCATTACA-----CAGA
JMFF036A04+ ACTACTGCTAGACTTCTTTTTCCCACCTTTAGACTCCATCAGTTCATTACA-----CAGA
JMFF031E15+ ACTACTGCTAGACTTCTTTTTCCCACCTTTAGACTCCATCAGTTCATTACA-----CAGA
JMFF014G05+ ACTACTGCTAGACTTCTTTTTCCCACCTTTAGACTCCATCAGTTCATTACA-----CAGA
JMFF028M07+ ACTACTGCTAGACTTCTTTTTCCCACCTTTAGACTCCATCAGTTCATTACA-----CAGA
JMFF033K01+ ACTACTGCTAGACTTCTTTTTCCCACCTTTAGACTCCATCAGTTCATTACA-----CAGA
JMFF004H09+ ACTACTGCTAGACTTCTTTTTCCCACCTTTAGACTCCATCAGTTCATTACA-----CAGA
JMFF002F07+ ACTACTGCTAGACTTCTTTTTCCCACCTTTAGACTCCATCAGTTCATTACA-----CAGA
JMFF015K19+ ACTACTGCTAGACTTCTTTTTCCCACCTTTAGACTCCATCAGTTCATTACA-----CAGA
JMFF019H23+ ACTACTGCTAGACTTCTTTTTCCCACCTTTAGACTCCATCAGTTCATTACA-----CAGA
JMFF018O13+ ACTACTGCTAGACTTCTTTTTCCCACCTTTAGACTCCATCAGTTCATTACA-----CAGA
JMFF012F14+ ACTACTGCTAGACTTCTTTTTCCCACCTTTAGACTCCATCAGTTCATTACA-----CAGA
JMFF001M19+ ACTACTGCTAGACTTCTTTTTCCCACCTTTAGACTCCATCAGTTCATTACA-----CAGA
JMFF040M15+ ACTACTGCTAGACTTCTTTTTCCCACCTTTAGACTCCATCAGTTCATTACA-----CAGA
JMFF038F03+ ACTACTGCTAGACTTCTTTTTCCCACCTTTAGACTCCATCAGTTCATTACA-----CAGA
JMFF002C05+ ACTACTGCTAGACTTCTTTTTCCCACCTTTAGACTCCATCAGTTCATTACA-----CAGA
JMFF035P13+ ACTACTGCTAGACTTCTTTTTCCCACCTTTAGACTCCATCAGTTCATTACA-----CAGA
JMSF024D02+ ACTACTGCTAGACTTCTTTTTCCCACCTTTAGACTCCATCAGTTCATTACA-----CAGA
JMFF023F17+ ACTACTGCTAGACTTCTTTTTCCCACCTTTAGACTCCATCAGTTCATTACA-----CAGA
JMFF007E07+ ACTACTGCTAGACTTCTTTTTCCCACCTTTAGACTCCATCAGTTCATTACA-----CAGA
JMFF049C08+ ACTACTGCTAGACTTCTTTTTCCCACCTTTAGACTCCATCAGTTCATTACA-----CAGA
JMSF050D12+ ACTACTGCTAGACTTCTTTTTCCCACCTTTAGACTCCATCAGTTCATTACA-----CAGA
JMSF019L05+ ACTACTGCTAGACTTCTTTTTCCCACCTTTAGACTCCATCAGTTCATTACA-----CAGA
JMFF045B18+ ACTACTGCTAGACTTCTTTTTCCCACCTTTAGACTCCATCAGTTCATTACA-----CAGA
JMFF020J13+ ACTACTGCTAGACTTCTTTTTCCCACCTTTAGACTCCATCAGTTCATTACA-----CAGA
JMFF046E15+ ACTACTGCTAGACTTCTTTTTCCCACCTTTAGACTCCATCAGTTCATTACA-----CAGA
JMFF050G14+ ACTACTGCTAGACTTCTTTTTCCCACCTTTAGACTCCATCAGTTCATTACA-----CAGA
JMFF039E24+ ACTACTGCTAGACTTCTTTTTCCCACCTTTAGACTCCATCAGTTCATTACA-----CAGA
JMFF033B02+ ACTACTGCTAGACTTCTTTTTCCCACCTTTAGACTCCATCAGTTCATTACA-----CAGA
JMFF024N03+ ACTACTGCTAGACTTCTTTTTCCCACCTTTAGACTCCATCAGTTCATTACA-----CAGA
JMFF020D24+ ACTACTGCTAGACTTCTTTTTCCCACCTTTAGACTCCATCAGTTCATTACA-----CAGA
JMFF023F22+ ACTACTGCTAGACTTCTTTTTCCCACCTTTAGACTCCATCAGTTCATTACA-----CAGA
JMFF050E04+ ACTACTGCTAGACTTCTTTTTCCCACCTTTAGACTCCATCAGTTCATTACA-----CAGA
JMFF022G08+ ACTACTGCTAGACTTCTTTTTCCCACCTTTAGACTCCATCAGTTCATTACA-----CAGA
JMFF049C23+ ACTACTGCTAGACTTCTTTTTCCCACCTTTAGACTCCATCAGTTCATTACA-----CAGA
JMFF013C19+ ACTACTGCTAGACTTCTTTTTCCCACCTTTAGACTCCATCAGTTCATTACA-----CAGA
JMFF024G10+ ACTACTGCTAGACTTCTTTTTCCCACCTTTAGACTCCATCAGTTCATTACA-----CAGA
JMFF040P16+ ACTACTGCTAGACTTCTTTTTCCCACCTTTAGACTCCATCAGTTCATTACA-----CAGA
JMFF005K17+ ACTACTGCTAGACTTCTTTTTCCCACCTTTAGACTCCATCAGTTCATTACA-----CAGA
JMSF015J07+ ACTCCATCAGTTCATTACA-----CAGA
JMSF017E19+ TCCATCAGTTCATTACA-----CAGA
JMSF008A16+ TTAGACTCCATCAGTTCATTACA-----CAGA
                      ____________________________________________________________
consensus ACTACTGCTAGACTTCTTTTTCCCACCTTTAGACTCCATCAGTTCATTACA-----CAGA
 
. : . : . : . : . : . :
JMSF045C12+ TCAATATGGAATATGAAACTTGTAACGATCAACTGTCGTTTAATCCTCCTCTATCAAAGC
JMSF045N14+ TCAATATGGAATATGAAACTTGTAACGATCAACTGTCGTTTAATCCTCCTCTATCAAAGC
JMSF032J09+ TCAATATGGAATATGAAACTTGTAACGATCAACTGTCGTTTAATCCTCCTCTATCAAAGC
JMSF032B24+ TCAATATGGAATATGAAACTTGTAACGATCAACTGTCGTTTAATCCTCCTCTATCAAAGC
JMSF035L10+ TCAATATGGAATATGAAACTTGTAACGATCAACTGTCGTTTAATCCTCCTCTATCAAAGC
JMSF024H19+ TCAATATGGAATATGAAACTTGTAACGATCAACTGTCGTTTAATCCTCCTCTATCAAAGC
JMSF050E12+ TCAATATGGAATATGAAACTTGTAACGATCAACTGTCGTTTAATCCTCCTCTATCAAAGC
JMFF037M04+ TCAATATGGAATATGAAACTTGTAACGATCAACTGTCGTTTAATCCTCCTCTATCAAAGC
JMFS051G03+ TCAATATGGAATATGAAACTTGTAACGATCAACTGTCGTTTAATCCTCCTCTATCAAAGC
JMFS098H01+ TCAATATGGAATATGAAACTTGTAACGATCAACTGTCGTTTAATCCTCCTCTATCAAAGC
JMFS075H01+ TCAATATGGAATATGAAACTTGTAACGATCAACTGTCGTTTAATCCTCCTCTATCAAAGC
JMFS076B03+ TCAATATGGAATATGAAACTTGTAACGATCAACTGTCGTTTAATCCTCCTCTATCAAAGC
JMFF041C04+ TCAATATGGAATATGAAACTTGTAACGATCAACTGTCGTTTAATCCTCCTCTATCAAAGC
JMFF016K04+ TCAATATGGAATATGAAACTTGTAACGATCAACTGTCGTTTAATCCTCCTCTATCAAAGC
JMFF038E23+ TCAATATGGAATATGAAACTTGTAACGATCAACTGTCGTTTAATCCTCCTCTATCAAAGC
JMFF007F17+ TCAATATGGAATATGAAACTTGTAACGATCAACTGTCGTTTAATCCTCCTCTATCAAAGC
JMFF044M03+ TCAATATGGAATATGAAACTTGTAACGATCAACTGTCGTTTAATCCTCCTCTATCAAAGC
JMFF013K04+ TCAATATGGAATATGAAACTTGTAACGATCAACTGTCGTTTAATCCTCCTCTATCAAAGC
JMFF008K11+ TCAATATGGAATATGAAACTTGTAACGATCAACTGTCGTTTAATCCTCCTCTATCAAAGC
JMFF047P12+ TCAATATGGAATATGAAACTTGTAACGATCAACTGTCGTTTAATCCTCCTCTATCAAAGC
JMFF018L18+ TCAATATGGAATATGAAACTTGTAACGATCAACTGTCGTTTAATCCTCCTCTATCAAAGC
JMFF038H05+ TCAATATGGAATATGAAACTTGTAACGATCAACTGTCGTTTAATCCTCCTCTATCAAAGC
JMFF020E21+ TCAATATGGAATATGAAACTTGTAACGATCAACTGTCGTTTAATCCTCCTCTATCAAAGC
JMFF034N04+ TCAATATGGAATATGAAACTTGTAACGATCAACTGTCGTTTAATCCTCCTCTATCAAAGC
JMFF032P21+ TCAATATGGAATATGAAACTTGTAACGATCAACTGTCGTTTAATCCTCCTCTATCAAAGC
JMFF028C05+ TCAATATGGAATATGAAACTTGTAACGATCAACTGTCGTTTAATCCTCCTCTATCAAAGC
JMFS002C05+ TCAATATGGAATATGAAACTTGTAACGATCAACTGTCGTTTAATCCTCCTCTATCAAAGC
JMFF022I03+ TCAATATGGAATATGAAACTTGTAACGATCAACTGTCGTTTAATCCTCCTCTATCAAAGC
JMFF001K14+ TCAATATGGAATATGAAACTTGTAACGATCAACTGTCGTTTAATCCTCCTCTATCAAAGC
JMFF036A04+ TCAATATGGAATATGAAACTTGTAACGATCAACTGTCGTTTAATCCTCCTCTATCAAAGC
JMFF031E15+ TCAATATGGAATATGAAACTTGTAACGATCAACTGTCGTTTAATCCTCCTCTATCAAAGC
JMFF014G05+ TCAATATGGAATATGAAACTTGTAACGATCAACTGTCGTTTAATCCTCCTCTATCAAGGC
JMFF028M07+ TCAATATGGAATATGAAACTTGTAACGATCAACTGTCGTTTAATCCTCCTCTATCAAAGC
JMFF033K01+ TCAATATGGAATATGAAACTTGTAACGATCAACTGTCGTTTAATCCTCCTCTATCAAAGC
JMFF004H09+ TCAATATGGAATATGAAACTTGTAACGATCAACTGTCGTTTAATCCTCCTCTATCAAAGC
JMFF002F07+ TCAATATGGAATATGAAACTTGTAACGATCAACTGTCGTTTAATCCTCCTCTATCAAAGC
JMFF015K19+ TCAATATGGAATATGAAACTTGTAACGATCAACTGTCGTTTAATCCTCCTCTATCAAAGC
JMFF019H23+ TCAATATGGAATATGAAACTTGTAACGATCAACTGTCGTTTAATCCTCCTCTATCAAAGC
JMFF018O13+ TCAATATGGAATATGAAACTTGTAACGATCAACTGTCGTTTAATCCTCCTCTATCAAAGC
JMFF012F14+ TCAATATGGAATATGAAACTTGTAACGATCAACTGTCGTTTAATCCTCCTCTATCAAAGC
JMFF001M19+ TCAATATGGAATATGAAACTTGTAACGATCAACTGTCGTTTAATCCTCCTCTATCAAAGC
JMFF040M15+ TCAATATGGAATATGAAACTTGTAACGATCAACTGTCGTTTAATCCTCCTCTATCAAAGC
JMFF038F03+ TCAATATGGAATATGAAACTTGTAACGATCAACTGTCGTTTAATCCTCCTCTATCAAAGC
JMFF002C05+ TCAATATGGAATATGAAACTTGTAACGATCAACTGTCGTTTAATCCTCCTCTATCAAAGC
JMFF035P13+ TCAATATGGAATATGAAACTTGTAACGATCAACTGTCGTTTAATCCTCCTCTATCAAAGC
JMSF024D02+ TCAATATGGAATATGAAACTTGTAACGATCAACTGTCGTTTAATCCTCCTCTATCAAAGC
JMFF023F17+ TCAATATGGAATATGAAACTTGTAACGATCAACTGTCGTTTAATCCTCCTCTATCAAAGC
JMFF007E07+ TCAATATGGAATATGAAACTTGTAACGATCAACTGTCGTTTAATCCTCCTCTATCAAAGC
JMFF049C08+ TCAATATGGAATATGAAACTTGTAACGATCAACTGTCGTTTAATCCTCCTCTATCAAAGC
JMSF050D12+ TCAATATGGAATATGAAACTTGTAACGATCAACNGTCGTTTAATCCTCCTCTATCAAAGC
JMSF019L05+ TCAATATGGAATATGAAACTTGTAACGATCAACTGTCGTTTAATCCTCCTCTATCAAAGC
JMFF045B18+ TCAATATGGAATATGAAACTTGTAACGATCAACTGTCGTTTAATCCTCCTCTATCAAAGC
JMFF020J13+ TCAATATGGAATATGAAACTTGTAACGATCAACTGTCGTTTAATCCTCCTCTATCAAAGC
JMFF046E15+ TCAATATGGAATATGAAACTTGTAACGATCAACTGTCGTTTAATCCTCCTCTATCAAAGC
JMFF003K21+ CGTTTAATCCTCCTCTATCAAAGC
JMFF050G14+ TCAATATGGAATATGAAACTTGTAACGATCAACTGTCGTTTAATCCTCCTCTATCAAAGC
JMFF039E24+ TCAATATGGAATATGAAACTTGTAACGATCAACTGTCGTTTAATCCTCCTCTATCAAAGC
JMFF033B02+ TCAATATGGAATATGAAACTTGTAACGATCAACTGTCGTTTAATCCTCCTCTATCAAAGC
JMFF024N03+ TCAATATGGAATATGAAACTTGTAACGATCAACTGTCGTTTAATCCTCCTCTATCAAAGC
JMFF020D24+ TCAATATGGAATATGAAACTTGTAACGATCAACTGTCGTTTAATCCTCCTCTATCAAAGC
JMFF023F22+ TCAATATGGAATATGAAACTTGTAACGATCAACTGTCGTTTAATCCTCCTCTATCAAAGC
JMFF050E04+ TCAATATGGAATATGAAACTTGTAACGATCAACTGTCGTTTAATCCTCCTCTATCAAAGC
JMFF022G08+ TCAATATGGAATATGAAACTTGTAACGATCAACTGTCGTTTAATCCTCCTCTATCAAAGC
JMFF049C23+ TCAATATGGAATATGAAACTTGTAACGATCAACTGTCGTTTAATCCTCCTCTATCAAAGC
JMFF013C19+ TCAATATGGAATATGAAACTTGTAACGATCAACTGTCGTTTAATCCTCCTCTATCAAAGC
JMFF024G10+ TCAATATGGAATATGAAACTTGTAACGATCAACTGTCGTTTAATCCTCCTCTATCAAAGC
JMFF040P16+ TCAATATGGAATATGAAACTTGTAACGATCAACTGTCGTTTAATCCTCCTCTATCAAAGC
JMFF005K17+ TCAATATGGAATATGAAACTTGTAACGATCAACTGTCGTTTAATCCTCCTCTATCAAAGC
JMSF015J07+ TCAATATGGAATATGAAACTTGTAACGATCAACTGTCGTTTAATCCTCCTCTATCAAAGC
JMSF017E19+ TCAATATGGAATATGAAACNTGTAACGATCAACTGTCGTTTAATCCTCCTCTATCAAAGC
JMSF008A16+ TCAATATGGAATATGAAACTTGTAACGATCAACTGTCGTTTAATCCTCCTCTATCAAAGC
                      ____________________________________________________________
consensus TCAATATGGAATATGAAACTTGTAACGATCAACTGTCGTTTAATCCTCCTCTATCAAAGC
 
. : . : . : . : . : . :
JMSF045C12+ CTTCGAGCAATCAAAACGTCTTCCTGGCTTCCTGCTCCGTATGTAAAGCGGCCGAACGAG
JMSF045N14+ CTTCGAGCAATCAAAACGTCTTCCTGGCTTCCTGCTCCGTATGTAAAGCGGCCGAACGAG
JMSF032J09+ CTTCGAGCAATCAAAACGTCTTCCTGGCTTCCTGCTCCGTATGTAAAGCGGCCGAACGAG
JMSF032B24+ CTTCGAGCAATCAAAACGTCTTCCTGGCTTCCTGCTCCGTATGTAAAGCGGCCGAACGAG
JMSF035L10+ CTTCGAGCAATCAAAACGTCTTCCTGGCTTCCTGCTCCGTATGTAAAGCGGCCGAACGAG
JMSF024H19+ CTTCGAGCAATCAAAACGTCTTCCTGGCTTCCTGCTCCGTATGTAAAGCGGCCGAACGAG
JMSF050E12+ CTTCGAGCAATCAAAACGTCTTCCTGGCTTCCTGCTCCGTATGTAAAGCGGCCGAACGAG
JMFF037M04+ CTTCGAGCAATCAAAACGTCTTCCTGGCTTCCTGCTCCGTATGTAAAGCGGCCGAACGAG
JMFS051G03+ CTTCGAGCAATCAAAACGTCTTCCTGGCTTCCTGCTCCGTATGTAAAGCGGCCGAACGAG
JMFS098H01+ CTTCGAGCAATCAAAACGTCTTCCTGGCTTCCTGCTCCGTATGTAAAGCGGCCGAACGAG
JMFS075H01+ CTTCGAGCAATCAAAACGTCTTCCTGGCTTCCTGCTCCGTATGTAAAGCGGCCGAACGAG
JMFS076B03+ CTTCGAGCAATCAAAACGTCTTCCTGGCTTCCTGCTCCGTATGTAAAGCGGCCGAACGAG
JMFF041C04+ CTTCGAGCAATCAAAACGTCTTCCTGGCTTCCTGCTCCGTATGTAAAGCGGCCGAACGAG
JMFF016K04+ CTTCGAGCAATCAAAACGTCTTCCTGGCTTCCTGCTCCGTATGTAAAGCGGCCGAACGAG
JMFF038E23+ CTTCGAGCAATCAAAACGTCTTCCTGGCTTCCTGCTTCGTATGTAAAGCGGCCGAACGAG
JMFF007F17+ CTTCGAGCAATCAAAACGTCTTCCTGGCTTCCTGCTTCGTATGTAAAGCGGCCGAACGAG
JMFF044M03+ CTTCGAGCAATCAAAACGTCTTCCTGGCTTCCTGCTCCGTATGTAAAGCGGCCGAACGAG
JMFF013K04+ ----------------CGTCTTCCTGGCTTCCTGCTCCGTATGTAAAGCGGCCGAACGAG
JMFF008K11+ CTTCGAGCAATCAAAACGTCTTCCTGGCTTCCTGCTCCGTATGTAAAGCGGCCGAACGAG
JMFF047P12+ CTTCGAGCAATCAAAACGTCTTCCTGGCTTCCTGCTCCGTATGTAAAGCGGCCGAACGAG
JMFF018L18+ CTTCGAGCAATCAAAACGTCTTCCTGGCTTCCTGCTCCGTATGTAAAGCGGCCGAACGAG
JMFF038H05+ CTTCGAGCAATCAAAACGTCTTCCTGGCTTCCTGCTCCGTATGTAAAGCGGCCGAACGAG
JMFF020E21+ CTTCGAGCAATCAAAACATCTTCCTGGCTTCCTGCTCCGTATGTAAAGCGGCCGAACGAG
JMFF034N04+ CTTCGAGCAATCAAAACGTCTTCCTGGCTTCCTGCTCCGTATGTAAAGCGGCCGAACGAG
JMFF032P21+ CTTCGAGCAATCAAAACGTCTTCCTGGCTTCCTGCTCCGTATGTAAAGCGGCCGAACGAG
JMFF028C05+ CTTCGAGCAATCAAAACGTCTTCCTGGCTTCCTGCTCCGTATGTAAAGCGGCCGAACGAG
JMFS002C05+ CTTCGAGCAATCAAAACGTCTTCCTGGCTTCCTGCTCCGTATGTAAAGCGGCCGAACGAG
JMFF022I03+ CTTCGAGCAATCAAAACGTCTTCCTGGCTTCCTGCTCCGTATGTAAAGCGGCCGAACGAG
JMFF001K14+ CTTCGAGCAATCAAAACGTCTTCCTGGCTTCCTGCTCCGTATGTAAAGCGGCCGAACGAG
JMFF036A04+ CTTCGAGCAATCAAAACGTCTTCCTGGCTTCCTGCTCCGTATGTAAAGCGGCCGAACGAG
JMFF031E15+ CTTCGAGCAATCAAAACGTCTTCCTGGCTTCCTGCTCCGTATGTAAAGCGGCCGAACGAG
JMFF014G05+ CTTCGAGCAATCAAAACGTCTTCCTGGCTTCCTGCTCCGTATGTAAAGCGGCCGAACGAG
JMFF028M07+ CTTCGAGCAATCAAAACGTCTTCCTGGCTTCCTGCTCCGTATGTAAAGCGGCCGAACGAG
JMFF033K01+ CTTCGAGCAATCAAAACGTCTTCCTGGCTTCCTGCTCCGTATGTAAAGCGGCCGAACGAG
JMFF004H09+ CTTCGAGCAATCAAAACGTCTTCCTGGCTTCCTGCTCCGTATGTAAAGCGGCCGAACGAG
JMFF002F07+ CTTCGAGCAATCAAAACGTCTTCCTGGCTTCCTGCTCCGTATGTAAAGCGGCCGAACGAG
JMFF015K19+ CTTCGAGCAATCAAAACGTCTTCCTGGCTTCCTGCTCCGTATGTAAAGCGGCCGAACGAG
JMFF019H23+ CTTCGAGCAATCAAAACGTCTTCCTGGCTTCCTGCTCCGTATGTAAAGCGGCCGAACGAG
JMFF018O13+ CTTCGAGCAATCAAAACGTCTTCCTGGCTTCCTGCTCCGTATGTAAAGCGGCCGAACGAG
JMFF012F14+ CTTCGAGCAATCAAAACGTCTTCCTGGCTTCCTGCTCCGTATGTAAAGCGGCCGAACGAG
JMFF001M19+ CTTCGAGCAATCAAAACGTCTTCCTGGCTTCCTGCTCCGTATGTAAAGCGGCCGAACGAG
JMFF040M15+ CTTCGAGCAATCAAAACGTCTTCCTGGCTTCCTGCTCCGTATGTAAAGCGGCCGAACGAG
JMFF038F03+ CTTCGAGCAATCAAAACGTCTTCCTGGCTTCCTGCTCCGTATGTAAAGCGGCCGAACGAG
JMFF002C05+ CTTCGAGCAATCAAAACGTCTTCCTGGCTTCCTGCTCCGTATGTAAAGCGGCCGAACGAG
JMFF035P13+ CTTCGAGCAATCAAAACGTCTTCCTGGCTTCCTGCTCCGTATGTAAAGCGGCCGAACGAG
JMSF024D02+ CTTCGAGCAATCAAAACGTCTTCCTGGCTTCCTGCTCCGTATGTAAAGCGGCCGAACGAG
JMFF023F17+ CTTCGAGCAATCAAAACGTCTTCCTGGCTTCCTGCTCCGTATGTAAAGCGGCCGAACGAG
JMFF007E07+ CTTCGAGCAATCAAAACGTCTTCCTGGCTTCCTGCTCCGTATGTAAAGCGGCCGAACGAG
JMFF049C08+ CTTCGAGCAATCAAAACGTCTTCCTGGCTTCCTGCTCCGTATGTAAAGCGGCCGAACGAG
JMSF050D12+ CTTCGAGCAATCAAAACGTCTTCCTGGCTTCNTGCTCCGTATGTAAAGCGGCCGAACGAG
JMSF019L05+ CTTCGAGCAATCAAAACGTCTTCCTGGCTTCCTGCTCCGTATGTAAAGCGGCCGAACGAG
JMFF045B18+ CTTCGAGCAATCAAAACGTCTTCCTGGCTTCCTGCTCCGTATGTAAAGCGGCCGAACGAG
JMFF020J13+ CTTCGAGCAATCAAAACGTCTTCCTGGCTTCCTGCTCCGTATGTAAAGCGGCCGAACGAG
JMFF046E15+ CTTCGAGCAATCAAAACGTCTTCCTGGCTTCCTGCTCCGTATGTAAAGCGGCCGAACGAG
JMFF003K21+ CTTCGAGCAATCAAAACGTCTTCCTGGCTTCCTGCTCCGTATGTAAAGCGGCCGAACGAG
JMFF050G14+ CTTCGAGCAATCAAAACGTCTTCCTGGCTTCCTGCTCCGTATGTAAAGCGGCCGAACGAG
JMFF039E24+ CTTCGAGCAATCAAAACGTCTTCCTGGCTTCCTGCTCCGTATGTAAAGCGGCCGAACGAG
JMFF033B02+ CTTCGAGCAATCAAAACGTCTTCCTGGCTTCCTGCTCCGTATGTAAAGCGGCCGAACGAG
JMFF024N03+ CTTCGAGCAATCAAAACGTCTTCCTGGCTTCCTGCTCCGTATGTAAAGCGGCCGAACGAG
JMFF020D24+ CTTCGAGCAATCAAAACGTCTTCCTGGCTTCCTGCTCCGTATGTAAAGCGGCCGAACGAG
JMFF023F22+ CTTCGAGCAATCAAAACGTCTTCCTGGCTTCCTGCTCCGTATGTAAAGCGGCCGAACGAG
JMFF050E04+ CTTCGAGCAATCAAAACGTCTTCCTGGCTTCCTGCTCCGTATGTAAAGCGGCCGAACGAG
JMFF022G08+ CTTCGAGCAATCAAAACGTCTTCCTGGCTTCCTGCTCCGTATGTAAAGCGGCCGAACGAG
JMFF049C23+ CTTCGAGCAATCAAAACGTCTTCCTGGCTTCCTGCTCCGTATGTAAAGCGGCCGAACGAG
JMFF013C19+ CTTCGAGCAATCAAAACGTCTTCCTGGCTTCCTGCTCCGTATGTAAAGCGGCCGAACGAG
JMFF024G10+ CTTCGAGCAATCAAAACGTCTTCCTGGCTTCCTGCTCCGTATGTAAAGCGGCCGAACGAG
JMFF040P16+ CTTCGAGCAATCAAAACGTCTTCCTGGCTTCCTGCTCCGTATGTAAAGCGGCCGAACGAG
JMFF024H12+ CTCCGTATGTAAAGCGGCCGAACGAG
JMFF005K17+ CTTCGAGCAATCAAAACGTCTTCCTGGCTTCCTGCTCCGTATGTAAAGCGGCCGAACGAG
JMSF015J07+ CTTCGAGCAATCAAAACGTCTTCCTGGCTTCCTGCTCCGTATGTAAAGCGGCCGAACGAG
JMSF017E19+ CTTCGAGCAATCAAAACGTCTTCCTGGCTTCCTGCTCCGTATGTAAAGCGGCCGAACGAG
JMSF008A16+ CTTCGAGCAATCAAAGCGTCTTCCTGGCTTCCTGCTCCGTATGTAAAGCGGCCGAACGAG
                      ____________________________________________________________
consensus CTTCGAGCAATCAAAACGTCTTCCTGGCTTCCTGCTCCGTATGTAAAGCGGCCGAACGAG
 
. : . : . : . : . : . :
JMSF045C12+ ATCGTAACCCTAGCAGCGGAACTTTCTCGACGGCGGAATAAGCGGTTAGAGAAAGGGAGG
JMSF045N14+ ATCGTAACCCTAGCAGCGGAACTTTCTCGACGGCGGAATAAGCGGTTAGAGAAAGGGAGG
JMSF032J09+ ATCGTAACCCTAGCAGCGGAACTTTCTCGACGGCGGAATAAGCGGTTAGAGAAAGGGAGG
JMSF032B24+ ATCGTAACCCTAGCAGCGGAACTTTCTCGACGGCGGAATAAGCGGTTAGAGAAAGGGAGG
JMSF035L10+ ATCGTAACCCTAGCAGCGGAACTTTCTCGACGGCGGAATAAGCGGTTAGAGAAAGGGAGG
JMSF024H19+ ATCGTAACCCTAGCAGCGGAACTTTCTCGACGGCGGAATAAGCGGTTAGAGAAAGGGAGG
JMSF050E12+ ATCGTAACCCTAGCAGCGGAACTTTCTCGACGGCGGAATAAGCGGTTAGAGAAAGGGAGG
JMFF037M04+ ATCGTAACCCTAGCAGCGGAACTTTCTCGACGGCGGAATAAGCGGTTAGAGAAAGGGAGG
JMFS051G03+ ATCGTAACCCTAGCAGCGGAACTTTCTCGACGGCGGAATAAGCGGTTAGAGAAAGGGAGG
JMFS098H01+ ATCGTAACCCTAGCAGCGGAACTTTCTCGACGGCGGAATAAGCGGTTAGAGAAAGGGAGG
JMFS075H01+ ATCGTAACCCTAGCAGCGGAACTTTCTCGACGGCGGAATAAGCGGTTAGAGAAAGGGAGG
JMFS076B03+ ATCGTAACCCTAGCAGCGGAACTTTCTCGACGGCGGAATAAGCGGTTAGAGAAAGGGAGG
JMFF041C04+ ATCGTAACCCTAGCAGCGGAACTTTCTCGACGGCGGAATAAGCGGTTAGAGAAAGGGAGG
JMFF016K04+ ATCGTAACCCTAGCAGCGGAACTTTCTCGACGGCGGAATAAGCGGTTAGAGAAAGGGAGG
JMFF038E23+ ATCGTAACCCTAGCAGCGGAACTTTCTCGACGGCGGAATAAGCGGTTAGAGAAAGGGAGG
JMFF007F17+ ATCGTAACCCTAGCAGCGGAACTTTCTCGACGGCGGAATAAGCGGTTAGAGAAAGGGAGG
JMFF044M03+ ATCGTAACCCTAGCAGCGGAACTTTCTCGACGGCGGAATAAGCGGTTAGAGAAAGGGAGG
JMFF013K04+ ATCGTAACCCTAGCAGCGGAACTTTCTCGACGGCGGAATAAGCGGTTAGAGAAAGGGAGG
JMFF008K11+ ATCGTAACCCTAGCAGCGGAACTTTCTCGACGGCGGAATAAGCGGTTAGAGAAAGGGAGG
JMFF047P12+ ATCGTAACCCTAGCAGCGGAACTTTCTCGACGGCGGAATAAGCGGTTAGAGAAAGGGAGG
JMFF018L18+ ATCGTAACCCTAGCAGCGGAACTTTCTCGACGGCGGAATAAGCGGTTAGAGAAAGGGAGG
JMFF038H05+ ATCGTAACCCTAGCAGCGGAACTTTCTCGACGGCGGAATAAGGGGTTAGAGAAAGGGAGG
JMFF020E21+ ATCGTAACCCTAGCAGCGGAACTTTCTCGACGGCGGAATAAGCGGTTAGAGAAAGGGAGG
JMFF034N04+ ATCGTAACCCTAGCAGCGGAACTTTCTCGACGGCGGAATAAGCGGTTAGAGAAAGGGAGG
JMFF032P21+ ATCGTAACCCTAGCAGCGGAACTTTCTCGACGGCGGAATAAGCGGTTAGAGAAAGGGAGG
JMFF028C05+ ATCGTAACCCTAGCAGCGGAACTTTCTCGACGGCGGAATAAGCGGTTAGAGAAAGGGAGG
JMFS002C05+ ATCGTAACCCTAGCAGCGGAACTTTCTCGACGGCGGAATAAGCGGTTAGAGAAAGGGAGG
JMFF022I03+ ATCGTAACCCTAGCAGCGGAACTTTCTCGACGGCGGAATAAGCGGTTAGAGAAAGGGAGG
JMFF001K14+ ATCGTAACCCTAGCAGCGGAACTTTCTCGACGGCGGAATAAGCGGTTAGAGAAAGGGAGG
JMFF036A04+ ATCGTAACCCTAGCAGCGGAACTTTCTCGACGGCGGAATAAGCGGTTAGAGAAAGGGAGG
JMFF031E15+ ATCGTAACCCTAGCAGCGGAACTTTCTCGACGGCGGAATAAGCGGTTAGAGAAAGGGAGG
JMFF014G05+ ATCGTAACCCTAGCAGCGGAACTTTCTCGACGGCGGAATAAGCGGTTAGAGAAAGGGAGG
JMFF028M07+ ATCGTAACCCTAGCAGCGGAACTTTCTCGACGGCGGAATAAGCGGTTAGAGAAAGGGAGG
JMFF033K01+ ATCGTAACCCTAGCAGCGGAACTTTCTCGACGGCGGAATAAGCGGTTAGAGAAAGGGAGG
JMFF004H09+ ATCGTAACCCTAGCAGCGGAACTTTCTCGACGGCGGAATAAGCGGTTAGAGAAAGGGAGG
JMFF002F07+ ATCGTAACCCTAGCAGCGGAACTTTCTCGACGGCGGAATAAGCGGTTAGAGAAAGGGAGG
JMFF015K19+ ATCGTAACCCTAGCAGCGGAACTTTCTCGACGGCGGAATAAGCGGTTAGAGAAAGGGAGG
JMFF019H23+ ATCGTAACCCTAGCAGCGGAACTTTCTCGACGGCGGAATAAGCGGTTAGAGAAAGGGAGG
JMFF018O13+ ATCGTAACCCTAGCAGCGGAACTTTCTCGACGGCGGAATAAGCGGTTAGAGAAAGGGAGG
JMFF012F14+ ATCGTAACCCTAGCAGCGGAACTTTCTCGACGGCGGAATAAGCGGTTAGAGAAAGGGAGG
JMFF001M19+ ATCGTAACCCTAGCAGCGGAACTTTCTCGACGGCGGAATAAGCGGTTAGAGAAAGGGAGG
JMFF040M15+ ATCGTAACCCTAGCAGCGGAACTTTCTCGACGGCGGAATAAGCGGTTAGAGAAAGGGAGG
JMFF038F03+ ATCGTAACCCTAGCAGCGGAACTTTCTCGACGGCGGAATAAGCGGTTAGAGAAAGGGAGG
JMFF002C05+ ATCGTAACCCTAGCAGCGGAACTTTCTCGACGGCGGAATAAGCGGTTAGAGAAAGGGAGG
JMFF035P13+ ATCGTAACCCTAGCAGCGGAACTTTCTCGACGGCGGAATAAGCGGTTAGAGAAAGGGAGG
JMSF024D02+ ATCGTAACCCTAGCAGCGGAACTTTCTCGACGGCGGAATAAGCGGTTAGAGAAAGGGAGG
JMFF023F17+ ATCGTAACCCTAGCAGCGGAACTTTCTCGACGGCGGAATAAGCGGTTAGAGAAAGGGAGG
JMFF007E07+ ATCGTAACCCTAGCAGCGGAACTTTCTCGACGGCGGAATAAGCGGTTAGAGAAAGGGAGG
JMFF049C08+ ATCGTAACCCTAGCAGCGGAACTTTCTCGACGGCGGAATAAGCGGTTAGAGAAAGGGAGG
JMSF050D12+ ATCGTAACCCTAGCAGCGGAACTTTCTCGNCGGCGGAATAAGCGGTTAGAGAAAGGGAGG
JMSF019L05+ ATCGTAACCCTAGCAGCGGAACTTTCTCGACGGCGGAATAAGCGGTTAGAGAAAGGGAGG
JMFF045B18+ ATCGTAACCCTAGCAGCGGAACTTTCTCGACGGCGGAATAAGCGGTTAGAGAAAGGGAGG
JMFF020J13+ ATCGTAACCCTAGCAGCGGAACTTTCTCGACGGCGGAATAAGCGGTTAGAGAAAGGGAGG
JMFF046E15+ ATCGTAACCCTAGCAGCGGAACTTTCTCGACGGCGGAATAAGCGGTTAGAGAAAGGGAGG
JMFF003K21+ ATCGTAACCCTAGCAGCGGAACTTTCTCGACGGCGGAATAAGCGGTTAGAGAAAGGGAGG
JMFF050G14+ ATCGTAACCCTAGCAGCGGAACTTTCTCGACGGCGGAATAAGCGGTTAGAGAAAGGGAGG
JMFF039E24+ ATCGTAACCCTAGCAGCGGAACTTTCTCGACGGCGGAATAAGCGGTTAGAGAAAGGGAGG
JMFF033B02+ ATCGTAACCCTAGCAGCGGAACTTTCTCGACGGCGGAATAAGCGGTTAGAGAAAGGGAGG
JMFF024N03+ ATCGTAACCCTAGCAGCGGAACTTTCTCGACGGCGGAATAAGCGGTTAGAGAAAGGGAGG
JMFF020D24+ ATCGTAACCCTAGCAGCGGAACTTTCTCGACGGCGGAATAAGCGGTTAGAGAAAGGGAGG
JMFF023F22+ ATCGTAACCCTAGCAGCGGAACTTTCTCGACGGCGGAATAAGCGGTTAGAGAAAGGGAGG
JMFF050E04+ ATCGTAACCCTAGCAGCGGAACTTTCTCGACGGCGGAATAAGCGGTTAGAGAAAGGGAGG
JMFF022G08+ ATCGTAACCCTAGCAGCGGAACTTTCTCGACGGCGGAATAAGCGGTTAGAGAAAGGGAGG
JMFF049C23+ ATCGTAACCCTAGCAGCGGAACTTTCTCGACGGCGGAATAAGCGGTTAGAGAAAGGGAGG
JMFF013C19+ ATCGTAACCCTAGCAGCGGAACTTTCTCGACGGCGGAATAAGCGGTTAGAGAAAGGGAGG
JMFF024G10+ ATCGTAACCCTAGCAGCGGAACTTTCTCGACGGCGGAATAAGCGGTTAGAGAAAGGGAGG
JMFF040P16+ ATCGTAACCCTAGCAGCGGAACTTTCTCGACGGCGGAATAAGCGGTTAGAGAAAGGGAGG
JMFF024H12+ ATCGTAACCCTAGCAGCGGAACTTTCTCGACGGCGGAATAAGCGGTTAGAGAAAGGGAGG
JMFF005K17+ ATCGTAACCCTAGCAGCGGAACTTTCTCGACGGCGGAATAAGCGGTTAGAGAAAGGGAGG
JMSF015J07+ ATCGTAACCCTAGCAGCGGAACTTTCTCGACGGCGGAATAAGCGGTTAGAGAAAGGGAGG
JMSF017E19+ ATCGTAACCCTAGCAGCGGAACTTTCTCGACGGCGGAATAAGCGGTTAGAGAAAGGGAGG
JMSF008A16+ ATCGTAACCCTAGCAGCGGAACTTTCTCGACGGCGGAATAAGCGGTTAGAGAAAGGGAGG
                      ____________________________________________________________
consensus ATCGTAACCCTAGCAGCGGAACTTTCTCGACGGCGGAATAAGCGGTTAGAGAAAGGGAGG
 
. : . : . : . : . : . :
JMSF045C12+ GAAATTTTCTAGAAAAGGAATAGCTTCTCAGAGGTTCACGAG-ACGTGAATGAG
JMSF045N14+ GAAATTTTCTAGAAAAGGAATAGCTTCTCAGAGGTTCACGAG-ACGTGAATGAGC
JMSF032J09+ GAAATTTTCTAGAAAAGGAATAGCTTCTCAGAGGTTCACGAG-ACGTGAATGAGCC
JMSF032B24+ GAAATTTTCTAGAAAAGGAATAGCTTCTCAGAGGTTCACGAG-ACGTGAATGAGCC
JMSF035L10+ GAAATTTTCTAGAAAAGGAATAGCTTCTCAGAGGTTCACGAG-ACGTGAATGAGCC
JMSF024H19+ GAAATTTTCTAGAAAAGGAATAGCTTCTCAGAGGTTCACGAG-ACGTGAATGAGCC
JMSF050E12+ GAAATTTTCTAGAAAAGGAATAGCTTCTCAGAGGTTCACGAG-ACGTGAATGAGCC
JMFF037M04+ GAAATTTTCTAGAAAAGGAATAGCTTCTCAGAGGTTCACGAG-ACGTGAAT
JMFS051G03+ GAAATTTTCTAGAAAAGGAATAGCTTCTCAGAGGTTCAC
JMFS098H01+ GAAATTTTCTAGAAAAGGAATAGCTTCTCAGAGGTTCACGAG-A
JMFS075H01+ GAAATTTTCTAGAAAAGGAATAGCTTCTCAGAGGTTCA
JMFS076B03+ GAAATTTTCTAGAAAAGGAATAGCTTC
JMFF041C04+ GAAATTTTCTAGAAAAGGAATAGCTTCTCAGAGGTTCACGAG-ACGTGAAT
JMFF016K04+ GAAATTTTCTAGAAAAGGAATAGCTCCTCAGAGGTTCACGAG-ACGTGAATGAGC
JMFF038E23+ GAAATTTTCTAGAAAAGGAATAGCTTCTCAGAGGTTCACGAG-AC
JMFF007F17+ GAAATTTTCTAGAAAAGGAATAGCTTCTCAGAGGTTCACGAG-AC
JMFF044M03+ GAAATTTTCTAGAAAAGGAATAGCTTCTCAGAGGTTCACGAG-ACGTGAATGA
JMFF013K04+ GAAATTTTCTAGAAAAGGAATAGCTTCTCAGAGGTTCACGAG-ACGTGAATGAGC
JMFF008K11+ GAAATTTTCTAGAAAAGGAATAGCTTCTCAGAGGTTCACGAG-ACGTGAATGAGC
JMFF047P12+ GAAATTTTCTAGAAAAGGAATAGCTTCTCAGAGGTTCACGAG-ACGT
JMFF018L18+ GAAATTTTCTAGAAAAGGAATAGCTTCTCAGAGGTTCACGAG-ACGTGAATGAGC
JMFF038H05+ GAAATTTTCTAGAAAAGGAATAGCTTCTCAGAGGTTCACGAG-ACGTGAATGAGC
JMFF020E21+ GAAATTTTCTAGAAAAGGAATAGCTTCTCAGAGGTTCACGAG-ACGTGAATGAGC
JMFF034N04+ GAAATTTTCTAGAAAAGGAATAGCTTCTCAGAGGTTCACGAG-ACGTGAATGAGC
JMFF032P21+ GAAATTTTCTAGAAAAGGAATAGCTTCTCAGAGGTTCACGAG-ACGTGAATGAGC
JMFF028C05+ GAAATTTTCTAGAAAAGGAATAGCTTCTCAGAGGTTCACGAG-ACGT
JMFS002C05+ GAAATTTTCTAGAAAAGGAATAGCTTCTCAGAGGTTCACG
JMFF022I03+ GAAATTTTCTAGAAAAGGAATAGCTTCTCAGAGGTTCACGAG-ACGTGAAT
JMFF001K14+ GAAATTTTCTAGAAAAGGAATAGCTTCTCAGAGGTTCACGAG-ACGTGAAT
JMFF036A04+ GAAATTTTCTAGAAAAGGAATAGCTTCTCAGAGGTTCACGAG-ACGT
JMFF031E15+ GAAATTTTCTAGAAAAGGAATAGCTTCTCAGAGGTTCACGAG-ACGTGAATGAGC
JMFF014G05+ GAAATTTTCTAGAAAAGGAATAGCTTCTCAGAGGTTCACGAG-ACGTGAATGAGC
JMFF028M07+ GAAATTTTCTAGAAAAGGAATAGCTTCTCAGAGGTTCACGAG-ACGTGAATGAGC
JMFF033K01+ GAAATTTTCTAGAAAAGGAATAGCTTCTCAGAGGTTCACGAG-ACGTGAAT
JMFF004H09+ GAAATTTTCTAGAAAAGGAATAGCTTCTCAGAGGTTCACGAG-ACGTGAATGAGC
JMFF002F07+ GAAATTTTCTAGAAAAGGAATAGCTTCTCAGAGGTTCACGAG-ACGTGAATGAGC
JMFF015K19+ GAAATTTTCTAGAAAAGGAATAGCTTCTCAGAGGTTCACGAG-ACGTGAATGAGC
JMFF019H23+ GAAATTTTCTAGAAAAGGAATAGCTTCTCAGAGGTTCACGAG-ACGTGAATGA
JMFF018O13+ GAAATTTTCTAGAAAAGGAATAGCTTCTCAGAGGTTCACGAG-ACGTGAATGAGC
JMFF012F14+ GAAATTTTCTAGAAAAGGAATAGCTTCTCAGAGGTTCACGAG-ACGTGAATGAGC
JMFF001M19+ GAAATTTTCTAGAAAAGGAATAGCTTCTCAGAGGTTCACGAG-ACGTGAATGA
JMFF040M15+ GAAATTTTCTAGAAAAGGAATAGCTTCTCAGAGGTTCACGAG-ACGTGAATGAGC
JMFF038F03+ GAAATTTTCTAGAAAAGGAATAGCTTCTCAGAGGTTCACGAG-ACGTGAATGAGC
JMFF002C05+ GAAATTTTCTAGAAAAGGAATAGCTTCTCAGAGGTTCACGAG-ACGTGAATGAGC
JMFF035P13+ GAAATTTTCTAGAAAAGGAATAGCTTCTCAGGGGTTCACGAG-ACGTGAAT
JMSF024D02+ GAAATTTTCTAGAAAAGGAATAGCTTCTCAGAGGTTCACGAG-ACGTGAATGAGCC
JMFF023F17+ GAAATTTTCTAGAAAAGGAATAGCTTCTCAGAGGTTCACGAG-ACGTGAATGAGCG
JMFF007E07+ GAAATTTTCTAGAAAAGGAATAGCTTCTCAGAGGTTCACGAG-ACGTGAATGAGCG
JMFF049C08+ GAAATTTTCTAGAAAAGGAATAGCTTCTCAGAGGTTCACGAG-ACGTGAATGAGCGG
JMSF050D12+ GAAATTTTCTAGAAAAGGAATAGCTTCTCAGAGGTTCACGAGAACGTGAATGAGCC
JMSF019L05+ GAAATTTTCTAGAAAAGGAATAGCTTCTCAGAGGTTCACGAG-ACGTGAATGAGCC
JMFF045B18+ GAAATTTTCTAGAAAAGGAATAGCTTCTCAGAGGTTCACGAG-ACGTGAATGAGCGGA
JMFF020J13+ GAAATTTTCTAGAAAAGGAATAGCTTCTCAGAGGTTCACGAG-ACGTGAATGAG
JMFF046E15+ GAAATTTTCTAGAAA
JMFF003K21+ GAAATTTTCTAGAAAAGGAATAGCTTCTCAGAGGTTCACGAG-ACGTGAATGAGCC
JMFF050G14+ GAAATTTTCTAGAAAAGGAATAGCTTCTCAGAGGTTCACGAG-ACGTGAATGAGCGGAT
JMFF039E24+ GAAATTTTCTAGAAAAGGAATAGCTTCTCAGAGGTTCACGAG-ACGTGAATGAGCGGAT
JMFF033B02+ GAAATTTTCTAGAAAAGGAATAGCTTCCCAGAGGTTCACGAG-ACGTGAATGAGCGGAT
JMFF024N03+ GAAATTTTCTAGAAAAGGAATAGCTTCTCAGAGGTTCACGAG-ACGTGAAAGAGCGGA
JMFF020D24+ GAAATTTTCTAGAAAAGGAATAGCTTCTCAGAGGTTCACGAG-ACGTGAATGAGCGGAT
JMFF023F22+ GAAATTTTCTAGAAAAGGAATAGCTTCTCAGAGGTTCACGAG-ACGTGAATGAGCGGAT
JMFF050E04+ GAAATTTTCTAGAAAAGGAATAGCTTCTCAGAGGTTCACGAG-ACGTGAATGAGCGGAT
JMFF022G08+ GAAATTTTCTAGAAAAGGAATAGCTTCTCAGAGGTTCACGAG-ACGTGAATGAGCGGAT
JMFF049C23+ GAAATTTTCTAGAAAAGGAATAGCTTCTCAGAGGTTCACGAG-ACGTGAATGAGCGGAT
JMFF013C19+ GAAATTTTCTAGAAAAGGAATAGCTTCTCAGAGGTTCACGAG-ACGTGAATGAGCGGAT
JMFF024G10+ GAAATTTTCTAGAAAAGGAATAGCTTCTCAGAGGTTCACGAG-ACGTGAATGAGCGGAT
JMFF040P16+ GAAATTTTCTAGAAAAGGAATAGCTTCTCAGAGGTTCACGAG-ACGTGAATGAGCGGAT
JMFF024H12+ GAAATTTTNTAGAAAAGGAATAGCTTCTCAGAGGTTCACGAG-ACGTGAATGAGCGGAT
JMFF005K17+ GAAATTTTCTAGAAAAGGAATAGCTTCTCAGAGGTTCACGAG-ACGTGAATGAGCGGAT
JMSF015J07+ GAAATTTTCTAGAAAAGGAATAGCTTCTCAGAGGTTCACGAG-ACGTGAATGAGCGGAT
JMSF017E19+ GAAATTTTCTAGAAAAGGAATAGCTTCTCAGAGGTTCACGAG-ACGTGAATGAGCGGAT
JMSF008A16+ GAAATTTTCTAGAAAAGGAATAGCTTCTCAGAGGTTCACGAG-ACGTGAATGAGCGGATC
                      ____________________________________________________________
consensus GAAATTTTCTAGAAAAGGAATAGCTTCTCAGAGGTTCACGAG-ACGTGAATGAGCGGATC