Previous Contig 004928:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF044B08Sequence628004928 (4)gb:ATU86081_15573518e-62Arabidopsis thaliana root hair defective 3 (RHD3) gene, complete cds.>gb:AY09298619003804 (18)pir|H96754|H967548e-51probable GTP-binding protein [imported] - Arabidopsis thaliana>gb:AE005173_89484
JMFS051E01Sequence527004928 (4)gb:ATU86081_15573511e-51Arabidopsis thaliana root hair defective 3 (RHD3) gene, complete cds.>gb:AY09298
JMSF007N09Sequence284004928 (4)737003804 (18)gb:ATU86081_15573514e-24Arabidopsis thaliana root hair defective 3 (RHD3) gene, complete cds.>gb:AY09298
JMSF019L01Sequence496004928 (4)gb:ATU86081_15573512e-36Arabidopsis thaliana root hair defective 3 (RHD3) gene, complete cds.>gb:AY09298717003804 (18)gb:ATU86081_15573515e-25Arabidopsis thaliana root hair defective 3 (RHD3) gene, complete cds.>gb:AY09298

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF044B08+ GCCAATATCATGACACCACAT
                      ____________________________________________________________
consensus GCCAATATCATGACACCACAT
 
. : . : . : . : . : . :
JMFF044B08+ GTTTATTAAAACTATATCAGAAACAGCAAGGGCAAACAAGGCACTTTGTTTTTCAAATGC
JMFS051E01+ AGCAAGGGCAAACAAGGCACTTTGTTTTTCAAATGC
                      ____________________________________________________________
consensus GTTTATTAAAACTATATCAGAAACAGCAAGGGCAAACAAGGCACTTTGTTTTTCAAATGC
 
. : . : . : . : . : . :
JMSF019L01+ CCATTACAAGGGTGCA
JMFF044B08+ TGTATCATCCTCTCCTCTCTCTCTTCCATCGGTGCCCTCTAAATCCATTACAAGGGTGCA
JMFS051E01+ TGTATCATCCTCTCCTCTCTTTCTTCCATCGGTGCCCTCTAAATCCATTACAAGGGTGCA
                      ____________________________________________________________
consensus TGTATCATCCTCTCCTCTCTTTCTTCCATCGGTGCCCTCTAAATCCATTACAAGGGTGCA
 
. : . : . : . : . : . :
JMSF019L01+ GGGTTCAATTCCAACACATTGAGCCATCCAAATACCTTTTGTGGTTTGTGTTCTTCCTTC
JMFF044B08+ GGGTTCAATTCCAACACATTGAGCCATCCAAATACCTTTTGTGGTTTGTGTTCTTCCTTC
JMFS051E01+ GGGTTCAATTCCAACACATTGAGCCATCCAAATACCTTTTGTGGTTTGTGTTCTTCCTTC
                      ____________________________________________________________
consensus GGGTTCAATTCCAACACATTGAGCCATCCAAATACCTTTTGTGGTTTGTGTTCTTCCTTC
 
. : . : . : . : . : . :
JMSF019L01+ AAAAGCATCCATCTCTCTAAAGTTTGTATCAAATAGATGATTCAACAGTGTGCTCTTTCC
JMFF044B08+ AAAAGCATCCATCTCTCTAAAGTTTGTATCAAATAGATGATTCAACAGTGTGCTCTTTCC
JMFS051E01+ AAAAGCATCCATCTCTCTAAAGTTTGTATCAAATAGATGATTCAACAGTGTGCTCTTTCC
                      ____________________________________________________________
consensus AAAAGCATCCATCTCTCTAAAGTTTGTATCAAATAGATGATTCAACAGTGTGCTCTTTCC
 
. : . : . : . : . : . :
JMSF019L01+ GCTACTTTGTGGGCCAATAATTGAAACAACAACATATGAACGCCCACAATCTGCCAATTT
JMFF044B08+ GCTACTTTGTGGGCCAATAATTGAAACAACAACATATGAACGCCCACAATCTGCCAATTT
JMFS051E01+ GCTACTTTGTGGGCCAATAATTGAAACAACAACATATGAACGCCCACAATCTGCCAATTT
                      ____________________________________________________________
consensus GCTACTTTGTGGGCCAATAATTGAAACAACAACATATGAACGCCCACAATCTGCCAATTT
 
. : . : . : . : . : . :
JMSF019L01+ AACCTTTGTCATGAAATGTTCAATTCCAGCAACATTGAATGTACCATCCCCATCAATGAG
JMFF044B08+ AACCTTTGTCATGAAATGTTCAATTCCAGCAACATTGAATGTACCATCCCCATCAATGAG
JMFS051E01+ AACCTTTGTCATGAAATGTTCAATTCCAGCAACATTGAATGTACCATCCCCATCAATGAG
JMSF007N09+ TGTTCAATTCCAGCAACATTGAATGTACCATCCCCATCAATGAG
                      ____________________________________________________________
consensus AACCTTTGTCATGAAATGTTCAATTCCAGCAACATTGAATGTACCATCCCCATCAATGAG
 
. : . : . : . : . : . :
JMSF019L01+ TTGAATTGAACAACACTC
JMFF044B08+ TTGAATTGAACAACACTC
JMFS051E01+ TTGAATTGAACAACACTCGCTGGTCATTTTGATATATGGTATCTAGTGTTCTTTCATTTA
JMSF007N09+ TTGAATTGAACAACACTCGCTGGTCATTTCGAAATATGGAAACAAGCGTACACTCCTTGA
                      ____________________________________________________________
consensus TTGAATTGAACAACACTCGCTGGTCATTTTGATATATGGTATCTAGTGTTCTTTCCTTTA
 
. : . : . : . : . : . :
JMFS051E01+ TTCATTGGGCTGTTTCCTCAGACAATGAGAGTAAGAATCGATGAGTCGTTAAGAACATGA
JMSF007N09+ GCCAGAGGGCAGTCTCCACAGACAATGAGAGTAAGAATCGCTGAGTCGCTAAGAACCTGA
                      ____________________________________________________________
consensus TTCATTGGGCTGTTTCCTCAGACAATGAGAGTAAGAATCGCTGAGTCGTTAAGAACCTGA
 
. : . : . : . : . : . :
JMFS051E01+ GTAGGCATTGAGTTAGAGAGGCGAGAGAGATGCGAGAGGGTGAGAGGGTGAGAGGGTGAG
JMSF007N09+ GGCGGCAGAGAGTGAGAGAGGCGAGAGAGATGCGAGAGGGTGAGAGGGTGAGAGGGTGAG
                      ____________________________________________________________
consensus GTCGGCATTGAGTTAGAGAGGCGAGAGAGATGCGAGAGGGTGAGAGGGTGAGAGGGTGAG
 
. : . : . : . : . : . :
JMFS051E01+ AGGGTGAGGTA
JMSF007N09+ AGGGTGAGGTAGCCTGAGGCAGAGAGTGAGAGATGCGAGAGGGTGAGGCTGAGAGATGCC
                      ____________________________________________________________
consensus AGGGTGAGGTAGCCTGAGGCAGAGAGTGAGAGATGCGAGAGGGTGAGGCTGAGAGATGCC