Previous Contig 004927:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF030B20Sequence436004927 (6)620009621 (5)gb:AY062465_15651217e-12Arabidopsis thaliana Unknown protein (At3g10980; F9F8.20) mRNA, complete cds.>gb
JMFS028B05Sequence512004927 (6)
JMSF007N03Sequence336004927 (6)731009621 (5)gb:AY062465_15651213e-35Arabidopsis thaliana Unknown protein (At3g10980; F9F8.20) mRNA, complete cds.>gb
JMSF012P24Sequence266004927 (6)742009621 (5)gb:AY062465_15651211e-37Arabidopsis thaliana Unknown protein (At3g10980; F9F8.20) mRNA, complete cds.>gb
JMSF013I23Sequence367004927 (6)gb:AY062465_15651213e-24Arabidopsis thaliana Unknown protein (At3g10980; F9F8.20) mRNA, complete cds.>gb733009621 (5)gb:AY062465_15651213e-35Arabidopsis thaliana Unknown protein (At3g10980; F9F8.20) mRNA, complete cds.>gb
JMSF048F09Sequence690004927 (6)gb:AY062465_15651211e-13Arabidopsis thaliana Unknown protein (At3g10980; F9F8.20) mRNA, complete cds.>gb751009621 (5)gb:AY062465_15651215e-39Arabidopsis thaliana Unknown protein (At3g10980; F9F8.20) mRNA, complete cds.>gb

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF013I23+ ATCGCGCCCGAGACAGCTAC
                      ____________________________________________________________
consensus ATCGCGCCCGAGACAGCTAC
 
. : . : . : . : . : . :
JMSF013I23+ ACATACGATCCAAACGAGAAGTGCCATGTTCAGTGGATTCCTTATCCATTCTTTACAAAT
JMSF048F09+ TTCTTTACAAAT
                      ____________________________________________________________
consensus ACATACGATCCAAACGAGAAGTGCCATGTTCAGTGGATTCCTTATCCATTCTTTACAAAT
 
. : . : . : . : . : . :
JMSF013I23+ CTTCCGAAGAGACGTCCAATCAATTTTCCGTGAAAAGAGCCTATGCAAGCGCTCACGGAG
JMSF048F09+ CTTCCGAAGAGACGTCCAATCAATTTTCCGTGAAAAGAGCCTATGCAAGCGCTCACGGAG
                      ____________________________________________________________
consensus CTTCCGAAGAGACGTCCAATCAATTTTCCGTGAAAAGAGCCTATGCAAGCGCTCACGGAG
 
. : . : . : . : . : . :
JMSF013I23+ ATGACGGCTGCCAGAAGAGGGCACAGCACGAGAAATCTCGTCCCTTTCCTCGGCAATCTG
JMSF048F09+ ATGACGGCTGCCAGAAGAGGGCACAGCACGAGAAATCTCGTCCCTTTCCTCGGCAATCTG
                      ____________________________________________________________
consensus ATGACGGCTGCCAGAAGAGGGCACAGCACGAGAAATCTCGTCCCTTTCCTCGGCAATCTG
 
. : . : . : . : . : . :
JMSF013I23+ CTGAAACTTGGCAGACGGGGAAGCCAAATTCCCGAACTTGAGGAACTGCAGCCTCTTCGG
JMSF048F09+ CTGAAACTTGGCAGACGGGGAAGCCAAATTCCCGAACTTGAGGAACTGCAGCCTCTTCGG
                      ____________________________________________________________
consensus CTGAAACTTGGCAGACGGGGAAGCCAAATTCCCGAACTTGAGGAACTGCAGCCTCTTCGG
 
. : . : . : . : . : . :
JMSF013I23+ GATAGAAATAGAACCACCTTGGAATCGTTTTTGAGGATTATCATCACTCACGAGCCCTCT
JMSF048F09+ GATAGAAATAGAACCACCTTGGAATCGTTTTTGAGGATTATCATCACTCACGAGCCCTCT
JMFF030B20+ T
JMFS028B05+ GTTTTTGAGGATTATCATCACTCACGAGCCCTCT
                      ____________________________________________________________
consensus GATAGAAATAGAACCACCTTGGAATCGTTTTTGAGGATTATCATCACTCACGAGCCCTCT
 
. : . : . : . : . : . :
JMSF013I23+ TTGAGACGAAGAAATGTGCAGAGCAGTGTGAGTCGGCCCTTGAGA
JMSF048F09+ TTGAGACGAAGAAATGTGCAGAGCAGTGTGAGTCGGCCCTTGAGAACCATTCGAATTACT
JMFF030B20+ TTGAGACGAAGAAATGTGCAGAGCAGTGTGAGTCGGCCCTTGAGAACCATTCGAATTACT
JMFS028B05+ TTGAGACGAAGAAATGTGCAGAGCAGTGTGAGTCGGCCCTTGAGAACCATTCGAATTACT
                      ____________________________________________________________
consensus TTGAGACGAAGAAATGTGCAGAGCAGTGTGAGTCGGCCCTTGAGAACCATTCGAATTACT
 
. : . : . : . : . : . :
JMSF048F09+ TTCCAAAACCTTACCATCATTTTCACTAACATCATTGGAACCCATCCTTGCTTCCTACAA
JMFF030B20+ TTCCAAAACCTTACCATCATTTTCACTAACATCATTGGAACCCATCCTTGCTTCCTACAA
JMFS028B05+ TTCCAAAACCTTACCATCATTTTCACTAACATCATTGGAACCCATCCTTGCTTCCTACAA
                      ____________________________________________________________
consensus TTCCAAAACCTTACCATCATTTTCACTAACATCATTGGAACCCATCCTTGCTTCCTACAA
 
. : . : . : . : . : . :
JMSF048F09+ ATTTTCTTGAGCCCCAATTCTTTTTACACAAAAATATTATACTAGGCTGACCATTTTCTG
JMSF012P24+ AGGCTGACCATTTTCTG
JMFF030B20+ ATTTTCTTGAGCCCCAATTCTTTTTACACAAAAATATTATACTAGGCTGACCATTTTCTG
JMFS028B05+ ATTTTCTTGAGCCCCAATTCTTTTTACACAAAAATATTATACTAGGCTGACCATTTTCTG
JMSF007N03+ TACACAAAAATATTATACTAGGCTGACCATTTTCTG
                      ____________________________________________________________
consensus ATTTTCTTGAGCCCCAATTCTTTTTACACAAAAATATTATACTAGGCTGACCATTTTCTG
 
. : . : . : . : . : . :
JMSF048F09+ TGCATTTCCTCTTCAACCCAAAGAAGAGCAGAGTGATAAGATCAATCAATCATCATCAAT
JMSF012P24+ TGCATTTCCTCTTCAACCCAAAGAAGAGCAGAGTGATAAGATCAATCAATCATCATCAAT
JMFF030B20+ TGCATTTCCTCTTCAACCCAAAGAAGAGCAGAGTGATAAGATCAATCAATCATCATCAAT
JMFS028B05+ TGCATTTCCTCTTCAACCCAAAGAAGAGCAGAGTGATAAGATCAATCAATCATCATCAAT
JMSF007N03+ TGCATTTCCTCTTCAACCCAAAGAAGAGCAGAGTGATAAGATCAATCAATCATCATCAAT
                      ____________________________________________________________
consensus TGCATTTCCTCTTCAACCCAAAGAAGAGCAGAGTGATAAGATCAATCAATCATCATCAAT
 
. : . : . : . : . : . :
JMSF048F09+ CTGAACCAAAGATTGAAGCTTTATTTAGTTCCCCCCAATCCATTGACCAATTTTGCAAGA
JMSF012P24+ CTGAACCAAAGATTGAAGCTTTATTTAGTTCCCCCCAATCCATTGACCAATTTTGCAAGA
JMFF030B20+ CTGAACCAAAGATTGAAGCTTTATTTAGTTCCCCCCAATCCATTGACCAATTTTGCAAGA
JMFS028B05+ CTGAACCAAAGATTGAAGCTTTATTTAGTTCCCCCCAATCCATTGACCAATTTTGCAAGA
JMSF007N03+ CTGAACCAAAGATTGAAGCTTTATTTAGTTCCCCCCAATCCATTGACCAATTTTGCAAGA
                      ____________________________________________________________
consensus CTGAACCAAAGATTGAAGCTTTATTTAGTTCCCCCCAATCCATTGACCAATTTTGCAAGA
 
. : . : . : . : . : . :
JMSF048F09+ TTTTCAACCCAGAATAAGGAGCACTAAAAGAGCAGCTTTTTTGGTATGCTTTTTACGTTT
JMSF012P24+ TTTTCAACCCAGAATAAGGAGCACTAAAAGAGCAGCTTTTTTGGTATGCTTTTTACGTTT
JMFF030B20+ TTTTCAACCCAGAATAAGGAGCACTAAAAGAGCAGCTTTTTTGGTATGCTTTTTACGTTT
JMFS028B05+ TTTTCAACCCAGAATAAGGAGCACTAAAAGAGCAGCTTTTTTGGTATGCTTTTTACGTTT
JMSF007N03+ TTTTCAACCCAGAATAAGGAGCACTAAAAGAGCAGCTTTTTTGGTATGCTTTTTACGTTT
                      ____________________________________________________________
consensus TTTTCAACCCAGAATAAGGAGCACTAAAAGAGCAGCTTTTTTGGTATGCTTTTTACGTTT
 
. : . : . : . : . : . :
JMSF048F09+ CTTTGATGAGAAGGAAAGAGAGAATCACATAAAGCAAAGCAAACAAAATTACAAAAGACA
JMSF012P24+ CTTTGATGAGAAGGAAAGAGAGAATCACATAAAGCAAAGCAAACAAAATTACAAAAGACA
JMFF030B20+ CTTTGATGAGAAGGAAAGAGAGAATCACATAAAGCAAAGCAAACAAAATTACAAAAGACA
JMFS028B05+ CTTTGATGAGAAGGAAAGAGAGAATCACATAAAGCAAAGCAAACAAAATTACAAAAGACA
JMSF007N03+ CTTTGATGAGAAGGAAAGAGAGAATCACATAAAGCAAAGCAAACAAAATTACAAAAGACA
                      ____________________________________________________________
consensus CTTTGATGAGAAGGAAAGAGAGAATCACATAAAGCAAAGCAAACAAAATTACAAAAGACA
 
. : . : . : . : . : . :
JMSF048F09+ GGAAAGACAGAAATT
JMSF012P24+ GGAAAGAC
JMFF030B20+ GGAAAGACAGAAATT
JMFS028B05+ GGAAAGACAGAAATTAGGGAGAAACAGGAAGACCCAAGTATTAAAATGAAAGAATTGT
JMSF007N03+ GGAAAGACAGAAATTAGGGAGAAACAGGAAGACCCAAGTATTAAAATGAAAGAATTGTCC
                      ____________________________________________________________
consensus GGAAAGACAGAAATTAGGGAGAAACAGGAAGACCCAAGTATTAAAATGAAAGAATTGTCC