Previous Contig 004924:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF007M18Sequence278004924 (5)731012418 (5)pir|T47568|T47568e-110fructokinase-like protein - Arabidopsis thaliana>gb:AX544356_1470090 Sequence 9
JMSF011I16Sequence281004924 (5)751012418 (5)pir|T47568|T47568e-106fructokinase-like protein - Arabidopsis thaliana>gb:AX544356_1470090 Sequence 9
JMSF014D08Sequence484004924 (5)pir|T47568|T475682e-04fructokinase-like protein - Arabidopsis thaliana>gb:AX544356_1470090 Sequence 9 752012418 (5)pir|T47568|T47568e-116fructokinase-like protein - Arabidopsis thaliana>gb:AX544356_1470090 Sequence 9
JMSF025I10Sequence657004924 (5)pir|T47568|T475685e-34fructokinase-like protein - Arabidopsis thaliana>gb:AX544356_1470090 Sequence 9 745012418 (5)pir|T47568|T475681e-90fructokinase-like protein - Arabidopsis thaliana>gb:AX544356_1470090 Sequence 9
JMSF029A06Sequence641004924 (5)pir|T47568|T475681e-36fructokinase-like protein - Arabidopsis thaliana>gb:AX544356_1470090 Sequence 9 703012418 (5)pir|T47568|T47568e-103fructokinase-like protein - Arabidopsis thaliana>gb:AX544356_1470090 Sequence 9

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF029A06+ TTCCCCAAACTCG
                      ____________________________________________________________
consensus TTCCCCAAACTCG
 
. : . : . : . : . : . :
JMSF029A06+ TCATCCCCGACTTTCCCCATAAACGCGGCTCTCCCACCCAGCCTCACGTGAGATATAGCC
JMSF025I10+ ATCCCCGACTTTCCCCATAAACGCGGCTCTCCCACCCAGCCTCACGTGAGATATAGCC
                      ____________________________________________________________
consensus TCATCCCCGACTTTCCCCATAAACGCGGCTCTCCCACCCAGCCTCACGTGAGATATAGCC
 
. : . : . : . : . : . :
JMSF029A06+ ACATTTGACGGCGGCCCTCCCGGAGCTCTGACGAACTCCGGCGGGTTCCACTGCAGCATC
JMSF025I10+ ACATTTGACGGCGGCCCTCCCGGAGCTCTGACGAACTCCGGCGGGTTCCACTGCAGCATC
                      ____________________________________________________________
consensus ACATTTGACGGCGGCCCTCCCGGAGCTCTGACGAACTCCGGCGGGTTCCACTGCAGCATC
 
. : . : . : . : . : . :
JMSF029A06+ TTCCATTCGGAATATATATCCGGGTCCATTTGCTCCGGCGCCACCCTCACCGTGGGCACG
JMSF025I10+ TTCCATTCGGAATATATATCCGGGTCCATTTGCTCCGGCGCCACCCTCACCGTGGGCACG
JMSF014D08+ CACG
                      ____________________________________________________________
consensus TTCCATTCGGAATATATATCCGGGTCCATTTGCTCCGGCGCCACCCTCACCGTGGGCACG
 
. : . : . : . : . : . :
JMSF029A06+ AACTCCTTCTGGGCCGCCCCGAAGCAGCATATCAGAGGCGGGGATTCGTAGGGAAAATCG
JMSF025I10+ AACTCCTTCTGGGCCGCCCCGAAGCAGCATATCAGAGGCGGGGATTCGTAGGGAAAATCG
JMSF014D08+ AACTCCTTCTGGGCCGCCCCGAAGCAGCATATCAGAGGCGGGGATTCGTAGGGAAAATCG
                      ____________________________________________________________
consensus AACTCCTTCTGGGCCGCCCCGAAGCAGCATATCAGAGGCGGGGATTCGTAGGGAAAATCG
 
. : . : . : . : . : . :
JMSF029A06+ ACACCGTCGTCGTAATCGTCTACCTCGTCAGCATTTACCGGAGGCTCAACGTAGGACTCA
JMSF025I10+ ACACCGTCGTCGTAATCGTCTACCTCGTCAGCATTTACCGGAGGCTCAACGTAGGACTCA
JMSF014D08+ ACACCGTCGTCGTAATCGTCTACCTCGTCAGCATTTACCGGAGGCTCAACGTAGGACTCA
                      ____________________________________________________________
consensus ACACCGTCGTCGTAATCGTCTACCTCGTCAGCATTTACCGGAGGCTCAACGTAGGACTCA
 
. : . : . : . : . : . :
JMSF029A06+ AATTCTTCGGTGTCACTTTGAGTTTCTTTTCTTGGACGAGCCCTGGACCTTTTTGTAGCG
JMSF025I10+ AATTCTTCGGTGTCACTTTGAGTTTCTTTTCTTGGACGAGCCCTGGACCTTTTTGTAGCG
JMSF014D08+ AATTCTTCGGTGTCACTTTGAGTTTCTTTTCTTGGACGAGCCCTGGACCTTTTTGTAGCG
                      ____________________________________________________________
consensus AATTCTTCGGTGTCACTTTGAGTTTCTTTTCTTGGACGAGCCCTGGACCTTTTTGTAGCG
 
. : . : . : . : . : . :
JMSF029A06+ ACAGATTCTATGGTTTCACTTTGAGGTTCTTTTTTTGGACGACCTCTGGGCTTTGAAGAA
JMSF025I10+ ACAGATTCTATGGTTTCACTTTGAGGTTCTTTTTTTGGACGACCTCTGGGCTTTGAAGAA
JMSF014D08+ ACAGATTCTATGGTTTCACTTTGAGGTTCTTTTTTTGGACGACCTCTGGGCTTTGAAGAA
JMSF011I16+ TTTGAGGTTCTTTTTTTGGACGACCTCTGGGCTTTGAAGAA
JMSF007M18+ GAGGTTCTTTTTTTGGACGACCTCTGGGCTTTGAAGAA
                      ____________________________________________________________
consensus ACAGATTCTATGGTTTCACTTTGAGGTTCTTTTTTTGGACGACCTCTGGGCTTTGAAGAA
 
. : . : . : . : . : . :
JMSF029A06+ GGTGAAGTCTTTTTCAGGGCACGGTGGGAGGTTTTTGAGGGTTGTTGAGTGGTGGTGTGG
JMSF025I10+ GGTGAAGTCTTTTTCAGGGCACGGCGGGAGGTTTTTGAGGGTTGTTGAGTGGTGGTGTGG
JMSF014D08+ GGTGAAGTCTTTTTCAGGGCACGGCGGGAGGTTTTTGAGGGTTGTTGAGTGGTGGTGTGG
JMSF011I16+ GGTGAAGTCTTTTTCAGGGCACGGCGGGAGGTTTTTGAGGGTTGTTGAGTGGTGGTGTGG
JMSF007M18+ GGTGAAGTCTTTTTCAGGGCACGGCGGGAGGTTTTTGAGGGTTGTTGAGTGGTGGTGTGG
                      ____________________________________________________________
consensus GGTGAAGTCTTTTTCAGGGCACGGCGGGAGGTTTTTGAGGGTTGTTGAGTGGTGGTGTGG
 
. : . : . : . : . : . :
JMSF029A06+ TCATCGGCGGAGGAGGACTTTGGCGGATTTGGGTGGCAAACGTAACGGTGTTTGGGTAAA
JMSF025I10+ TCATCGGCGGAGGAGGACTTTGGCGGATTTGGGTGGCAAACGTAACGGTGTTTGGGTAAA
JMSF014D08+ TCATCGGCGGAGGAGGACTTTGGCGGATTTGGGTGGCAAACGTAACGGTGTTTGGGTAAA
JMSF011I16+ TCATCGGCGGAGGAGGACTTTGGCGGATTTGGGTGGCAAACGTAACGGTGTTTGGGTAAA
JMSF007M18+ TCATCGGCGGAGGAGGACTTTGGCGGATTTGGGTGGCAAACGTAACGGTGTTTGGGTAAA
                      ____________________________________________________________
consensus TCATCGGCGGAGGAGGACTTTGGCGGATTTGGGTGGCAAACGTAACGGTGTTTGGGTAAA
 
. : . : . : . : . : . :
JMSF029A06+ AAGGTTGATACTTTGAAATGGGTAAGAGAGTTGAGGGCTAGAGAGTGAGAATGCTGAGAA
JMSF025I10+ AAGGTTGATACTTTGAAATGGGTAAGAGAGTTGAGGGCTAGAGAGTGAGAATGCTGAGAA
JMSF014D08+ AAGGTTGATACTTTGAAATGGGTAAGAGAGTTGAGGGCTAGAGAGTGAGAATGCTGAGAA
JMSF011I16+ AAGGTTGATACTTTGAAATGGGTAAGAGAGTTGAGGGCTAGAGAGTGAGAATGCTGAGAA
JMSF007M18+ AAGGTTGATACTTTGAAATGGGTAAGAGAGTTGAGGGCTAGAGAGTGAGAATGCTGAGAA
                      ____________________________________________________________
consensus AAGGTTGATACTTTGAAATGGGTAAGAGAGTTGAGGGCTAGAGAGTGAGAATGCTGAGAA
 
. : . : . : . : . : . :
JMSF029A06+ AGGGAAGATGGAAGGAAATGAATTGC
JMSF025I10+ AGGGAAGATGGAAGGAAATGAATTGCTGCCATGGCCATCATTGGTGTTAGGGTTTAT
JMSF014D08+ AGGGAAGATGGAAGGAAATGAATTGCTGCCATGGCCATCATTGGTGTTAGGGTTTAT
JMSF011I16+ AGGGAAGATGGAAGGAAATGAATTGCTGCCATGGCCATCATTGGTGTTAGGGTTTAT
JMSF007M18+ AGGGAAGATGGAAGGAAATGAATTGCTGCCATGGCCATCATTGGTGTTAGGGTTTATCAC
                      ____________________________________________________________
consensus AGGGAAGATGGAAGGAAATGAATTGCTGCCATGGCCATCATTGGTGTTAGGGTTTATCAC