Previous Contig 004922:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS120E09Sequence622004922 (3)pir|H86240|H862404e-35hypothetical protein [imported] - Arabidopsis thaliana>gb:AE005172_890087 Arabid
JMSF007M11Sequence297004922 (3)764011400 (3)pir|H86240|H862404e-31hypothetical protein [imported] - Arabidopsis thaliana>gb:AE005172_890087 Arabid
JMSF023M10Sequence623004922 (3)pir|H86240|H862409e-16hypothetical protein [imported] - Arabidopsis thaliana>gb:AE005172_890087 Arabid758011400 (3)pir|H86240|H86240e-107hypothetical protein [imported] - Arabidopsis thaliana>gb:AE005172_890087 Arabid

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS120E09+ GCCT
                      ____________________________________________________________
consensus GCCT
 
. : . : . : . : . : . :
JMFS120E09+ CCTTTCAAATAATAGAACAATTCTCGAGCCCTATCATAAACACTAGTCAATGACCCCAAA
                      ____________________________________________________________
consensus CCTTTCAAATAATAGAACAATTCTCGAGCCCTATCATAAACACTAGTCAATGACCCCAAA
 
. : . : . : . : . : . :
JMFS120E09+ TCAGGCACAAGAACCCTTTCATCCTTCTTCTCTGCCCCAGCAAAATAAGACAGGCCACCT
JMSF023M10+ GCCCCAGCAAAATAAGACAGGCCACCT
                      ____________________________________________________________
consensus TCAGGCACAAGAACCCTTTCATCCTTCTTCTCTGCCCCAGCAAAATAAGACAGGCCACCT
 
. : . : . : . : . : . :
JMFS120E09+ AATCTCCCTTTACCAAAACCAAAGATTCCATGTACCAGAACAATGGGAGACAAATCTTTG
JMSF023M10+ AATCTCCCTTTACCAAAACCAAAGATTCCATGTACCAGAACAATGGGAGACAAATCTTTG
                      ____________________________________________________________
consensus AATCTCCCTTTACCAAAACCAAAGATTCCATGTACCAGAACAATGGGAGACAAATCTTTG
 
. : . : . : . : . : . :
JMFS120E09+ GAGCTGGTTGTCTTGTTTGACTCTTCTGCTCTCAACCCATTCTCCAGATTGGGCTTGAAA
JMSF023M10+ GAGCTGGTTGTCTTGTTTGACTCTTCTGCTCTCAACCCATTCTCCAGATTGGGCTTGAAA
                      ____________________________________________________________
consensus GAGCTGGTTGTCTTGTTTGACTCTTCTGCTCTCAACCCATTCTCCAGATTGGGCTTGAAA
 
. : . : . : . : . : . :
JMFS120E09+ AACCAATCACTCAAGGCCAGAGAGAGATCACCAGCCACAGCTGTGCTGAATATGTAAAAC
JMSF023M10+ AACCAATCACTCAAGGCCAGAGAGAGATCACCAGCCACAGCTGTGCTGAATATGTAAAAC
                      ____________________________________________________________
consensus AACCAATCACTCAAGGCCAGAGAGAGATCACCAGCCACAGCTGTGCTGAATATGTAAAAC
 
. : . : . : . : . : . :
JMFS120E09+ CCATATGCCAAATGAACCACGGAGGTCACGAAAAGCTCTGCTAATTGCAGTGATAGTATC
JMSF023M10+ CCATATGCCAAATGAACCACGGAGGTCACGAAAAGCTCTGCTAATTGCAGTGATAGTATC
                      ____________________________________________________________
consensus CCATATGCCAAATGAACCACGGAGGTCACGAAAAGCTCTGCTAATTGCAGTGATAGTATC
 
. : . : . : . : . : . :
JMFS120E09+ CCCCATCTTATCATTTTCATAAAATCCCAAAGATATATTTGCTTATTATCCCAGAAAGCC
JMSF023M10+ CCCCATCTTATCATTTTCATAAAATCCCAAAGATATATTTGCTTATTATCCCAGAAAGCC
                      ____________________________________________________________
consensus CCCCATCTTATCATTTTCATAAAATCCCAAAGATATATTTGCTTATTATCCCAGAAAGCC
 
. : . : . : . : . : . :
JMFS120E09+ TTCTTCTAGACAAGAGAAGAAGACTCGTTGGGACAGAAACTCTATATCCGTCAGCAGAAA
JMSF023M10+ TTCTTCTAGACAAGAGAAGAAGACTCGTTGGGACAGAAACTCTATATCCGTCAGCAGAAA
JMSF007M11+ TTCTAGACAAGAGAAGAAGACTCGTTGGGACAGAAACTCTATATCCGTCAGCAGAAA
                      ____________________________________________________________
consensus TTCTTCTAGACAAGAGAAGAAGACTCGTTGGGACAGAAACTCTATATCCGTCAGCAGAAA
 
. : . : . : . : . : . :
JMFS120E09+ ATGAAATGGAAATGGAAATGGAAGACGCAACTCGGAATCCACCAAACCCCCCCAATAATT
JMSF023M10+ ATGAAATGGAAATGGAAATGGAAGACGCAACTCGGAATCCACCAAACCCCCCCAATAATT
JMSF007M11+ ATGAAATGGAAATGGAAATGGAAGACGCAACTCGGAATCCACCAAACCCCCCCAATAATT
                      ____________________________________________________________
consensus ATGAAATGGAAATGGAAATGGAAGACGCAACTCGGAATCCACCAAACCCCCCCAATAATT
 
. : . : . : . : . : . :
JMFS120E09+ CAACTTTCAATTCAAGTTTCTCCAAAGGGTTGAAGTTGAGCCTCGAAAGAATGGGCAGAA
JMSF023M10+ CAACTTTCAATTCAAGTTTCTCCAAAGGGTTGAAGTTGAGCCTCGAAAGAATGGGCAGAA
JMSF007M11+ CAACTTTCAATTCAAGTTTCTCCAAAGGGTTGAAGTTGAGCCTCGAAAGAATGGGCAGAA
                      ____________________________________________________________
consensus CAACTTTCAATTCAAGTTTCTCCAAAGGGTTGAAGTTGAGCCTCGAAAGAATGGGCAGAA
 
. : . : . : . : . : . :
JMFS120E09+ AAGCGAGGAATTTCGTGA
JMSF023M10+ AAGCGAGGAATTTCGTGACCCCCTCCCTACCCTGTGAATTTCAAATGGAGTCGTTTGCTC
JMSF007M11+ AAGCGAGGAATTTCGTGACCCCCTCCCTACCCTGTGAATTTCAAATGGAGTCGTTTGCTC
                      ____________________________________________________________
consensus AAGCGAGGAATTTCGTGACCCCCTCCCTACCCTGTGAATTTCAAATGGAGTCGTTTGCTC
 
. : . : . : . : . : . :
JMSF023M10+ CTATGGGTAGAAGAAAGGGGAAACAAATTTCTCAATTTTCCACAAATTTCTCGTT
JMSF007M11+ CTATGGGTAGAAGAAAGGGGAAACAAATTTCTCAATTTTCCACAAATTTCTCGTTGGCCC
                      ____________________________________________________________
consensus CTATGGGTAGAAGAAAGGGGAAACAAATTTCTCAATTTTCCACAAATTTCTCGTTGGCCC