Previous Contig 004912:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF004F24Sequence453004912 (6)pir|D71418|D714181e-27hypothetical protein - Arabidopsis thaliana>gb:ATCHRIV41_1545341 Arabidopsis tha737009755 (4)gb:AX025512_14569676e-12Sequence 38 from Patent WO0032789.
JMFF014D07Sequence582004912 (6)gb:AP001314_18211828e-18Arabidopsis thaliana genomic DNA, chromosome 3, BAC clone:T6J22.667009755 (4)gb:AX025512_14569675e-10Sequence 38 from Patent WO0032789.
JMFF033C13Sequence541004912 (6)pir|D71418|D714188e-34hypothetical protein - Arabidopsis thaliana>gb:ATCHRIV41_1545341 Arabidopsis tha713009755 (4)gb:AX025512_14569675e-10Sequence 38 from Patent WO0032789.
JMSF007K21Sequence284004912 (6)gb:AB023041_15154582e-09Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MPE11.783012132 (2)gb:AX025512_14569674e-20Sequence 38 from Patent WO0032789.
JMSF020G18Sequence660004912 (6)pir|D71418|D714189e-33hypothetical protein - Arabidopsis thaliana>gb:ATCHRIV41_1545341 Arabidopsis tha771012132 (2)gb:AX025512_14569676e-16Sequence 38 from Patent WO0032789.
JMSF038C12Sequence649004912 (6)pir|D71418|D714188e-33hypothetical protein - Arabidopsis thaliana>gb:ATCHRIV41_1545341 Arabidopsis tha

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF014D07+ CGGCTTCCA
                      ____________________________________________________________
consensus CGGCTTCCA
 
. : . : . : . : . : . :
JMFF014D07+ ATTCCCACCGAGCGGCCACCATTTGGTAGATGTTGCCTAGGCACTGCGAAGGGAATGGCG
                      ____________________________________________________________
consensus ATTCCCACCGAGCGGCCACCATTTGGTAGATGTTGCCTAGGCACTGCGAAGGGAATGGCG
 
. : . : . : . : . : . :
JMFF014D07+ GGTTCAACTTATTTCGCACGTTAATCATTTTTGTCAGCAAATGCATCTTGAGGTTTGGGT
                      ____________________________________________________________
consensus GGTTCAACTTATTTCGCACGTTAATCATTTTTGTCAGCAAATGCATCTTGAGGTTTGGGT
 
. : . : . : . : . : . :
JMFF014D07+ TCGCCTGTAGAGTTGCCCGTATCACCGCCGCCCATACGAAAGCCGACAACGCCTCCACCC
                      ____________________________________________________________
consensus TCGCCTGTAGAGTTGCCCGTATCACCGCCGCCCATACGAAAGCCGACAACGCCTCCACCC
 
. : . : . : . : . : . :
JMFF014D07+ GAGACGGACGGCGGCTGTGCTCCGATGGCTGATAATAATCGTTTCTGATCCGCTCAATAT
                      ____________________________________________________________
consensus GAGACGGACGGCGGCTGTGCTCCGATGGCTGATAATAATCGTTTCTGATCCGCTCAATAT
 
. : . : . : . : . : . :
JMFF014D07+ CCCGCTTGCAAAGAACAAATCTTTTCGAGGAGTACTTACCCTGTTTCTCGAGGGGAAAGG
                      ____________________________________________________________
consensus CCCGCTTGCAAAGAACAAATCTTTTCGAGGAGTACTTACCCTGTTTCTCGAGGGGAAAGG
 
. : . : . : . : . : . :
JMFF014D07+ GCTTTAGCGGGGAGCTGACGAGGTTCCCCGGCCTGAAAGTTGCGGAGGCGTCCGCGATGA
JMSF038C12+ GGAGCTGAAGAGGTTCCCCGGCCTGAAAATTGTGGAGGCGTCCACGACGA
JMSF020G18+ GGAGCTGAAGAGGTTCCCCGGCCTGAAAATTGTGGAGGCGTCCACGACGA
                      ____________________________________________________________
consensus GCTTTAGCGGGGAGCTGAAGAGGTTCCCCGGCCTGAAAATTGTGGAGGCGTCCACGACGA
 
. : . : . : . : . : . :
JMFF014D07+ GACCGCCGGGATTAATGGGTCCTTCTCCGCGGTTGATTGCCGCCCATGTGTTAAATAATC
JMSF038C12+ GTCCGCCGGGATTACTGGGTCCTTCCCCGCGGTTGATTGCCGTCCATGTGTTAAATAATC
JMFF033C13+ CCGCGGTTGATTGCCGCCCATGTGTTAAATAATC
JMSF020G18+ GTCCGCCGGGATTACTGGGTCCTTCCCCGCGGTTGATTGCCGTCCATGTGTTAAATAATC
                      ____________________________________________________________
consensus GTCCGCCGGGATTACTGGGTCCTTCCCCGCGGTTGATTGCCGTCCATGTGTTAAATAATC
 
. : . : . : . : . : . :
JMFF014D07+ CGGTCATCGCGCCGCCGTCCGCCAGGCCGTGCCAAATGCAGAAACCCACCGCAGTTCCGC
JMSF038C12+ CGACCATCGCGGCGCCGTCCGCCAGGCCGTGCCAAATGCAGAACGCCACCGCAGTTCCGC
JMFF004F24+ GCCAAATGCAGAACCCCACCGCAGTTCCGC
JMFF033C13+ CGGTCATCGCGCCGCCGTCCGCCAGGCCGTGCCAAATGCAGAACCCCACCGCAGTTCCGC
JMSF020G18+ CGACCATCGCGGCGCCGTCCGCCAGGCCGTGCCAAATGCAGAACGCCACCGCAGTTCCGC
                      ____________________________________________________________
consensus CGGTCATCGCGGCGCCGTCCGCCAGGCCGTGCCAAATGCAGAACCCCACCGCAGTTCCGC
 
. : . : . : . : . : . :
JMFF014D07+ CGCACCGGAATGTGTTGACCTGAACAGCTAACATTGGCAGGGCGGAGTGAATAGGGTTTG
JMSF038C12+ CGCACCGGAATGTGTTGACCTGAACAGCTAACATTGGCATGGCGGAGTGAATAGGGTTTG
JMFF004F24+ CGCACCGGAATGTGTTGACCTGAACAGCTAACATTGGCAGGGCGGAGTGAATAGGGTTTG
JMFF033C13+ CGCACCGGAATGTGTTGACCTGAACAGCTAACATTGGCAGGGCGGAGTGAATAGGGTTTG
JMSF020G18+ CGCACCGGAATGTGTTGACCTGAACAGCTAACATTGGCATGGCGGAGTGAATAGGGTTTG
                      ____________________________________________________________
consensus CGCACCGGAATGTGTTGACCTGAACAGCTAACATTGGCAGGGCGGAGTGAATAGGGTTTG
 
. : . : . : . : . : . :
JMFF014D07+ GGTAGGGATCAAGTGGGAGCAGCTGGCGTATAT
JMSF038C12+ GGTAGGGATCAAGTGGGAGCAGCTGGCGTATATCTTCGAGTTTGGGGTGCCGGAGAAGCT
JMFF004F24+ GGTAGGGATCAAGTGGGAGCAGCTGGCGTATATCTTCGTGTTTGGGGTGCCGGAGAAACT
JMFF033C13+ GGTAGGGATCAAGTGGGAGCAGCTGGCGTATATCTTCGTGTTTGGGGTGCCGGAGAAACT
JMSF020G18+ GGTAGGGATCAAGTGGGAGCAGCTGGCGTATATCTTCGAGTTTGGGGTGCCGGAGAAGCT
                      ____________________________________________________________
consensus GGTAGGGATCAAGTGGGAGCAGCTGGCGTATATCTTCGTGTTTGGGGTGCCGGAGAAGCT
 
. : . : . : . : . : . :
JMSF038C12+ CACCCAAATCACAATTGGTAACTTTAGCTAGGACAAAATCCGCACCCTCGTCGTTGCATT
JMFF004F24+ CACCCAAATCACAATTGGTAACTTTAGCTAGGACAAAATCCGCACCCTCGTCGTTGCATT
JMFF033C13+ CACCCAAATCACAATTGGTAACTTTAGCTAGGACAAAATCCGCACCCTCGTCGTTGCATT
JMSF020G18+ CACCCAAATCACAATTGGTAACTTTAGCTAGGACAAAATCCGCACCCTCGTCGTTGCATT
                      ____________________________________________________________
consensus CACCCAAATCACAATTGGTAACTTTAGCTAGGACAAAATCCGCACCCTCGTCGTTGCATT
 
. : . : . : . : . : . :
JMSF038C12+ CGATGGTCGATGCATCTTTAATTCTTCCGGCGAGCGGATATAAGAGGGACAGTGTCTTCA
JMFF004F24+ CGATGGTCGATGCATCTTTAATTCTTCCGGCGAGCGGATACAAGAGGGACAGTGTCTTCA
JMFF033C13+ CGATGGTCGATGCATCTTTAATTCTTCCGGCGAGCGGATACAAGAGGGACAGTGTCTTCA
JMSF020G18+ CGATGGTCGATGCATCTTTAATTCTTCCGGCGAGCGGATATAAGAGGGACAGTGTCTTCA
                      ____________________________________________________________
consensus CGATGGTCGATGCATCTTTAATTCTTCCGGCGAGCGGATATAAGAGGGACAGTGTCTTCA
 
. : . : . : . : . : . :
JMSF038C12+ TGAGCGAGTTCTTGAGCGAGTCATAATCGTGGCGACTGGCACCGGAGTTGTAGAAGAAAA
JMFF004F24+ TGAGCGAGTTCTTGAGCTCATCATAATCGTGGCGATCGGCGCCGGAGTTGTAGAAGAAAA
JMFF033C13+ TGAGCGAGTTCTTGAGCTCATCATAATCGTGGCGATCGGCGCCGGAGTTGTAGAAGAAAA
JMSF020G18+ TGAGCGAGTTCTTGAGCGAGTCATAATCGTGGCGACTGGCACCGGAGTTGTAGAAGAAAA
JMSF007K21+ GGAGTTGTAGAAGAAAA
                      ____________________________________________________________
consensus TGAGCGAGTTCTTGAGCTCGTCATAATCGTGGCGATTGGCGCCGGAGTTGTAGAAGAAAA
 
. : . : . : . : . : . :
JMSF038C12+ CATAGGGGTTATAATAAGTGGAGGCTATCATATCAAGGAGAGAAAGCTTGTAGTTTCTCA
JMFF004F24+ CAAAGGGGTTATAATAAGTCGAGGATATTATATCAATGAGAGAAAGCTTGTAGTTTCTCA
JMFF033C13+ CAAAGGGGTTATAATAAGTCGAGGATATTATATCAATGAGAGAAAGCTTGTAGTTTCTCA
JMSF020G18+ CATAGGGGTTATAATAAGTGGAGGCTATCATATCAAGGAGAGAAAGCTTGTAGTTTCTCA
JMSF007K21+ CAAAGGGGTTATAAAAAGTCGAGACTAATATATCAAGGAGAGAAAGCTTGTAGTTTCTCA
                      ____________________________________________________________
consensus CAAAGGGGTTATAATAAGTCGAGGCTATTATATCAAGGAGAGAAAGCTTGTAGTTTCTCA
 
. : . : . : . : . : . :
JMSF038C12+ AGGTTTGGGGAGTTGGTGAACATGGCCTCACTCTCTCTTTCTGATAAACTTCAACTTTAA
JMFF004F24+ AGGTTTGGGGAGTTGGTGAACATGGCCTCACTCTCTCTTTCTGATAAACTTCAACTTTCA
JMFF033C13+ AGGTTTGGGGAGTTGGTGAACATGGCCTCACTCTCTCTTTCTGATAAACTTCAACTTTCA
JMSF020G18+ AGGTTTGGGGAGTTGGTGAACATGGCCTCACTCTCTCTTTCTGATAAACTTCAACTTTAA
JMSF007K21+ AGGTTTGGGGAGTTGGTGAACCTGGCCTCACTTTCTCTTTCTGATAAACTTCAATTTTCA
                      ____________________________________________________________
consensus AGGTTTGGGGAGTTGGTGAACATGGCCTCACTCTCTCTTTCTGATAAACTTCAACTTTCA
 
. : . : . : . : . : . :
JMSF038C12+ GGGCCATTGAATCGAT
JMFF004F24+ GGG
JMFF033C13+ GGGCCATTGAATCGAT
JMSF020G18+ GGGCCATTGAATCGAT
JMSF007K21+ GGGCCATTGGATCGATTGATACCTTATTTCATAACGCCCACTTATGATCACATATGCGTC
                      ____________________________________________________________
consensus GGGCCATTGAATCGATTGATACCTTATTTCATAACGCCCACTTATGATCACATATGCGTC