Previous Contig 004908:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF008B14Sequence347004908 (7)660008530 (3)gb:AF049930_17641291e-57Petunia x hybrida PGPD14 (PGPD14) mRNA, complete cds.
JMFN043M10Sequence608004908 (7)gb:AP003224_18255903e-09Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P001
JMFN046O01Sequence545004908 (7)
JMSF007K09Sequence501004908 (7)841004908 (7)
JMSF026D19Sequence664004908 (7)gb:OSJN00083_16945913e-07Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0064G10, complete seque854004908 (7)

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF026D19- AAAAGTAAGAACAAATACTGATCACTTTGTCTAGGGCATCTAAACTTTGTCACACCAAAA
rJMSF007K09- AATACTGATCACTTTGTCTAGGGCATCTAAACTTTGTCACACCAAAA
                      ____________________________________________________________
consensus AAAAGTAAGAACAAATACTGATCACTTTGTCTAGGGCATCTAAACTTTGTCACACCAAAA
 
. : . : . : . : . : . :
rJMSF026D19- TGAATGTAAGTAACCTCTACAGAAGCTGAGAACAGTGCAAATTCTTATATCAGAAAAACA
JMFN046O01+ AGCTGAGAACAGTGCAAATTCTTATATCAGAAAAACA
JMFF008B14+ GAATGTAAGTAACCTNTACAGAAGNTGAGAACAGTGCAAACTCTTAGAT-AGAAAAACA
rJMSF007K09- TGAATGTAAGTAACCTCTACAGAAGCTGAGAACAGTGCAAATTCTTATATCAGAAAAACA
                      ____________________________________________________________
consensus TGAATGTAAGTAACCTCTACAGAAGCTGAGAACAGTGCAAATTCTTATATCAGAAAAACA
 
. : . : . : . : . : . :
rJMSF026D19- TAAGAACTAGTTAATGCTTTCATCTCAAAAAAGTTAAGGCCATCATATATGTATTTAACA
JMFN046O01+ TAAGAACTAGTTAATGCTTTCATCTCAAAAAAGTTAAGGCCATCATATATGTATTTAACA
JMFF008B14+ CAAGAACTAGTTAATGCTTTCATCTCAAAAAAGTTAAGGCCATCATCTATGT
rJMSF007K09- TAAGAACTAGTTAATGCTTTCATCTCAAAAAAGTTAAGGCCATCATATATGTATTTAACA
                      ____________________________________________________________
consensus TAAGAACTAGTTAATGCTTTCATCTCAAAAAAGTTAAGGCCATCATATATGTATTTAACA
 
. : . : . : . : . : . :
rJMSF026D19- TCAGAATAGGCTACTCAAAGGCAGTTTGAATGAAGCTTGCAACCTCCCCCATTTTGTCCT
JMFN046O01+ TCAGAATAGGCTACTCAAAGGCAGTTTGAATGAAGCTTGCAACCTCCCCCATTTTGTCCT
rJMSF007K09- TCAGAATAGGCTACTCAAAGGCAGTTTGAATGAAGCTTGCAACCTCCCCCATTTTGTCCT
                      ____________________________________________________________
consensus TCAGAATAGGCTACTCAAAGGCAGTTTGAATGAAGCTTGCAACCTCCCCCATTTTGTCCT
 
. : . : . : . : . : . :
rJMSF026D19- TCAAAGCTTGTTTCATCGAAGCTGTCCTCTGAACCTCAATAGTCTCCGCTTCTAGTTGGG
JMFN046O01+ TCAAAGCTTGTTTCATCGAAGCTGTCCTCTGAACCTCAATAGTCTCCGCTTCTAGTTGGG
rJMSF007K09- TCAAAGCTTGTTTCATCGAAGCTGTCCTCTGAACCTCAATAGTCTCCGCTTCTAGTTGGG
                      ____________________________________________________________
consensus TCAAAGCTTGTTTCATCGAAGCTGTCCTCTGAACCTCAATAGTCTCCGCTTCTAGTTGGG
 
. : . : . : . : . : . :
rJMSF026D19- TACTTAAAGCAGCTTTCTTAAGCGTCATATTCAAAATATCATTATTTAAGGTACCCAACT
JMFN046O01+ TACTTAAAGCAGCTTTCTTAAGCGTCATATTCAAAATATCATTATTTAAGGTACCCAACT
rJMSF007K09- TACTTAAAGCAGCTTTCTTAAGCGTCATATTCAAAATATCATTATTTAAGGTACCCAACT
                      ____________________________________________________________
consensus TACTTAAAGCAGCTTTCTTAAGCGTCATATTCAAAATATCATTATTTAAGGTACCCAACT
 
. : . : . : . : . : . :
rJMSF026D19- GATCTTGACTGGTTTTAATATCTGCATCTAGTTGGTGTAGTTGAACAATCAGGTCATTAT
JMFN046O01+ GATCTTGACTGGTTTTAATATCTGCATCTAGTTGGTGTAGTTGAACAATCAGGTCATTAT
rJMSF007K09- GATCTTGACTGGTTTTAATATCTGCATCTAGTTGGTGTAGTTGAACAATCAGGTCATTAT
                      ____________________________________________________________
consensus GATCTTGACTGGTTTTAATATCTGCATCTAGTTGGTGTAGTTGAACAATCAGGTCATTAT
 
. : . : . : . : . : . :
rJMSF026D19- ACAGCCGTCCTTCCGCTAAAACGGTTTGCTCTAACTCCTGAAGATGGCGCCGTAACACAG
JMFN046O01+ ACAGCCGTCCTTCCGCTAAAACGGTTTGCTCTAACTCCTGAAGATGGCGCCGTAACACAG
rJMSF007K09- ACAGCCGTCCTTCCGCTAAAACGGTTTGCTCTAACTCCTGAAGATGGCGCCGTAACACAG
                      ____________________________________________________________
consensus ACAGCCGTCCTTCCGCTAAAACGGTTTGCTCTAACTCCTGAAGATGGCGCCGTAACACAG
 
. : . : . : . : . : . :
rJMSF026D19- CAGAATCCTGCGTATTAGCCATGAGGTAACTCAAATCCTGACGGACGAAGACCGGTGATT
JMFN046O01+ CAGAATCCTGCGTATTAGCCATGAGGTAACTCAAATCCTGACGGACGAAGACCGGTGATT
rJMSF007K09- CAGAATCCTGCGTATTAGCCATGAGGTAACTCAAATCCTGACGGACGAAGACCGGTGATT
                      ____________________________________________________________
consensus CAGAATCCTGCGTATTAGCCATGAGGTAACTCAAATCCTGACGGACGAAGACCGGTGATT
 
. : . : . : . : . : . :
rJMSF026D19- GCGATCGAGGACGACGAGCGAAGACGGAGCGAAGACGGATGACTGAAGGAGCGATCAAGG
JMFN046O01+ GCGATCGAGGACGACGAGCGAAGACGGAGCGAAGACGGATGACTGAAGGAGCGATCAAGG
rJMSF007K09- GCGATCGAGGACGACGAGCGAAGACGGAGCGAAGACGGATGACTGAAGGAGCGATCAAGG
                      ____________________________________________________________
consensus GCGATCGAGGACGACGAGCGAAGACGGAGCGAAGACGGATGACTGAAGGAGCGATCAAGG
 
. : . : . : . : . : . :
rJMSF026D19- ACGACGAGCGAAGACGATGATGGAGCGACCTGGCTCAAATTCTGACGGACGAAGACCGGT
JMFN046O01+ ACGACGAGCGAAGACGATGATGGAGCGA
rJMSF007K09- ACGACGAGCGAAGACGATGATGGAGCGACCTGGCTCAAATTCTGACGGACGAAGACCGGT
                      ____________________________________________________________
consensus ACGACGAGCGAAGACGATGATGGAGCGACCTGGCTCAAATTCTGACGGACGAAGACCGGT
 
. : . : . : . : . : . :
rJMSF026D19- GAGTCGATCGAGGACGACGAGCGAAGACGAATGACTGAAGGAGCGATCAAGGACGACGAG
rJMSF007K09- GAGTCGATCGAGGACGACGAGCGAAGACGAATGACTGAAGGAGCGATCAAGGACGACGAG
JMFN043M10+ GAGCGAAGACGAATGACTGAAGGAGCGATCAAGGACGACGAG
                      ____________________________________________________________
consensus GAGTCGATCGAGGACGACGAGCGAAGACGAATGACTGAAGGAGCGATCAAGGACGACGAG
 
. : . : . : . : . : . :
rJMSF026D19- CGAAGACGATGATGGAGCGACCTGGCTCAAACGGACGAANACCGGTGATTCGATCGAGGA
rJMSF007K09- CGAAGACGATGATGGAGCGACCTGGCTCAAACGGACGAAGACCGGTGATNCGATCGAGGA
JMFN043M10+ CGAAGACGATGATGGAGCGACCTGGCTCAAACGGACGAAGACCGGTGATTCGATCGAGGA
                      ____________________________________________________________
consensus CGAAGACGATGATGGAGCGACCTGGCTCAAACGGACGAAGACCGGTGATTCGATCGAGGA
 
. : . : . : . : . : . :
rJMSF026D19- CGACGAGCGAAGACGGAGGAAGGAGCAGCGAAAACGGATGACTGATTTAGGAGCGATTGA
rJMSF007K09- CGACNAGCGAAGACGGAGGAAGGAGCANCGAAAACGGATGACTGATTNAGGAGCGATTGA
JMFN043M10+ CGACGAGCGAAGACGGAGGAAGGAGCAGCGAAGACGGATGACTGATTTAGGAGCGATTGA
                      ____________________________________________________________
consensus CGACGAGCGAAGACGGAGGAAGGAGCAGCGAAAACGGATGACTGATTTAGGAGCGATTGA
 
. : . : . : . : . : . :
rJMSF026D19- GNACGACGAGCGAA
rJMSF007K09- GGACGACNAGCGAA
JMFN043M10+ GGACGACGAGCGAAACGGATGAAGACGGATGAAAGAGCCGCTGGATCTTCGACCGGTGAG
                      ____________________________________________________________
consensus GGACGACGAGCGAAACGGATGAAGACGGATGAAAGAGCCGCTGGATCTTCGACCGGTGAG
 
. : . : . : . : . : . :
JMFN043M10+ AGAGTCGAAGATCTTTTTGAATCTTCTAGATCCCACACCTTTATTAACCTGGATGAAGAT
JMSF026D19+ TTTTTGAATCTTCTAGATCCCACACCTTTATTAACCTGGATGAAGAT
                      ____________________________________________________________
consensus AGAGTCGAAGATCTTTTTGAATCTTCTAGATCCCACACCTTTATTAACCTGGATGAAGAT
 
. : . : . : . : . : . :
JMFN043M10+ CCAGCAGTTACTAAAATCTCAGCTGAATCAAAGGTTATAGACTCTACGGAACTTGTGTGG
JMSF026D19+ CCAGCAGTTACTAAAATCTCAGCTGAATCAAAAGTTATAGACTCTACGGAACTTGTGTGG
                      ____________________________________________________________
consensus CCAGCAGTTACTAAAATCTCAGCTGAATCAAAGGTTATAGACTCTACGGAACTTGTGTGG
 
. : . : . : . : . : . :
JMFN043M10+ CCAGATAGGGCCTTTATCAATTTTGTCTTAGATTTTGGGATTTTTGGAGAGGAACTTTTC
JMSF026D19+ CCAGATAGGGCCTTTATCAATTTTGTCTTAGATTTTGGGATTTTTGGAGAGGAACTTTTC
JMSF007K09+ TTTTGGAGAGGAACTTTTC
                      ____________________________________________________________
consensus CCAGATAGGGCCTTTATCAATTTTGTCTTAGATTTTGGGATTTTTGGAGAGGAACTTTTC
 
. : . : . : . : . : . :
JMFN043M10+ GACTTCGTGATTGCTCTATATGTACACCGTCAAATCTTTGGAATGGCTTTCAACTATTAT
JMSF026D19+ GACTTCGTGATTGCTCTATATGTACACCGTCAAATCTTTGGAATGGCTTTCAACTCTTAT
JMSF007K09+ GACTTCGTGATTGCTCTATATGTACACCGTCAAATCTTNGGAATGGCTTTCAACTCTTAT
                      ____________________________________________________________
consensus GACTTCGTGATTGCTCTATATGTACACCGTCAAATCTTTGGAATGGCTTTCAACTCTTAT
 
. : . : . : . : . : . :
JMFN043M10+ TTTTCTTCCTTCACTCTCAGGTGTACATAGATCAGGTGATGTAGACAGCCTATGTATAGC
JMSF026D19+ TTTTCTTCCTTCACTCTCAGGTGTACATAGATCAGGTGATGTAGACAGCCTATGTATAGC
JMSF007K09+ TTTTCTTCCTTCACTCTCAGGTGTACATAGATCAGGTGATGTAGACAGCCTATGTATAGC
                      ____________________________________________________________
consensus TTTTCTTCCTTCACTCTCAGGTGTACATAGATCAGGTGATGTAGACAGCCTATGTATAGC
 
. : . : . : . : . : . :
JMFN043M10+ TATGGATGTTGAGTTTTCTCTTTCGATGCAACTTATGTTGAAGACGGTACGAAGGACTGC
JMSF026D19+ TATGGATGTTGAGTTTTCTCTTTCGATGCAACTTATGTTGAAGACGGTACGAAGGACTGC
JMSF007K09+ TATGGATGTTGAGTTTTCTCTTTCGATGCAACTTATGTTGAAGACGGTACGAAGGACTGC
                      ____________________________________________________________
consensus TATGGATGTTGAGTTTTCTCTTTCGATGCAACTTATGTTGAAGACGGTACGAAGGACTGC
 
. : . : . : . : . : . :
JMFN043M10+ AATAATTGGTTTACGATGAT
JMSF026D19+ AATAATTGGTTTACGATGATTATTTTAGCTAATTAGGTGCGAATTGGAGTTAAATTTGGT
JMSF007K09+ AATAATTGGTTTACGATGATTATTTTAGCTAATTAGGTGCGAATTGGAGTTAAATTTGGT
                      ____________________________________________________________
consensus AATAATTGGTTTACGATGATTATTTTAGCTAATTAGGTGCGAATTGGAGTTAAATTTGGT
 
. : . : . : . : . : . :
JMSF026D19+ GTTAGATATTACAGGGTAAAGTGAGCTTTTGGTTTTTGATGGATTTGTATCCATTTCTAT
JMSF007K09+ GTTAGATATTACAGGGTAAAGTGAGCTTTTGGTTTTTGATGGATTTGTATCCATTTCTAT
                      ____________________________________________________________
consensus GTTAGATATTACAGGGTAAAGTGAGCTTTTGGTTTTTGATGGATTTGTATCCATTTCTAT
 
. : . : . : . : . : . :
JMSF026D19+ GTACGGAGTGGTCGTCTATGGCTTTGCGAGGAAGACGACCACGAAGGGCAGAAATGGGGA
JMSF007K09+ GTACGGAGTGGTCGTCTATGGCTTTGCGAGGAAGACGACCACGAAGGGCAGAAATGGGGA
                      ____________________________________________________________
consensus GTACGGAGTGGTCGTCTATGGCTTTGCGAGGAAGACGACCACGAAGGGCAGAAATGGGGA
 
. : . : . : . : . : . :
JMSF026D19+ AGAAGACTGGGTTGAACCGATGGATTACGGAGTGAGGTGCTCTTTTGATTTTCTATGGCT
JMSF007K09+ AGAAGACTGGGTTGAACCGATGGATTACGGAGTGAGGTGCTCTTTTGATTTTCTATGGCT
                      ____________________________________________________________
consensus AGAAGACTGGGTTGAACCGATGGATTACGGAGTGAGGTGCTCTTTTGATTTTCTATGGCT
 
. : . : . : . : . : . :
JMSF026D19+ TCGTCTCCATTTCTGTGGAGTGTGGATGGATTGTCGGTTTAGGGAAGAAGACGAAGTGCC
JMSF007K09+ TCGTCTCCATTTCTGTGGAGTGTGGATGGATTGTCGGTTTAGGGAAGAAGACGAAGTGCC
                      ____________________________________________________________
consensus TCGTCTCCATTTCTGTGGAGTGTGGATGGATTGTCGGTTTAGGGAAGAAGACGAAGTGCC