Previous Contig 004900:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS039C09Sequence640004900 (3)gb:OSA535049_16926604e-50Oryza sativa (japonica cultivar-group) partial pdr6 gene for PDR-like ABC transp
JMSF007J17Sequence327004900 (3)pir|T02644|T026443e-04ABC-type transport protein homolog F12C20.5 - Arabidopsis thaliana>gb:AC005168_1739013848 (2)pir|T02644|T026441e-60ABC-type transport protein homolog F12C20.5 - Arabidopsis thaliana>gb:AC005168_1
JMSF049M07Sequence703004900 (3)gb:OSA535049_16926609e-52Oryza sativa (japonica cultivar-group) partial pdr6 gene for PDR-like ABC transp714013848 (2)pir|T02644|T026444e-48ABC-type transport protein homolog F12C20.5 - Arabidopsis thaliana>gb:AC005168_1

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS039C09+ CCAATCGC
JMSF049M07+ GCCAATCGC
                      ____________________________________________________________
consensus GCCAATCGC
 
. : . : . : . : . : . :
JMFS039C09+ GCTGGCTGACATATGCAGACGTTCTCTGAGGCACAAACTCATTCAGATTGTGCCCATGNT
JMSF049M07+ GCTGGCTGACATATGCAGACGTTCTCTGAGGCACAAACTCATTCAGATTGTGCCCATTGT
                      ____________________________________________________________
consensus GCTGGCTGACATATGCAGACGTTCTCTGAGGCACAAACTCATTCAGATTGTGCCCATTGT
 
. : . : . : . : . : . :
JMFS039C09+ ATGTAATCTTCCCTGACATCTTCAAACCAGGCCCAAGGCGCCCGGCAAGAGCCAAAAGCA
JMSF049M07+ ATGTAATCTTCCCTGACATCTTCAAACCAGGCCCAAGGCGCCCGGCAAGAGCCAAAAGCA
                      ____________________________________________________________
consensus ATGTAATCTTCCCTGACATCTTCAAACCAGGCCCAAGGCGCCCGGCAAGAGCCAAAAGCA
 
. : . : . : . : . : . :
JMFS039C09+ AAGTAGTCTTCCCAGAGCTCGGAGGGCCGAGAAGAAGAGTCAGCCTTGAAGGCCTTAGGA
JMSF049M07+ AAGTAGTCTTCCCAGAGCTCGGAGGGCCGAGAAGAAGAGTCAGCCTTGAAGGCCTTAGGA
                      ____________________________________________________________
consensus AAGTAGTCTTCCCAGAGCTCGGAGGGCCGAGAAGAAGAGTCAGCCTTGAAGGCCTTAGGA
 
. : . : . : . : . : . :
JMFS039C09+ TGCCACTGATGTTATTTAGGACAGACAGCCTCTTCCTCCGGCTGGGAAAAATCCTCAACT
JMSF049M07+ TGCCACTGATGTTATTTAGGACAGACAGCCTCTTCCTCCGGCTGGGAAAAATCCTCAACT
                      ____________________________________________________________
consensus TGCCACTGATGTTATTTAGGACAGACAGCCTCTTCCTCCGGCTGGGAAAAATCCTCAACT
 
. : . : . : . : . : . :
JMFS039C09+ TTCTCAAGAATGCCTCTGTCATGTTGAATAAGAAATTGGGGATTGTTGGTAAGGCTCTAC
JMSF049M07+ TTCTCAAGAATGCCTCTGTCATGTTGAATAAGAAATTGGGGATTGTTGGTAAGGCTCTAC
                      ____________________________________________________________
consensus TTCTCAAGAATGCCTCTGTCATGTTGAATAAGAAATTGGGGATTGTTGGTAAGGCTCTAC
 
. : . : . : . : . : . :
JMFS039C09+ TCCCTTCATGGACAAATGCATCCACCTTAAGATCTTGAAACCGAACTTCAACCTTTGGAA
JMSF049M07+ TCCCTTCATGGACAAATGCATCCACCTTAAGATCTTGAAACCGAACTTCAACCTTTGGAA
                      ____________________________________________________________
consensus TCCCTTCATGGACAAATGCATCCACCTTAAGATCTTGAAACCGAACTTCAACCTTTGGAA
 
. : . : . : . : . : . :
JMFS039C09+ ACTCCAAATCAACCGCCTCGAATCTCTGCCTAACTCGTCGGAAGAACAGCTCGGTATCCT
JMSF049M07+ ACTCCAAATCAACCGCCTCGAATCTCTGCCTAACTCGTCGGAAGAACAGCTCGGTATCCT
JMSF007J17+ CTCGTCGGAAGAACAGCTCGGTATCCT
                      ____________________________________________________________
consensus ACTCCAAATCAACCGCCTCGAATCTCTGCCTAACTCGTCGGAAGAACAGCTCGGTATCCT
 
. : . : . : . : . : . :
JMFS039C09+ CATCAATAGCAGCAATCATCTTCTCCAACACCTCCTCCTGTTCTTGTTCTTTGAGCTTCC
JMSF049M07+ CATCAATAGCAGCAATCATCTTCTCCAACACCTCCTCCTGTTCTTGTTCTTTGAGCTTCC
JMSF007J17+ CATCAATAGCAGCAATCATCTTCTCCAACACCTCCTCCTGTTCTTGTTCTTTGAGCTTCC
                      ____________________________________________________________
consensus CATCAATAGCAGCAATCATCTTCTCCAACACCTCCTCCTGTTCTTGTTCTTTGAGCTTCC
 
. : . : . : . : . : . :
JMFS039C09+ CAACATCCAGCACAGAAACCTCTCCATCCTGGCCAATAAAGACCGAATTCCGGGCACGAA
JMSF049M07+ CAACATCCAGCACAGAAACCTCTCCATCCTGGCCAATAAAGACCGAATTCCGGGCACGAA
JMSF007J17+ CAACATCCAGCACAGAAACCTCTCCATCCTGGCCAATAAAGACCGAATTCCGGGCACGAA
                      ____________________________________________________________
consensus CAACATCCAGCACAGAAACCTCTCCATCCTGGCCAATAAAGACCGAATTCCGGGCACGAA
 
. : . : . : . : . : . :
JMFS039C09+ AGACGGTGGGAGACCTCTGCAGGGCAGCCTTGATGAGTGCTTCCTCATCACTGCACCCAC
JMSF049M07+ AGACGGTGGGAGACCTCTGCAGGGCAGCCTTGATGAGTGCTTCCTCATCACTGCACCCAC
JMSF007J17+ AGACGGTGGGAGACCTCTGCAGGGCAGCCTTGATGAGTGCTTCCTCATCACTGCACCCAC
                      ____________________________________________________________
consensus AGACGGTGGGAGACCTCTGCAGGGCAGCCTTGATGAGTGCTTCCTCATCACTGCACCCAC
 
. : . : . : . : . : . :
JMFS039C09+ CACTCTGGGCTAATCTT
JMSF049M07+ CACTCTGGGCTAATCTTGAAAACATGATTTCTTTGGGACTCCACATTGTGGTGTGCAGTG
JMSF007J17+ CACTCTGGGCTAATCTTGAAAACATGATTTCTTTGGGACTCCACATTGTGGTGTGCAGTG
                      ____________________________________________________________
consensus CACTCTGGGCTAATCTTGAAAACATGATTTCTTTGGGACTCCACATTGTGGTGTGCAGTG
 
. : . : . : . : . : . :
JMSF049M07+ GAGAGAGTGGAAACCAGGCCTTTCATATAGCTC
JMSF007J17+ GAGAGAGTGGAAACCAGGCCTTTCATATAGCTCAGTTGGTCTAGTTTTTGGTTAATGTTC
                      ____________________________________________________________
consensus GAGAGAGTGGAAACCAGGCCTTTCATATAGCTCAGTTGGTCTAGTTTTTGGTTAATGTTC