Previous Contig 004896:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF015C24Sequence580004896 (8)pir|C86228|C862286e-63hypothetical protein [imported] - Arabidopsis thaliana>gb:AE005172_889954 Arabid764010655 (10)pir|E86228|E862282e-43hypothetical protein [imported] - Arabidopsis thaliana>gb:AE005172_889956 Arabid
JMFF016A07Sequence565004896 (8)pir|C86228|C862286e-62hypothetical protein [imported] - Arabidopsis thaliana>gb:AE005172_889954 Arabid712010655 (10)pir|T16995|T169956e-49probable cinnamyl-alcohol dehydrogenase (EC 1.1.1.195) - apple tree>gb:AF053084_
JMFF046J11Sequence556004896 (8)pir|T16995|T169952e-61probable cinnamyl-alcohol dehydrogenase (EC 1.1.1.195) - apple tree>gb:AF053084_446010655 (10)gb:AX002650_14558474e-14Sequence 1 from Patent EP0856584.>gb:AX002652_1455848 Sequence 3 from Patent EP0
JMFF049A17Sequence457004896 (8)pir|C86228|C862281e-48hypothetical protein [imported] - Arabidopsis thaliana>gb:AE005172_889954 Arabid451010655 (10)pir|T16995|T169957e-15probable cinnamyl-alcohol dehydrogenase (EC 1.1.1.195) - apple tree>gb:AF053084_
JMSF007I18Sequence388004896 (8)gb:AY088448_15734675e-41Arabidopsis thaliana clone 6748 mRNA, complete sequence.387006932 (53)gb:AP003722_18323991e-34Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC clone:B101
JMSF016D11Sequence495004896 (8)pir|C86228|C862285e-48hypothetical protein [imported] - Arabidopsis thaliana>gb:AE005172_889954 Arabid771010655 (10)pir|T16995|T169951e-62probable cinnamyl-alcohol dehydrogenase (EC 1.1.1.195) - apple tree>gb:AF053084_
JMSF041H01Sequence423004896 (8)gb:AY088448_15734677e-31Arabidopsis thaliana clone 6748 mRNA, complete sequence.736013885 (3)gb:AK175372_18173604e-36Arabidopsis thaliana mRNA, complete cds, clone: RAFL21-81-A09.
JMSF044N02Sequence721004896 (8)pir|C86228|C862281e-75hypothetical protein [imported] - Arabidopsis thaliana>gb:AE005172_889954 Arabid702010655 (10)pir|T16995|T169952e-55probable cinnamyl-alcohol dehydrogenase (EC 1.1.1.195) - apple tree>gb:AF053084_

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF044N02+ C
                      ____________________________________________________________
consensus C
 
. : . : . : . : . : . :
JMSF044N02+ TCTAACATCAACATAGCAATTGAATGGGGAAGACATGAACTCCCTTCCTTCTTTTATGGT
                      ____________________________________________________________
consensus TCTAACATCAACATAGCAATTGAATGGGGAAGACATGAACTCCCTTCCTTCTTTTATGGT
 
. : . : . : . : . : . :
JMSF044N02+ GTCCAGAATCATCTCACTTGAAAAATTAAGAATTGGTTGTAAAAGAGGGCCAATAACAAG
                      ____________________________________________________________
consensus GTCCAGAATCATCTCACTTGAAAAATTAAGAATTGGTTGTAAAAGAGGGCCAATAACAAG
 
. : . : . : . : . : . :
JMFF046J11+ CAGCATATTTCCATGCTGCTTC
JMFF016A07+ TATTCTCCCCAGCATATTTCCATGCTGCTTC
JMFF015C24+ AAACCATGTCGATCCTATTCTCCCCAGCATATTTCCATGCTGCTTC
JMSF044N02+ AGCAGGGTGCAGTGAAACCATGTCGATCCTATTCTCCCCAGCATATTTCCATGCTGCTTC
                      ____________________________________________________________
consensus AGCAGGGTGCAGTGAAACCATGTCGATCCTATTCTCCCCAGCATATTTCCATGCTGCTTC
 
. : . : . : . : . : . :
JMFF046J11+ CTCAGCAAAGACTTTAGACAAGATATACCATTGCTTTGTTTCCTCTGCAAATTCTTTATC
JMSF016D11+ TCTGCAAATTCTTTATC
JMFF016A07+ CTCAGCAAAGACTTTAGACAAGATATACCATTGCTTTGTTTCCTCTGCAAATTCTTTATC
JMFF015C24+ CTCAGCAAAGACTTTAGACAAGATATACCATTGCTTTGTTTCCTCTGCAAATTCTTTATC
JMSF044N02+ CTCAGCAAAGACTTTAGACAAGATATACCATTGCTTTGTTTCCTCTGCAAATTCTTTATC
                      ____________________________________________________________
consensus CTCAGCAAAGACTTTAGACAAGATATACCATTGCTTTGTTTCCTCTGCAAATTCTTTATC
 
. : . : . : . : . : . :
JMFF046J11+ AGAAAACCAAGTGTCATCGATTACGTCAGTTGGACTTATAGGATTTGGTTTGTACATAAT
JMSF016D11+ AGAAAACCAAGTGTCATCGATTACGTCAGTTGGACTTATAGGATTTGGTTTGTACATAAT
JMFF049A17+ CGATTACGTCAGTGGGACTTATAGGATTTGGTTTGTACATAAT
JMFF016A07+ AGAAAACCAAGTGTCATCGATTACGTCAGTTGGACTTATAGGATTTGGTTTGTACATAAT
JMFF015C24+ AGAAAACCAAGTGTCATCGATTACGTCAGTTGGACTTATAGGATTTGGTTTGTACATAAT
JMSF044N02+ AGAAAACCAAGTGTCATCGATTACGTCAGTTGGACTTATAGGATTTGGTTTGTACATAAT
                      ____________________________________________________________
consensus AGAAAACCAAGTGTCATCGATTACGTCAGTTGGACTTATAGGATTTGGTTTGTACATAAT
 
. : . : . : . : . : . :
JMFF046J11+ GGTTGCCGTTGAGGACGTCAGCACTATTCTTTTCACAGAAGGTGTTCTCACACATGATTC
JMSF016D11+ GGTTGCCGTTGAGGACGTCAGCACTATTCTTTTCACAGAAGGTGTTCTCACACATGATTC
JMFF049A17+ GGTGGCCGTTGAGGACGTCAGCACTATTCTTTTCACAGAAGGTGTTCTCACACATGATTC
JMFF016A07+ GGTTGCCGTTGAGGACGTCAGCACTATTCTTTTCACAGAAGGTGTTCTCACACATGATTC
JMFF015C24+ GGTTGCCGTTGAGGACGTCAGCACTATTCTTTTCACAGAAGGTGTTCTCACACATGATTC
JMSF044N02+ GGTTGCCGTTGAGGACGTCAGCACTATTCTTTTCACAGAAGGTGTTCTCACACATGATTC
JMSF007I18+ TCACAGAAGGTGTTCTCACACATGATTC
                      ____________________________________________________________
consensus GGTTGCCGTTGAGGACGTCAGCACTATTCTTTTCACAGAAGGTGTTCTCACACATGATTC
 
. : . : . : . : . : . :
JMFF046J11+ AAGAACGTTTAGTGTCCCATTTACTGCAGGACTCACTAGCTCTGCCTTAGTTGCAGATGG
JMSF016D11+ AAGAACGTTTAGTGTCCCATTTACTGCAGGACTCACTAGCT----CTTAGTTGCAGATGG
JMFF049A17+ AAGAACGTTTAGTGTCCCATTTACTGCAGGACTCACTAGCTCTGCCTTAGTTGCAGATGG
JMSF041H01+ CCTTAGTTGCTGATGG
JMFF016A07+ AAGAACGTTTAGTGTCCCATTTACTGCAGGACTCACTAGCTCTGCCTTAGTTGCAGATGG
JMFF015C24+ AAGAACGTTTAGTGTCCCATTTACTGCAGGACTCACTAGCTCTGCCTTAGTTGCAGATGG
JMSF044N02+ AAGAACGTTTAGTGTCCCATTTACTGCAGGACTCACTAGCTCTGCCTTAGTTGCAGATGG
JMSF007I18+ AAGAACGTTTAGTGTCCCATTTACTGCAGGACTCACTAGCTCTGCCTTAGTTGCAGATGG
                      ____________________________________________________________
consensus AAGAACGTTTAGTGTCCCATTTACTGCAGGACTCACTAGCTCTGCCTTAGTTGCAGATGG
 
. : . : . : . : . : . :
JMFF046J11+ TGAAAAAGAAACAGGTGATGCTGTGTGGAAAACACCTTCACACCCATTAATTGCAGAATC
JMSF016D11+ TGAAAAAGAAACAGGTGATGCTGTGTGGAAAACACCTTCACACCCATTAATTGCAGAATC
JMFF049A17+ TGAAAAAGAAACAGGTGATGCTGTGTGGAAAACACCTTCACACCCATTAATTGCAGAATC
JMSF041H01+ TGATAAATCTACAGGTGATGCTGTGTGAAAAACACCTTCACATCCATTAATTGCATCATC
JMFF016A07+ TGAAAAAGAAACAGGTGATGCTGTGTGGAAAACACCTTCACACCCATTAATTGCAGAATC
JMFF015C24+ TGAAAAAGAAACAGGTGATGCTGTGCGGAAAACACCTTCACACCCATTAATTGCAGAATC
JMSF044N02+ TGAAAAAGAAACAGGTGATGCTGTGTGGAAAACACCTTCACACCCATTAATTGCAGAATC
JMSF007I18+ TGAAAAAGAAACAGGTGATGCTGTGTGGAAAACACCTTCACACCCATTAATTGCAGAATC
                      ____________________________________________________________
consensus TGAAAAAGAAACAGGTGATGCTGTGTGGAAAACACCTTCACACCCATTAATTGCAGAATC
 
. : . : . : . : . : . :
JMFF046J11+ AAAAGAGTTTTCCTCAACTAAGTCAGCTTCAAACAAATGCAGTCTTTCTTTGGCACCATC
JMSF016D11+ AAAAGAGTTTTCCTCAACTAAGTCAGCTTCAAACAAATGCAGTCTTTCTTTGGCACCATC
JMFF049A17+ AAAAGAGTTTTCCTCAACTAAGTCAGCTTCAAACAAATGCAGTCTTTCTTTGGCACCATC
JMSF041H01+ AAAAGAGTTTTCCTTAAGTAAGTCGGCTTCAAACAAATGCAATCTTTCCTTAGCACCATC
JMFF016A07+ AAAAGAGTTTTCCTCAACTAAGTCAGCTTCAAACAAATGCAGTCTTTCTTTGGCACCATC
JMFF015C24+ AAAAGAGTTTTCCTCAACTAAGTCAGCTTCAAACAAATGCAGTCTTTCTTTGGCACCATC
JMSF044N02+ AAAAGAGTTTTCCTCAACTAAGTCAGCTTCAAACAAATGCAGTCTTTCTTTGGCACCATC
JMSF007I18+ AAAAGAGTTTTCCTCAACTAAGTCAGCTTCAAACAAATGCAGTCTTTCTTTGGCACCATC
                      ____________________________________________________________
consensus AAAAGAGTTTTCCTCAACTAAGTCAGCTTCAAACAAATGCAGTCTTTCTTTGGCACCATC
 
. : . : . : . : . : . :
JMFF046J11+ TAATGCAAGAAGATGTGACACCTTATTTGGATCCTTGAGGCTGCGAACGGTGGCGTGGAC
JMSF016D11+ TAATGCAAGAAGATGTGACACCTTATTTGGATCCTTGAGGCTGCGAACGGTGGCGTGGAC
JMFF049A17+ TAATGCAAGAAGATGTGACACCTTATTTGGATCCTTGAGGCTGCGAACGGTGGCGTGGAC
JMSF041H01+ TAATGCAAGAAGATGTGACACCTTACTTGGAACCTTGAGGCTGCGAATGGTGGCGTGGAC
JMFF016A07+ TAATGCAAGAAGATGTGACACCTTATTTGGATCCTTGAGGCTGCGAACGGTGGCGTGGAC
JMFF015C24+ TAATGCAAGAAGATGTGACACCTTATTTGGATCCTTGAGGCTGCGAACGGTGGCGTGGAC
JMSF044N02+ TAATGCAAGAAGATGTGACACCTTATTTGGATCCTTGAGGCTGCGAACGGTGGCGTGGAC
JMSF007I18+ TAATGCAAGAAGATGTGACACCTTATTTGGATCCTTGAGGCTGCGAACGGTGGCGTGGAC
                      ____________________________________________________________
consensus TAATGCAAGAAGATGTGACACCTTATTTGGATCCTTGAGGCTGCGAACGGTGGCGTGGAC
 
. : . : . : . : . : . :
JMFF046J11+ GGTGTAACCACGGTGGAGCAAAAGCTTGACGAGCCAAGAAGCTATGAAGCCGGAAGCACC
JMSF016D11+ GGTGTAACCACGGTGGAGCAAAAGCTTGACGAGCCAAGAAGCTATGAAGCCGGAAGCACC
JMFF049A17+ GGTGTAACCACGGTGGAGCAAAAGCTTGACGAGCCAAGAAGCTATGAAGCCGGAAGCACC
JMSF041H01+ GGTGTAACCACGGTGGAGCAAAAGCTTGACGAGCCAAGAAGCTATGAAGCCGGAAGCACC
JMFF016A07+ GGTGTAACCACGGTGGAGCAAAAGCTTGACGAGCCAAGAAGCTATGAAGCCGGAAGCACC
JMFF015C24+ GGTGTAACCACGGTGGAGCAAAAGCTTGACGAGCCAAGAAGCTATGAAGCCGGAAGCACC
JMSF044N02+ GGTGTAACCACGGTGGAGCAAAAGCTTGACGAGCCAAGAAGCTATGAAGCCGGAAGCACC
JMSF007I18+ GGTGTAACCACGGTGGAGCAAAAGCTTGACGAGCCAAGAAGCTATGAAGCCGGAAGCACC
                      ____________________________________________________________
consensus GGTGTAACCACGGTGGAGCAAAAGCTTGACGAGCCAAGAAGCTATGAAGCCGGAAGCACC
 
. : . : . : . : . : . :
JMFF046J11+ GGTCACGCATACCACCTTCCCCTCACCGCTCATCCTCTTCTTTTAGATAATAAT
JMSF016D11+ GGTCACGCATACCACCTTCCCCTCACCGCTCATCCTCT
JMFF049A17+ GGTCACGCATACCACCTTCCCCTCACCGCTCATCCTCTTCTTTTAGATAATAAT
JMSF041H01+ GGTCACGCATAC
JMFF016A07+ GGTCACGCATACCACCTTCCCCTCACCGCTCATCCTCTTCTTTTAGATAATAAT
JMFF015C24+ GGTCACGCATACCACCTTCCCCTCACCGCTCATCCTCTTCTTTTAGATAATAAT
JMSF044N02+ GGTCACGCATACCAACTTCCCCTCACCGCTCATCCTCTTCTTTTAGATAATAAT
JMSF007I18+ GGTCACGCATACCACCTTCCCCTCACCGCTCATCCTCTTCTTTTAGATAATAATAAACTC
                      ____________________________________________________________
consensus GGTCACGCATACCACCTTCCCCTCACCGCTCATCCTCTTCTTTTAGATAATAATAAACTC