Previous Contig 004893:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF007I02Sequence376004893 (3)pir|T51461|T514617e-21hypothetical protein K10A8_50 - Arabidopsis thaliana>gb:ATK10A8_1553508 Arabidop792004893 (3)pir|T51461|T514615e-40hypothetical protein K10A8_50 - Arabidopsis thaliana>gb:ATK10A8_1553508 Arabidop
JMSF029K09Sequence676004893 (3)pir|T51461|T514613e-69hypothetical protein K10A8_50 - Arabidopsis thaliana>gb:ATK10A8_1553508 Arabidop707023402pir|T51461|T514611e-28hypothetical protein K10A8_50 - Arabidopsis thaliana>gb:ATK10A8_1553508 Arabidop

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF007I02- AGTTACATGTCTTGCAATACAAG
                      ____________________________________________________________
consensus AGTTACATGTCTTGCAATACAAG
 
. : . : . : . : . : . :
rJMSF007I02- TATGAAGAAGATCCAGGGGGCTCAGGCACAGACAGTGTGTGCCTCGGTTACTTTAAGAGA
                      ____________________________________________________________
consensus TATGAAGAAGATCCAGGGGGCTCAGGCACAGACAGTGTGTGCCTCGGTTACTTTAAGAGA
 
. : . : . : . : . : . :
rJMSF007I02- AAGCAATCTGAACTAATCTCGAAGCTAAAATGCACATATCAACGAGAGAGGTATCCCGAA
                      ____________________________________________________________
consensus AAGCAATCTGAACTAATCTCGAAGCTAAAATGCACATATCAACGAGAGAGGTATCCCGAA
 
. : . : . : . : . : . :
rJMSF007I02- GATTATAATGTATTGTGAGATTTTAATATATAGTTCCATGAAAGAATTGAAATGAATACT
                      ____________________________________________________________
consensus GATTATAATGTATTGTGAGATTTTAATATATAGTTCCATGAAAGAATTGAAATGAATACT
 
. : . : . : . : . : . :
rJMSF007I02- AGAATAGTAATTGCATTGCATCTAGCAATTAAATGACCACTGAAGTTGAAGTTTGTTTAC
                      ____________________________________________________________
consensus AGAATAGTAATTGCATTGCATCTAGCAATTAAATGACCACTGAAGTTGAAGTTTGTTTAC
 
. : . : . : . : . : . :
rJMSF007I02- TCCTTCAATGACGCAATATCTAAACAAAAGGAACACAATCACTACCTCACTGCTGCACTT
                      ____________________________________________________________
consensus TCCTTCAATGACGCAATATCTAAACAAAAGGAACACAATCACTACCTCACTGCTGCACTT
 
. : . : . : . : . : . :
rJMSF007I02- TTGAACCTTCGTATGAGAACAGCTGCCTTGCATTTGAAAAGCTTAAATCAGTGAGTTTTT
                      ____________________________________________________________
consensus TTGAACCTTCGTATGAGAACAGCTGCCTTGCATTTGAAAAGCTTAAATCAGTGAGTTTTT
 
. : . : . : . : . : . :
rJMSF007I02- CTTTGCTCATATCAAGTAAAGATGCTACGTAGTGAAGAACATGATGGATGTTGGCTGGAT
                      ____________________________________________________________
consensus CTTTGCTCATATCAAGTAAAGATGCTACGTAGTGAAGAACATGATGGATGTTGGCTGGAT
 
. : . : . : . : . : . :
rJMSF007I02- GGTTTAGGGTTTCTTTTGGCAGTGACGAAGAAGGCAAAGTTTTGGCGGAATTATCAGTTT
                      ____________________________________________________________
consensus GGTTTAGGGTTTCTTTTGGCAGTGACGAAGAAGGCAAAGTTTTGGCGGAATTATCAGTTT
 
. : . : . : . : . : . :
rJMSF007I02- CAGGAATTGGAATTTGTCCTTCACCACCACTTTCTTTAGAAGCAGAGGTTTCCTCTTCTA
                      ____________________________________________________________
consensus CAGGAATTGGAATTTGTCCTTCACCACCACTTTCTTTAGAAGCAGAGGTTTCCTCTTCTA
 
. : . : . : . : . : . :
rJMSF007I02- TCAAAAACAAAGTGTCTGGATTGTTTAATTTTGGAAAAGCATCGGGTGCATCTGTCTCCA
                      ____________________________________________________________
consensus TCAAAAACAAAGTGTCTGGATTGTTTAATTTTGGAAAAGCATCGGGTGCATCTGTCTCCA
 
. : . : . : . : . : . :
rJMSF007I02- ACAAAATCCTTTCGATAGGAATTGAACGTAACATCTTCTTTGCCTTGCTTTCTTTCAAAG
                      ____________________________________________________________
consensus ACAAAATCCTTTCGATAGGAATTGAACGTAACATCTTCTTTGCCTTGCTTTCTTTCAAAG
 
. : . : . : . : . : . :
rJMSF007I02- ACATCAGAAACCCAGAGAACGAGAAGTAAGCACCAAGCTTAGCAAATTCAGGAACCATTT
JMSF029K09+ AATTCAGGAACCATTT
                      ____________________________________________________________
consensus ACATCAGAAACCCAGAGAACGAGAAGTAAGCACCAAGCTTAGCAAATTCAGGAACCATTT
 
. : . : . : . : . : . :
rJMSF007I02- CAGCAGAGCCAAGGAAAGAATGAAGGATAACTCCNGAA-GGAACGGACCC
JMSF029K09+ CAGCAGAGCCAAGGAAAGAATGAAGGATAACTCCAGAAGGGAACGGACCCATAGATTTCA
                      ____________________________________________________________
consensus CAGCAGAGCCAAGGAAAGAATGAAGGATAACTCCAGAAGGGAACGGACCCATAGATTTCA
 
. : . : . : . : . : . :
JMSF029K09+ GTATCTCAAGAAGATCCCCATAAGCTCGGACACAATGAATAGACGCGGGTCTTTTCAACT
                      ____________________________________________________________
consensus GTATCTCAAGAAGATCCCCATAAGCTCGGACACAATGAATAGACGCGGGTCTTTTCAACT
 
. : . : . : . : . : . :
JMSF029K09+ CTTNGGCTAGCTGAAGTTGTTGGCGGAAGACTTCAACCTGATCAGCAAAATCAATCTTCT
                      ____________________________________________________________
consensus CTTNGGCTAGCTGAAGTTGTTGGCGGAAGACTTCAACCTGATCAGCAAAATCAATCTTCT
 
. : . : . : . : . : . :
JMSF029K09+ TTCCCATTGAACCTTTATCCAAACCAATCTCACCAACCGCAGCTTCAGGTGTAGCCTCAA
                      ____________________________________________________________
consensus TTCCCATTGAACCTTTATCCAAACCAATCTCACCAACCGCAGCTTCAGGTGTAGCCTCAA
 
. : . : . : . : . : . :
JMSF029K09+ AGTATTCCTTCAATGTTTTCAACCAATTAGGTGTCCTCTCGGCAATGAACCAGGGATGGA
JMSF007I02+ ATGAACCAGGGATGGA
                      ____________________________________________________________
consensus AGTATTCCTTCAATGTTTTCAACCAATTAGGTGTCCTCTCGGCAATGAACCAGGGATGGA
 
. : . : . : . : . : . :
JMSF029K09+ TCCCGAAATTTGGAACAACACAAGGATAGCTGTTGCTCATCTCCTTGACTATGTGCCAAT
JMSF007I02+ TCCCGAAATTTGGAACAACACAAGGATAGCTGTTGCTCATCTCCTTGACTATGTGCCAAT
                      ____________________________________________________________
consensus TCCCGAAATTTGGAACAACACAAGGATAGCTGTTGCTCATCTCCTTGACTATGTGCCAAT
 
. : . : . : . : . : . :
JMSF029K09+ CCTTCTCACACACACCGTTCACCGCAAAATGAACCACTCCTGTATCAAGAGTGGTCCTAA
JMSF007I02+ CCTTCTCACACACACCGTTCACCGCAAAATGAACCACTCCTGTATCAAGAGTGGTCCTAA
                      ____________________________________________________________
consensus CCTTCTCACACACACCGTTCACCGCAAAATGAACCACTCCTGTATCAAGAGTGGTCCTAA
 
. : . : . : . : . : . :
JMSF029K09+ TTAATTGTGGGACCATATTAAAGATCTTAGGGTCTTGGAGATGACAATGAGCATCAAAAA
JMSF007I02+ TTAATTGTGGGACCATATTAAAGATCTTAGGGTCTTGGAGATGACAATGAGCATCAAAAA
                      ____________________________________________________________
consensus TTAATTGTGGGACCATATTAAAGATCTTAGGGTCTTGGAGATGACAATGAGCATCAAAAA
 
. : . : . : . : . : . :
JMSF029K09+ GTTTCATTTCTGGCCTATATCAACTGCTGCAACACTCTTCTTTGTCTTTACTTTCCAGCA
JMSF007I02+ GTTTCATTTCTGGCCTATATCAACTGCTGCAACACTCTTCTTTGTCTTTATTTTCCAGCA
                      ____________________________________________________________
consensus GTTTCATTTCTGGCCTATATCAACTGCTGCAACACTCTTCTTTGTCTTTATTTTCCAGCA
 
. : . : . : . : . : . :
JMSF029K09+ GCCTTCTGTATCCTAAAATGCACACTTTTGCAAATCCACTCCTATAGTGTAACAGCTGCA
JMSF007I02+ GCCTTCTGTATCCTAAAATGCACACTTTTGCAAATCCACTCCTATAGTGTAACAGCTGCA
                      ____________________________________________________________
consensus GCCTTCTGTATCCTAAAATGCACACTTTTGCAAATCCACTCCTATAGTGTAACAGCTGCA
 
. : . : . : . : . : . :
JMSF029K09+ GCACTTATCTATGGAACTTAAAGGCTTAAAGCCTCGAGGCTCGAACTATCATCAGCA
JMSF007I02+ GCACTTATCTATGGAACTTAAAGGCTTAAAGCCTCGAGGCTCGAACTATCATCAGCACCC
                      ____________________________________________________________
consensus GCACTTATCTATGGAACTTAAAGGCTTAAAGCCTCGAGGCTCGAACTATCATCAGCACCC