Previous Contig 004889:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF041I09Sequence658004889 (5)gb:AE014186_9381700.009Plasmodium falciparum 3D7 chromosome 11 complete sequence.>gb:AE014838_1228904 P574010140 (2)gb:AC145120_17442726e-10Solanum demissum chromosome 5 BAC PGEC446O19 genomic sequence, complete sequence
JMFS013H01Sequence589004889 (5)sp|Q38834|R134_ARATH0.028Putative disease resistance RPP13-like protein 4.>pir|T08416|T08416 disease resi
JMFS108D03Sequence642004889 (5)gb:CP000027_791380.012Dehalococcoides ethenogenes 195, complete genome.
JMFS119F04Sequence614004889 (5)gb:AE014186_9381700.004Plasmodium falciparum 3D7 chromosome 11 complete sequence.>gb:AE014838_1228904 P
JMSF007H14Sequence279004889 (5)750011380 (6)

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS013H01+ TTCATCATCAAAACCAACCACATCTTCTC
                      ____________________________________________________________
consensus TTCATCATCAAAACCAACCACATCTTCTC
 
. : . : . : . : . : . :
JMFS013H01+ TTTCTACCACCGGAGCCATCCTCTGCATAATAGGTTGACCTCTGTTTGGGTCATCTATGA
                      ____________________________________________________________
consensus TTTCTACCACCGGAGCCATCCTCTGCATAATAGGTTGACCTCTGTTTGGGTCATCTATGA
 
. : . : . : . : . : . :
JMFS013H01+ GGGCCTGAAGAGCTACGCTGTTGTCTTGCCTGATTTTCTTAACCTTGTCTCTGATGCTTT
                      ____________________________________________________________
consensus GGGCCTGAAGAGCTACGCTGTTGTCTTGCCTGATTTTCTTAACCTTGTCTCTGATGCTTT
 
. : . : . : . : . : . :
JMFS013H01+ GGATCTCTCTCGCAGAAACGTTAACCTTGGCGTAATAAGCAAGTGTTTCCAAGTATCTGA
                      ____________________________________________________________
consensus GGATCTCTCTCGCAGAAACGTTAACCTTGGCGTAATAAGCAAGTGTTTCCAAGTATCTGA
 
. : . : . : . : . : . :
JMFS013H01+ GCACCCCTTTGTCTTTATACTTCTTCCGCCTCAATCACCACGTTTCGGATCTTCTCCACC
JMFS108D03+ CACC
JMFF041I09+ ACC
                      ____________________________________________________________
consensus GCACCCCTTTGTCTTTATACTTCTTCCGCCTCAATCACCACGTTTCGGATCTTCTCCACC
 
. : . : . : . : . : . :
JMFS013H01+ ACGTCGTTCAGGACTTCATTGTCGCCGGCGCTTTGGTTCTTCGACGCTTGCTTCAGATAT
JMFS108D03+ ACGTCGTTCAGGACTTCGTTGTCGCCGGCGCTTTGGCTCTCCGACGCTTGCTTCAGATAT
JMFS119F04+ CGACGCTTGCTTCAGATAT
JMFF041I09+ ACGTCGTTCAGGACTTCGTTGTCGCCGGCGCTTTGGCTCTCCGACGCTTGCTTCAGATAT
                      ____________________________________________________________
consensus ACGTCGTTCAGGACTTCGTTGTCGCCGGCGCTTTGGCTCTCCGACGCTTGCTTCAGATAT
 
. : . : . : . : . : . :
JMFS013H01+ GCGTTGAACGTTTTCAGGTCGGACACTAGGTCGTCGATCTGATCTTTTATCCCGATTATT
JMFS108D03+ GCGTTGATCGTTGTCAGGTCGGACACTAGGTCTTCGATCTGATCCTTTATCCCGATTATT
JMFS119F04+ GCGTTGATCGTTGTCAGGTCGGACACTAGGTCTTCGATCTGATCCTTTATCCCGATTATT
JMFF041I09+ GCGTTGATCGTTGTCAGGTCGGACACTAGGTCTTCGATCTGATCCTTTATCCCGATTATT
                      ____________________________________________________________
consensus GCGTTGATCGTTGTCAGGTCGGACACTAGGTCTTCGATCTGATCCTTTATCCCGATTATT
 
. : . : . : . : . : . :
JMFS013H01+ AGCGCCGCGTTTTCCTCTACTGCTTGTGCTAGCCGGCTCACCAGCTCCCCTACTAC
JMFS108D03+ AACGACGCGTTTTCCTCTACTGCTTGTGCTAGCCGGCTCACCAGCTCCCCTACTA-----
JMFS119F04+ AACGACGCGTTTTCCTCTACTGCTTGTGCTAGCCGGCTCACCAGCTCCCCTACTACTGCA
JMFF041I09+ AACGACGCGTTTTCCTCTACTGCTTGTGCTAGCCGGCTCACCAGCTCCCCTACTACTGCA
                      ____________________________________________________________
consensus AACGACGCGTTTTCCTCTACTGCTTGTGCTAGCCGGCTCACCAGCTCCCCTACTACTGCA
 
. : . : . : . : . : . :
JMFS108D03+ -CAGTAATGGGCGTATGACATATGAGGAGCTTAACAGTTTGGGCGTGGTCTTCCTTGATT
JMFS119F04+ TCAGTAATGGGCGTATGACATATGAGGAGCTTAACAGTTTGGGCGTGGTCTTCCTTGATT
JMFF041I09+ TCAGTAATGGGCGTATGACATATGAGGAGCTTAACAGTTTGGGCGTGGTCTTCCTTGATT
                      ____________________________________________________________
consensus TCAGTAATGGGCGTATGACATATGAGGAGCTTAACAGTTTGGGCGTGGTCTTCCTTGATT
 
. : . : . : . : . : . :
JMFS108D03+ TTCTTAACCCTGTCTGTGATGCTCTGTATCTCTTCACTAAAATCGCGAATACATTTGGCT
JMFS119F04+ TTCTTAACCCTGTCTGTGATGCTCTGTATCTCTTCACTAAAATCGCGAATACATTTGGCT
JMFF041I09+ TTCTTAACCCTGTCTGTGATGCTCTGTATCTCTTCACTAAAATCGCGAATACATTTGGCT
                      ____________________________________________________________
consensus TTCTTAACCCTGTCTGTGATGCTCTGTATCTCTTCACTAAAATCGCGAATACATTTGGCT
 
. : . : . : . : . : . :
JMFS108D03+ TCAGATCTAGCATGCTTCTTCCTCTCCACTGTGAACATACAGATTGCGTGTTCCGCATCA
JMFS119F04+ TCAGATCTAGCATGCTTCTTCCTCTCCACTGTGAACATACAGATTGCGTGTTCCGCATCA
JMFF041I09+ TCAGATCTAGCATGCTTCTTCCTCTCCACTGTGAACATACAGATTGCGTGTTCCGCATCA
                      ____________________________________________________________
consensus TCAGATCTAGCATGCTTCTTCCTCTCCACTGTGAACATACAGATTGCGTGTTCCGCATCA
 
. : . : . : . : . : . :
JMFS108D03+ CTTATCACATTTCGGATCTTCTCCACCATGTCTTTTAGAGCATATTTGGCTCTTTCGTTC
JMFS119F04+ CTTATCACATTTCGGATCTTCTCCACCATGTCTTTTAGAGCATATTTGGCTCTTTCGTTC
JMFF041I09+ CTTATCACATTTCGGATCTTCTCCACCATGTCTTTTAGAGCATATTTGGCTCTTTCGTTC
JMSF007H14+ TCCACCATGTCTTTTAGAGCATATTTGGCTCTTTCGTTN
                      ____________________________________________________________
consensus CTTATCACATTTCGGATCTTCTCCACCATGTCTTTTAGAGCATATTTGGCTCTTTCGTTC
 
. : . : . : . : . : . :
JMFS108D03+ TCGGATGCTAGCTCCACAGTAGAGCTCAATGATTTGAGGCCTATCACCAGATCCGAGATC
JMFS119F04+ TCGGATGCTAGCTCCACAGTAGAGCTCAATGATTTGAGGCCTATCACCAGATCCGAGATC
JMFF041I09+ TCGGATGCTAGCTCCACAGTAGAGCTCAATGATTTGAGGCCTATCACCAGATCCGAGATC
JMSF007H14+ TCGGATGCTAGCTCCACAGTAGAGCTCAATGATTTGAGGCCTATCACCAGATCCGAGATN
                      ____________________________________________________________
consensus TCGGATGCTAGCTCCACAGTAGAGCTCAATGATTTGAGGCCTATCACCAGATCCGAGATC
 
. : . : . : . : . : . :
JMFS108D03+ TGACTCTTTATCCCCATTTCAAACAACCTGTTTTCCTCAGCTAATTGTTCCAGTCGGTCT
JMFS119F04+ TGACTCTTTATCCCCATTTCAAACAACCTGTTTTCCTCAGCTAATTGTTCCAGTCGGTCT
JMFF041I09+ TGACTCTTTATCCCCATTTCAAACAACCTGTTTTCCTCAGCTAATTGTTCCAGTCGGTCT
JMSF007H14+ TGACTCTTTATCCCCATTTCAAACAACCTGTTTTCCTCAGNTAATTGTTCCAGTCGGTCT
                      ____________________________________________________________
consensus TGACTCTTTATCCCCATTTCAAACAACCTGTTTTCCTCAGCTAATTGTTCCAGTCGGTCT
 
. : . : . : . : . : . :
JMFS108D03+ ACCCTCCCTGAGATAGATAATGCATCTTCCACGGCCATAGCAGATCAAGCTCAGATCTAG
JMFS119F04+ ACCCTCCCTGAGATAGATAATGCATCTTCCACGGCCATAGCAGATCAAGCTCAGATCTAG
JMFF041I09+ ACCCTCCCTGAGATAGATAATGCATCTTCCACGGCCATAGCAGATCAAGCTCAGATCTAG
JMSF007H14+ ACCCTCCCTGAGATAGATAATGCATNTTCCACGGCCATAGCAGATCAAGCTCAGATCTAG
                      ____________________________________________________________
consensus ACCCTCCCTGAGATAGATAATGCATCTTCCACGGCCATAGCAGATCAAGCTCAGATCTAG
 
. : . : . : . : . : . :
JMFS108D03+ CGTTTGCTTATGA-TTTTTTTTTTCAACTCCGAGGTTTTAATTTC
JMFS119F04+ CGTTTGCTTATGA-TTTTTTTTTTCAACTCCGAGGTTTTAATTTC
JMFF041I09+ CGTTTGCTTATGA-TTTTTTTTTTCAACTCCGAGGTTTTAATTTCATACAA
JMSF007H14+ CGTTTGCTTATGATTTTTTTTTTTCAACTCCGAGGTTTTAATTTCATACAAGCACCATCC
                      ____________________________________________________________
consensus CGTTTGCTTATGA-TTTTTTTTTTCAACTCCGAGGTTTTAATTTCATACAAGCACCATCC