Previous Contig 004882:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF009M13Sequence571004882 (11)gb:AY088727_15737414e-28Arabidopsis thaliana clone 93312 mRNA, complete sequence.>gb:AY133672_1581495 Ar707004882 (11)gb:AY088727_15737414e-63Arabidopsis thaliana clone 93312 mRNA, complete sequence.>gb:AY133672_1581495 Ar
JMFF016L09Sequence570004882 (11)gb:AY088727_15737414e-28Arabidopsis thaliana clone 93312 mRNA, complete sequence.>gb:AY133672_1581495 Ar780004882 (11)gb:AY088727_15737411e-68Arabidopsis thaliana clone 93312 mRNA, complete sequence.>gb:AY133672_1581495 Ar
JMFF024A21Sequence527004882 (11)gb:AY088727_15737413e-22Arabidopsis thaliana clone 93312 mRNA, complete sequence.>gb:AY133672_1581495 Ar637010371 (3)gb:AY088727_15737413e-39Arabidopsis thaliana clone 93312 mRNA, complete sequence.>gb:AY133672_1581495 Ar
JMFF026H24Sequence535004882 (11)gb:AY088727_15737413e-22Arabidopsis thaliana clone 93312 mRNA, complete sequence.>gb:AY133672_1581495 Ar767010371 (3)gb:AC068197_15403596e-45Genomic sequence for Arabidopsis thaliana BAC F16A14 from chromosome I, complete
JMFF031G11Sequence540004882 (11)gb:AY088727_15737413e-22Arabidopsis thaliana clone 93312 mRNA, complete sequence.>gb:AY133672_1581495 Ar829004882 (11)gb:AY088727_15737411e-74Arabidopsis thaliana clone 93312 mRNA, complete sequence.>gb:AY133672_1581495 Ar
JMFF043O18Sequence639004882 (11)gb:AY088727_15737411e-28Arabidopsis thaliana clone 93312 mRNA, complete sequence.>gb:AY133672_1581495 Ar639010371 (3)gb:AY088727_15737411e-38Arabidopsis thaliana clone 93312 mRNA, complete sequence.>gb:AY133672_1581495 Ar
JMSF007G08Sequence373004882 (11)794004882 (11)gb:AY088727_15737418e-77Arabidopsis thaliana clone 93312 mRNA, complete sequence.>gb:AY133672_1581495 Ar

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF009M13- ATGGTTCAA
rJMSF007G08- TGGAGACTTTTCACTAAATTTTCCCATGGTTCAA
rJMFF016L09- A
rJMFF031G11- A
                      ____________________________________________________________
consensus TGGAGACTTTTCACTAAATTTTCCCATGGTTCAA
 
. : . : . : . : . : . :
rJMFF009M13- TAATTCTGAACTGAAACACTTGTATTCTATCAGGATTTACCGTATAGGAGGATATGGCAA
rJMSF007G08- TAATTCTGAACTGAAACACTTGTATTCTATCAGGATTTACCGTATAGGAGGATATGGCAA
rJMFF016L09- TAATTCTGAACTGAAACACTTGTATTCTATCAGGATTTACCGTATAGGAGGATATGGCAA
rJMFF031G11- TAATTCTGAACTGAAACACTTGTATTCTATCAGGATTTACCGTATAGGAGGATATGGCAA
                      ____________________________________________________________
consensus TAATTCTGAACTGAAACACTTGTATTCTATCAGGATTTACCGTATAGGAGGATATGGCAA
 
. : . : . : . : . : . :
rJMFF009M13- TGATCAAATATCAATGGTCACAAACACATTACAGTTAATGAGAGTATTGCAAATTGGTTT
rJMSF007G08- TGATCAAATATCAATGGTCACAAACACATTACAGTTAATGAGAGTATTGCAAATTGGTTT
rJMFF016L09- TGATCAAATATCAATGGTCACAAACACATTACAGTTAATGAGAGTATTGCAAATTGGTTT
rJMFF031G11- TGATCAAATATCAATGGTCACAAACACATTACAGTTAATGAGAGTATTGCAAATTGGTTT
                      ____________________________________________________________
consensus TGATCAAATATCAATGGTCACAAACACATTACAGTTAATGAGAGTATTGCAAATTGGTTT
 
. : . : . : . : . : . :
rJMFF009M13- TTGGTGCAGACAGAAGGACATATTCTCTGCTGATGGAGCCTCGACTCGTGTTCCTATTGA
rJMSF007G08- TTGGTGCAGACAGAAGGACATATTCTCTGCTGATGGAGCCTCGACTCGTGTTCCTATTGA
rJMFF016L09- TTGGTGCAGACAGAAGGACATATTCTCTGCTGATGGAGCCTCGACTCGTGTTCCTATTGA
rJMFF031G11- TTGGTGCAGACAGAAGGACATATTCTCTGCTGATGGAGCCTCGACTCGTGTTCCTATTGA
                      ____________________________________________________________
consensus TTGGTGCAGACAGAAGGACATATTCTCTGCTGATGGAGCCTCGACTCGTGTTCCTATTGA
 
. : . : . : . : . : . :
rJMFF009M13- TCTTCCAGGGAGTGTTTACGGGCTCTCAAGTTGAGTTTGAGATTTTCAGGCCGGGGAGGC
rJMSF007G08- TCTTCCAGGGAGTGTTTACGGGCTCTCAAGTTGAGTTTGAGATTTTCAGGCCGGGGAGGC
rJMFF016L09- TCTTCCAGGGAGTGTTTACGGGCTCTCAAGTTGAGTTTGAGATTTTCAGGCCGGGGAGGC
rJMFF031G11- TCTTCCAGGGAGTGTTTACGGGCTCTCAAGTTGAGTTTGAGATTTTCAGGCCGGGGAGGC
                      ____________________________________________________________
consensus TCTTCCAGGGAGTGTTTACGGGCTCTCAAGTTGAGTTTGAGATTTTCAGGCCGGGGAGGC
 
. : . : . : . : . : . :
rJMFF009M13- GTTCTTCCCCTGCGAAACAGAACCGCCAACGCCCTCATCTTCCGGCACAGATCAAATACC
rJMSF007G08- GTTCTTCCCCTGCGAAACAGAACCGCCAACGCCCTCATCTTCCGGCACAGATCAAATACC
rJMFF016L09- GTTCTTCCCCTGCGAAACAGAACCGCCAACGCCCTCATCTTCCGGCACAGATCAAATACC
rJMFF031G11- GTTCTTCCCCTGCGAAACAGAACCGCCAACGCCCTCATCTTCCGGCACAGATCAAATACC
                      ____________________________________________________________
consensus GTTCTTCCCCTGCGAAACAGAACCGCCAACGCCCTCATCTTCCGGCACAGATCAAATACC
 
. : . : . : . : . : . :
rJMFF009M13- GAGGATGCTTCAATCTCTGCAACGCCTTCGCAATTTTGACCTCCTCCTTGGAGTAAGTCG
rJMSF007G08- GAGGATGCTTCAATCTCTGCAACGCCTTCGCAATTTTGACCTCCTCCTTGGAGTAAGTCG
rJMFF016L09- GAGGATGCTTCAATCTCTGCAACGCCTTCGCAATTTTGACCTCCTCCTTGGAGTAAGTCG
rJMFF031G11- GAGGATGCTTCAATCTCTGCAACGCCTTCGCAATTTTGACCTCCTCCTTGGAGTAAGTCG
                      ____________________________________________________________
consensus GAGGATGCTTCAATCTCTGCAACGCCTTCGCAATTTTGACCTCCTCCTTGGAGTAAGTCG
 
. : . : . : . : . : . :
rJMFF009M13- CAGTATTTTACAGCTTCATCACCATCTTCAAACACCAGAACACCTTCTCTGACATCTTCA
rJMSF007G08- CAGTATTTTACAGCTTCATCACCATCTTCAAACACCAGAACACCTTCTCTGACATCTTCA
rJMFF016L09- CAGTATTTTACAGCTTCATCACCATCTTCAAACACCAGAACACCTTCTCTGACATCTTCA
rJMFF031G11- CAGTATTTTACAGCTTCATCACCATCTTCAAACACCAGAACACCTTCTCTGACATCTTCA
                      ____________________________________________________________
consensus CAGTATTTTACAGCTTCATCACCATCTTCAAACACCAGAACACCTTCTCTGACATCTTCA
 
. : . : . : . : . : . :
rJMFF009M13- ACAACCATCTGAAATTTTGTGCCAGTTCCTGTCTGCTTAGCTTGATTTCTCCACTTCCCA
rJMSF007G08- ACAACCATCTGAAATTTTGTGCCAGTTCCTGTCTGCTTAGCTTGATTTCTCCACTTCCCA
rJMFF016L09- ACAACCATCTGAAATTTTGTGCCAGTTCCTGTCTGCTTAGCTTGATTTCTCCACTTCCCA
rJMFF031G11- ACAACCATCTGAAATTTTGTGCCAGTTCCTGTCTGCTTAGCTTGATTTCTCCACTTCCCA
                      ____________________________________________________________
consensus ACAACCATCTGAAATTTTGTGCCAGTTCCTGTCTGCTTAGCTTGATTTCTCCACTTCCCA
 
. : . : . : . : . : . :
rJMFF009M13- CCTTTGGAAAACAATAACCCAAGCTCCCTTTCAACTTCACTCTGGTTCCTCCGAGTTTTC
rJMSF007G08- CCTTTGGAAAACAATAACCCAAGCTCCCTTTCAACTTCACTCTGGTTCCTCCGAGTTTTC
rJMFF016L09- CCTTTGGAAAACAATAACCCAAGCTCCCTTTCAACTTCACTCTGGTTCCTCCGAGTTTTC
rJMFF031G11- CCTTTGGAAAACAATAACCCAAGCTCCCTTTCAACTTCACTCTGGTTCCTCCGAGTTTTC
JMFF043O18+ CTCTGGTTCCTCCGAGTTTTC
JMFF016L09+ TCCGAGTTTTC
JMFF009M13+ CTCCGAGTTTTC
                      ____________________________________________________________
consensus CCTTTGGAAAACAATAACCCAAGCTCCCTTTCAACTTCACTCTGGTTCCTCCGAGTTTTC
 
. : . : . : . : . : . :
rJMFF009M13- ATCGTACACAACTGGTTTTCCCTATGAGTTAGTACATACACAGGGCTTCGACGTTTCCCT
rJMSF007G08- ATCGTACACAACTGGTTTTCCCTATGAGTTAGTACATACACA-GGCTTCGACGTTTCCCT
rJMFF016L09- ATCGTACACAACTGGTTTTCCCTATGAGTTAGTACATACACAGGGCTTCGACGTTTCCCT
rJMFF031G11- ATCGTACACAACTGGTTTTCCCTATGAGTTAGTACATACACA-GGCTTCGACGTTTCCCT
JMFF043O18+ ATCGTACACAACTGGTTTTCCCTATGAGTTAGTACATACACA-GGCTTCGACGTTTCCCT
JMFF016L09+ ATCGTACACAACTGGTTTTCCCTATGAGTTAGTACATACACA-GGCTTCGACGTTTCCCT
JMFF031G11+ CCCTATGAGTTAGTACATACACA-GGCTTCGACGTTTCCCT
JMFF026H24+ CCCTATGAGTTAGTACATACACA-GGCTTCGACGTTTCCCT
JMFF024A21+ CCCTATGAGTTAGTACATACACA-GGCTTCGACGTTTCCCT
JMFF009M13+ ATCGTACACAACTGGTTTTCCCTATGAGTTAGTACATACACA-GGCTTCGACGTTTCCCT
                      ____________________________________________________________
consensus ATCGTACACAACTGGTTTTCCCTATGAGTTAGTACATACACA-GGCTTCGACGTTTCCCT
 
. : . : . : . : . : . :
rJMFF009M13- CCAAGGATTAGCCTCCAGCACATCATAGCTGCTGCTATCAAAACCCTGNTGAAGATGCCT
rJMSF007G08- CCAAGGATTAGCCTCCAGCACATCATAGCTGCTGCTATCAAAACCCTGTTGAAGATGCCT
rJMFF016L09- CCAAGGATTAGCCTCCAGCACATCATAGCTGCTGCTATCAAAACCCTGTTGAAGATGCCT
rJMFF031G11- CCAAGGATTAGCCTCCAGCACATCATAGCTGCTGCTATCAAAACCCTGTTGAAGATGCCT
JMFF043O18+ CCAAGGATTAGCCTCCAGCACATCATAGCTGCTGCTATCAAAACCCTGTTGAAGATGCCT
JMFF016L09+ CCAAGGATTAGCCTCCAGCACATCATAGCTGCTGCTATCAAAACCCTGTTGAAGATGCCT
JMFF031G11+ CCAAGGATTAGCCTCCAGCACATCATAGCTGCTGCTATCAAAACCCTGTTGAAGATGCCT
JMFF026H24+ CCAAGGATTAGCCTCCAGCACATCATAGCTGCTGCTATCAAAACCCTGTTGAAGATGCCT
JMFF024A21+ CCAAGGATTAGCCTCCAGCACATCATAGCTGCTGCTATCAAAACCCTGTTGAAGATGCCT
JMFF009M13+ CCAAGGATTAGCCTCCAGCACATCATAGCTGCTGCTATCAAAACCCTGTTGAAGATGCCT
                      ____________________________________________________________
consensus CCAAGGATTAGCCTCCAGCACATCATAGCTGCTGCTATCAAAACCCTGTTGAAGATGCCT
 
. : . : . : . : . : . :
rJMFF009M13- CCGCATGTCGTAGGCGCGTGACGACACTTGCTTTACAA
rJMSF007G08- CCGCATGTCGTANGCGCGTGACGACACTTGCTTTACAAACTCGCTCGGAGTCCCCGG-AA
rJMFF016L09- CCGCATGTCGTANGCGCGTGACGACACTTGCTTTACAAACTCGCTCGGAGTCCCCGGAAA
rJMFF031G11- CCGCATGTCGTAGGCGCGTGACGACACTTGCTTTACAAACTCGCTCGGAGTCCCCGG-AA
JMFF043O18+ CCGCATGTCGTAGGCGCGTGACGACACTTGCTTTACAAACTCGCTCGGAGTCCCCGG-AA
JMFF016L09+ CCGCATGTCGTAGGCGCGTGACGACACTTGCTTTACAAACTCGCTCGGAGTCCCCGG-AA
JMFF031G11+ CCGCATGTCGTAGGCGCGTGACGACACTTGCTTTACAAACTCGCTCGGAGTCCCCGG-AA
JMFF026H24+ CCGCATGTCGTAGGCGCGTGACGACACTTGCTTTACAAACTCGCTCGGAGTCCCCGG-AA
JMFF024A21+ CCGCATGTCGTAGGCGCGTGACGACACTTGCTTTACAAACTCGCTCGGAGTCCCCGG-AA
JMFF009M13+ CCGCATGTCGTAGGCGCGTGACGACACTTGCTTTACAAACTCGCTCGGAGTCCCCGG-AA
                      ____________________________________________________________
consensus CCGCATGTCGTAGGCGCGTGACGACACTTGCTTTACAAACTCGCTCGGAGTCCCCGG-AA
 
. : . : . : . : . : . :
rJMSF007G08- TAGTACCGTCCATTCGAAGCGCACTCTCCACCTCCTCATCTC
rJMFF016L09- TAGTACCGTCCATTCGAAGCGCACTCTCCACCTCCTCATCTCGCCG
rJMFF031G11- TAGTACCGTCCATTCGAAGCGCACTCTCCACCTCCTCATCTCGCCGCCGANCTTCTTCTT
JMFF043O18+ TAGTACCGTCCATTCGAAGCGCACTCTCCACCTCCTCATCTCGCCGCCGACCTTCTTCTT
JMFF016L09+ TAGTACCGTCCATTCGAAGCGCACTCTCCACCTCCTCATCTCGCCGCCGACCTTCTTCTT
JMFF031G11+ TAGTACCGTCCATTCGAAGCGCACTCTCCACCTCCTCATCTCGCCGCCGACCTTCTTCTT
JMFF026H24+ TAGTACCGTCCATTCGAAGCGCACTCTCCACCTCCTCATCTCGCCGCCGACCTTCTTCTT
JMFF024A21+ TAGTACCGTCCATTCGAAGCGCACTCTCCACCTCCTCATCTCGCCGCCGACCTTCTTCTT
JMFF009M13+ TAGTACCGTCCATTCGAAGCGCACTCTCCACCTCCTCATCTCGCCGCCGACCTTCTTCTT
                      ____________________________________________________________
consensus TAGTACCGTCCATTCGAAGCGCACTCTCCACCTCCTCATCTCGCCGCCGACCTTCTTCTT
 
. : . : . : . : . : . :
rJMFF031G11- CTANGTCGTCTCGCCGCCGACCTTCTTCTTCTAGGTCGTCTCCG
JMFF043O18+ CTAGGTCGTCTCGCCGCCGACCTTCTTCTTCTAGGTCGTCTCCGCCTTCTCCGCCGCCTA
JMFF016L09+ CTAGGTCGTCTCGCCGCCGACCTTCTTCTTCTAGGTCGTCTCCGCCTTCTCCGCCGCCTA
JMFF031G11+ CTAGGTCGTCTCGCCGCCGACCTTCTTCTTCTAGGTCGTCTCCGCCTTCTCCGCCGCCTA
JMFF026H24+ CTAGGTCGTCTCGCCGCCGACCTTCTTCTTCTAGGTCGTCTCCGCCTTCTCCGCCGCCTA
JMFF024A21+ CTAGGTCGTCTCGCCGCCGACCTTCTTCTTCTAGGTCGTCTCCGCCTTCTCCGCCGCCTA
JMFF009M13+ CTAGGTCGTCTCGCCGCCGACCTTCTTCTTCTAGGTCGTCTCCGCCTTCTCCGCCGCCTA
JMSF007G08+ TCTCCGCCGCCTA
                      ____________________________________________________________
consensus CTAGGTCGTCTCGCCGCCGACCTTCTTCTTCTAGGTCGTCTCCGCCTTCTCCGCCGCCTA
 
. : . : . : . : . : . :
JMFF043O18+ ATTTACAATAAGCTTCCGCCAGTGTTCTCCTCCGATCGATGCCATCACTGGTACGCCCGA
JMFF016L09+ ATTTACAATAAGCTTCCGCCAGTGTTCTCCTCCGATCGATGCCATCACTGGTACGCCCGA
JMFF031G11+ ATTTACAATAAGCTTCCGCCAGTGTTCTCCTCCGATCGATGCCATCACTGGTACGCCCGA
JMFF026H24+ ATTTACAATAAGCTTCCGCCAGTGTTCTCCTCCGATCGATGCCATCACTGGTACGCCCGA
JMFF024A21+ ATTTACAATAAGCTTCCGCCAGTGTTCTCCTCCGATCGATGCCATCACTGGTACGCCCGA
JMFF009M13+ ATTTACAATAAGCTTCCGCCAGTGTTCTCCTCCGATCGATGCCATCACTGGTACGCCCGA
JMSF007G08+ ATTTACAATAAGCTTCCGCCAGTGTTCTCCTCCGATCGATGCCATCACTGGTACGCCCGA
                      ____________________________________________________________
consensus ATTTACAATAAGCTTCCGCCAGTGTTCTCCTCCGATCGATGCCATCACTGGTACGCCCGA
 
. : . : . : . : . : . :
JMFF043O18+ ACGAGCTGCGCGGAATACCGGAGGAGAAGGATAGGCGTAACTGACGAGCGAGCTTAACCT
JMFF016L09+ ACGAGCTGCGCGGAATACCGGAGGAGAAGGATAGGCGTAACTGACGAGCGAGCTTAACCT
JMFF031G11+ ACGAGCTGCGCGGAATACCGGAGGAGAAGGATAGGCGTAACTGACGAGCGAGCTTAACCT
JMFF026H24+ ACGAGCTGCGCGGAATACCGGAGGAGAAGGATAGGCGTAACTGACGAGCGAGCTTAACCT
JMFF024A21+ ACGAGCTGCGCGGAATACCGGAGGAGAAGGATAGGCGTAACTGACGAGCGAGCTTAACCT
JMFF009M13+ ACGAGCTGCGCGGAATACCGGAGGAGAAGGATAGGCGTAACTGACGAGCGAGCTTAACCT
JMSF007G08+ ACGAGCTGCGCGGAATACCGGAGGAGAAGGATAGGCGTAACTGACGAGCGAGCTTAACCT
                      ____________________________________________________________
consensus ACGAGCTGCGCGGAATACCGGAGGAGAAGGATAGGCGTAACTGACGAGCGAGCTTAACCT
 
. : . : . : . : . : . :
JMFF043O18+ TGGAGGACACAGATATTCGCCGCCGGTGATGATGGTGCCGGAGAGGCTTTCCGGGAGGGA
JMFF016L09+ TGGAGGACACAGATATTCGCCGCCGGTGATGATGGTGCCGGAGAGGCTTTCCGGGAGGGA
JMFF031G11+ TGGAGGACACAGATATTCGCCGCCGGTGATGATGGTGCCGGAGAGGCTTTCCGGGAGGGA
JMFF026H24+ TGGAGGACACAGATATTCGCCGCCGGTGATGATGGTGCCGGAGAGGCTTTCCGGGAGGGA
JMFF024A21+ TGGAGGACACAGATATTCGCCGCCGGTGATGATGGTGCCGGAGAGGCTTTCCGGGAGGGA
JMFF009M13+ TGGAGGACACAGATATTCGCCGCCGGTGATGATGGTGCCGGAGAGGCTTTCCGGGAGGGA
JMSF007G08+ TGGAGGACACAGATATTCGCCGCCGGTGATGATGGTGCCGGAGAGGCTTTCCGGGAGGGA
                      ____________________________________________________________
consensus TGGAGGACACAGATATTCGCCGCCGGTGATGATGGTGCCGGAGAGGCTTTCCGGGAGGGA
 
. : . : . : . : . : . :
JMFF043O18+ GAACGAACGACGGCGATACCGACGAGAGTGAATCCATGATCCGAAATCCAAATCTCAGAA
JMFF016L09+ GAACGAACGACGGCGATACCGACGAGAGAGAATCCATGATCCGAAATCCAAATCTCAGAA
JMFF031G11+ GAACGAACGACGGCGATACCGACGAGAGAGAATCCATGATCCGAAATCCAAATCTCAGAA
JMFF026H24+ GAACGAACGACGGCGATACCGACGAGAGAGAATCCATGATCCGAAATCCAAATCTCAGAA
JMFF024A21+ GAACGAACGACGGCGATACCGACGAGAGAGAATCCATGATCCGAAATCCAAATCTCAGAA
JMFF009M13+ GAACGAACGACGGCGATACCGACGAGAGAGAATCCATGATCCGAAATCCAAATCTCAGAA
JMSF007G08+ GAACGAACGACGGCGATACCGACGAGAGAGAATCCATGATCCGAAATCCAAATCTCAGAA
                      ____________________________________________________________
consensus GAACGAACGACGGCGATACCGACGAGAGAGAATCCATGATCCGAAATCCAAATCTCAGAA
 
. : . : . : . : . : . :
JMFF043O18+ CAACGATT
JMFF016L09+ CAACGATTGCTTTCCT
JMFF031G11+ CAACGATTGCTTTCCT
JMFF026H24+ CAACGATTGCTT
JMFF024A21+ CAACGATT
JMFF009M13+ CAACGATTGCTTTCCT
JMSF007G08+ CAACGATTGCTTTCCTCAACACTCCACACTCAGATCCAATATATGGAACGAAAGTAGAGG
                      ____________________________________________________________
consensus CAACGATTGCTTTCCTCAACACTCCACACTCAGATCCAATATATGGAACGAAAGTAGAGG
 
. : . : . : . : . : . :
JMSF007G08+ GAATTCGATACGTAACAGAAAACGGATTGGAATTGAAGAACGGAGAGGGTTGGAAGGTCC
                      ____________________________________________________________
consensus GAATTCGATACGTAACAGAAAACGGATTGGAATTGAAGAACGGAGAGGGTTGGAAGGTCC