Previous Contig 004880:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS158B06Sequence421004880 (3)
JMSF007G03Sequence283004880 (3)700012931 (3)pir|A84829|A848298e-56hypothetical protein At2g40400 [imported] - Arabidopsis thaliana>gb:AC007020_153
JMSF016B20Sequence260004880 (3)805012931 (3)gb:AY093111_15750651e-75Arabidopsis thaliana putative protein (At3g56140) mRNA, complete cds.>gb:BT01034

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS158B06+ TCTCCGCTTGAGCAGG
                      ____________________________________________________________
consensus TCTCCGCTTGAGCAGG
 
. : . : . : . : . : . :
JMFS158B06+ CGCCGGATCTAGAACCTCCGTCGCCGTCGCCGTGGCGGGGGCGCTCTCCGGGGGATCATC
                      ____________________________________________________________
consensus CGCCGGATCTAGAACCTCCGTCGCCGTCGCCGTGGCGGGGGCGCTCTCCGGGGGATCATC
 
. : . : . : . : . : . :
JMFS158B06+ GTCGGCTCTCGCCACTGCCGTCCGGAGCACGCTAGCTCCGAGGGCGATTAATGAGGTGAC
                      ____________________________________________________________
consensus GTCGGCTCTCGCCACTGCCGTCCGGAGCACGCTAGCTCCGAGGGCGATTAATGAGGTGAC
 
. : . : . : . : . : . :
JMSF016B20+ TCGTGCCGCGAACGGCGCCGCCATTCTCGGCCGGGATTTGACC
JMFS158B06+ GAGCACTTCTCGCCTCTTCGTGCCGCGAACGGCGCCGCCATTCTCGGCCGGGATTTGACC
JMSF007G03+ TCGTGCCGCGAACGGCGCCGCCATTCTCGGCCGGGATTTGACC
                      ____________________________________________________________
consensus GAGCACTTCTCGCCTCTTCGTGCCGCGAACGGCGCCGCCATTCTCGGCCGGGATTTGACC
 
. : . : . : . : . : . :
JMSF016B20+ GCAGCGGACGGAGAAGCTGAGGTGGCACGGGAACTTTCGCCGGCGACGATTTCCCACCAC
JMFS158B06+ GCAGCGGACGGAGAAGCTGAGGTGGCACGGCAACTTTCGCCGGCGACGATTTCCCACCAC
JMSF007G03+ GCAGCGGACGGAGAAGCTGAGGTGGCACGGGAACTTTCGCCGGCGACGATTTCCCACCAC
                      ____________________________________________________________
consensus GCAGCGGACGGAGAAGCTGAGGTGGCACGGGAACTTTCGCCGGCGACGATTTCCCACCAC
 
. : . : . : . : . : . :
JMSF016B20+ GAGACGGCGGTTGACGTGGAGTGATCTGAAAGTAAAGCCACGTAGAACGTGGCACTCCAT
JMFS158B06+ GAGACGGCGGTTGACGTGGAGTGATCTGAAAGTAAAGCCACGTAGAACGTGGCACTCCAT
JMSF007G03+ GAGACGGCGGTTGACGTGGAGTGATCTGAAAGTAAAGCCACGTAGAACGTGGCACTCCAT
                      ____________________________________________________________
consensus GAGACGGCGGTTGACGTGGAGTGATCTGAAAGTAAAGCCACGTAGAACGTGGCACTCCAT
 
. : . : . : . : . : . :
JMSF016B20+ TTCCAGATTCGGGTGAGATGAGAAGAGGTGATTGGAGAGCAGTAGCAGTAGCGCTACATG
JMFS158B06+ TTCCAGATTCGGGTGAGATGAGAAGAGGTGATTGGAGAGCAGTAGCAGTAGCGCTACATG
JMSF007G03+ TTCCAGATTCGGGTGAGATGAGAAGAGGTGATTGGAGAGCAGTAGCAGTAGCGCTACATG
                      ____________________________________________________________
consensus TTCCAGATTCGGGTGAGATGAGAAGAGGTGATTGGAGAGCAGTAGCAGTAGCGCTACATG
 
. : . : . : . : . : . :
JMSF016B20+ GTCAGCGCCGACGACCAATCCATCTTCAATCT
JMFS158B06+ GTCAGCGCCCACGACCAATCCATCTTCAATCTTAGCCTTCAAAAT
JMSF007G03+ GTCAGCGCCGACGACCAATCCATCTTCAATCTTAGCCTTCAAAATTTTCTGAACAAAGCC
                      ____________________________________________________________
consensus GTCAGCGCCGACGACCAATCCATCTTCAATCTTAGCCTTCAAAATTTTCTGAACAAAGCC