Previous Contig 004871:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF031L23Sequence516004871 (6)gb:AY142492_15829217e-22Arabidopsis thaliana unknown protein (At3g52610) mRNA, complete cds.772009686 (6)gb:AY142492_15829213e-67Arabidopsis thaliana unknown protein (At3g52610) mRNA, complete cds.
JMFF039O12Sequence440004871 (6)gb:AY142492_15829212e-19Arabidopsis thaliana unknown protein (At3g52610) mRNA, complete cds.741009686 (6)gb:AY142492_15829216e-66Arabidopsis thaliana unknown protein (At3g52610) mRNA, complete cds.
JMSF007E05Sequence421004871 (6)gb:AY142492_15829213e-11Arabidopsis thaliana unknown protein (At3g52610) mRNA, complete cds.745009686 (6)gb:AY142492_15829216e-69Arabidopsis thaliana unknown protein (At3g52610) mRNA, complete cds.
JMSF023H06Sequence656004871 (6)gb:AY142492_15829212e-26Arabidopsis thaliana unknown protein (At3g52610) mRNA, complete cds.742009686 (6)gb:AY142492_15829211e-66Arabidopsis thaliana unknown protein (At3g52610) mRNA, complete cds.
JMSF028I06Sequence616004871 (6)gb:AY142492_15829212e-25Arabidopsis thaliana unknown protein (At3g52610) mRNA, complete cds.713009686 (6)gb:AY142492_15829212e-66Arabidopsis thaliana unknown protein (At3g52610) mRNA, complete cds.
JMSF045P05Sequence720004871 (6)gb:AY142492_15829212e-26Arabidopsis thaliana unknown protein (At3g52610) mRNA, complete cds.645009686 (6)gb:AY142492_15829212e-61Arabidopsis thaliana unknown protein (At3g52610) mRNA, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF023H06+ TTCAGGAATGCAGTCCTCCATTGCCGGAGCAATCTTAGTTTCGCACTCTAA
JMSF045P05+ TTCAGGAATGCAGTCCTCCATTGCCGGAGCAATCTTAGTTTCGCACTCTAA
                      ____________________________________________________________
consensus TTCAGGAATGCAGTCCTCCATTGCCGGAGCAATCTTAGTTTCGCACTCTAA
 
. : . : . : . : . : . :
JMSF023H06+ TTCCCTCTGTATTATCCCTTCTTCCCCAAGCAACGTCATCAGCTCCATACATAATGTCCA
JMSF028I06+ CCCCAAGCAACGTCATCAGCTCCATACATAATGTCCA
JMSF045P05+ TTCCCTCTGTATTATCCCTTCTTCCCCAAGCAACGTCATCAGCTCCATACATAATGTCCA
                      ____________________________________________________________
consensus TTCCCTCTGTATTATCCCTTCTTCCCCAAGCAACGTCATCAGCTCCATACATAATGTCCA
 
. : . : . : . : . : . :
JMSF023H06+ CGCCGTCGCAAGGTCACACGCCGACGTGTGAAGCCGTAGGGCCACGGCCAACTTGTCGCC
JMFF031L23+ GTCGCC
JMSF028I06+ CGCCGTCGCAAGGTCACACGCCGACGTGTGAAGCCGTAGGGCCACGGCCAACTTGTCGCC
JMSF045P05+ CGCCGTCGCAAGGTCACACGCCGACGTGTGAAGCCGTAGGGCCACGGCCAACTTGTCGCC
                      ____________________________________________________________
consensus CGCCGTCGCAAGGTCACACGCCGACGTGTGAAGCCGTAGGGCCACGGCCAACTTGTCGCC
 
. : . : . : . : . : . :
JMSF023H06+ GGCGACGCCGGGTAAGGTGTAAACGCTGGCGAAGAAAACGTCGCTGTCAACGTGGGATTC
JMFF031L23+ GGCGACGCCGGGTAAGGTGTAAACGCTGGCGAAGAAAACGTCGCTGTCAACGTGGGATTC
JMSF028I06+ GGCGACGCCGGGTAAGGTGTAAACGCTGGCGAAGAAAACGTCGCTGTCAACGTGGGATTC
JMSF045P05+ GGCGACGCCGGGTAAGGTGTAAACGCTGGCGAAGAAAACGTCGCTGTCAACGTGGGATTC
                      ____________________________________________________________
consensus GGCGACGCCGGGTAAGGTGTAAACGCTGGCGAAGAAAACGTCGCTGTCAACGTGGGATTC
 
. : . : . : . : . : . :
JMSF023H06+ CGGGTCGGGGCTCTGCCAAGCGTTGCGGTTCATTTCGTGCTCGAGGATGAGGTGGAAGTC
JMFF031L23+ CGGGTCGGGGCTCTGCCAAGCGTTGCGGTTCATTTCGTGCTCGAGGATGAGGTGGAAGTC
JMFF039O12+ GCTCTGCCAAGCGTTGCGGTTCATTTCGTGCTCGAGGATGAGGTGGAAGTC
JMSF028I06+ CGGGTCGGGGCTCTGCCAAGCGTTGCGGTTCATTTCGTGCTCGAGGATGAGGTGGAAGTC
JMSF045P05+ CGGGTCGGGGCTCTGCCAAGCGTTGCGGTTCATTTCGTGCTCGAGGATGAGGTGGAAGTC
                      ____________________________________________________________
consensus CGGGTCGGGGCTCTGCCAAGCGTTGCGGTTCATTTCGTGCTCGAGGATGAGGTGGAAGTC
 
. : . : . : . : . : . :
JMSF023H06+ GGAGACTGAGGAGTCGCCGCCGTCCGGGGAATTTGCCAGTTCGCGGAGAATCTCCGCCGT
JMFF031L23+ GGAGACTGAGGAGTCGCCGCCGTCCGGGGAATTTGCCAGTTCGCGGAGAATCTCCGCCGT
JMFF039O12+ GGAGACTGAGGAGTCGCCGCCGTCCGGGGAATTTGCCAGTTCGCGGAGAATCTCCGCCGT
JMSF028I06+ GGAGACTGAGGAGTCGCCGCCGTCCGGGGAATTTGCCAGTTCGCGGAGAATCTCCGCCGT
JMSF045P05+ GGAGACTGAGGAGTCGCCGCCGTCCGGGGAATTTGCCAGTTCGCGGAGAATCTCCGCCGT
JMSF007E05+ T
                      ____________________________________________________________
consensus GGAGACTGAGGAGTCGCCGCCGTCCGGGGAATTTGCCAGTTCGCGGAGAATCTCCGCCGT
 
. : . : . : . : . : . :
JMSF023H06+ CGACGCACGATCAAACGACTGGATTTTCAGGGGAGGAGTGGCGGGAGTGACGTAGGAGTA
JMFF031L23+ CGACGCACGATCAAACGACTGGATTTTCAGGGGAGGAGTGGCGGGAGTGACGTAGGAGTA
JMFF039O12+ CGACGCACGATCAAACGACTGGATTTTCAGGGGAGGAGTGGCGGGAGTGACGTAGGAGTA
JMSF028I06+ CGACGCACGATCAAACGACTGGATTTTCAGGGGAGGAGTGGCGGGAGTGACGTAGGAGTA
JMSF045P05+ CGACGCACGATCAAACGACTGGATTTTCAGGGGAGGAGTGGCGGGAGTGACGTAGGAGTA
JMSF007E05+ CGACGCACGATCAAACGACTGGATTTTCAGGGGAGGAGTGGCGGGAGTGACGTAGGAGTA
                      ____________________________________________________________
consensus CGACGCACGATCAAACGACTGGATTTTCAGGGGAGGAGTGGCGGGAGTGACGTAGGAGTA
 
. : . : . : . : . : . :
JMSF023H06+ GAATCCCGTGGCCGGATCATGGCGGAGTTGGCAGCTGAGGATGGGATGTGCGGTTTGGAG
JMFF031L23+ GAATCCCGTGGCCGGATCATGGCGGAGTTGGCAGCTGAGGATGGGATGTGCGGTTTGGAG
JMFF039O12+ GAATCCCGTGGCCGGATCATGGCGGAGTTGGCAGCTGAGGATGGGATGTGCGGTTTGGAG
JMSF028I06+ GAATCCCGTGGCCGGATCATGGCGGAGTTGGCAGCTGAGGATGGGATGTGCGGTTTGGAG
JMSF045P05+ GAATCCCGTGGCCGGATCATGGCGGAGTTGGCAGCTGAGGATGGGATGTGCGGTTTGGAG
JMSF007E05+ GAATCCCGTGGCCGGATCATGGCGGAGTTGGCAGCTGAGGATGGGATGTGCGGTTTGGAG
                      ____________________________________________________________
consensus GAATCCCGTGGCCGGATCATGGCGGAGTTGGCAGCTGAGGATGGGATGTGCGGTTTGGAG
 
. : . : . : . : . : . :
JMSF023H06+ TTTCCCGACGGCGTCGCTAACAACTGAAAAATCCGGCGGTTTTGAGAAGAGCAGCGCCGA
JMFF031L23+ TTTCCCGACGGCGTCGCTAACAACTGAAAAATCCGGCGGTTTTGAGAAGAGCAGCGCCGA
JMFF039O12+ TTTCCCGACGGCGTCGCTAACAACTGAAAAATCCGGCGGTTTTGAGAAGAGCAGCGCCGA
JMSF028I06+ TTTCCCGACGGCGTCGCTAACAACTGAAAAATCCGGCGGTTTTGAGAAGAGCAGCGCCGA
JMSF045P05+ TTTCCCGACGGCGTCGCTAACAACTGAAAAATCCGGCGGTTTTGAGAAGAGCAGCGCCGA
JMSF007E05+ TTTCCCGACGGCGTCGCTAACAACTGAAAAATCCGGCGGTTTTGAGAAGAGCAGCGCCGA
                      ____________________________________________________________
consensus TTTCCCGACGGCGTCGCTAACAACTGAAAAATCCGGCGGTTTTGAGAAGAGCAGCGCCGA
 
. : . : . : . : . : . :
JMSF023H06+ AACAGTTATCCCTGTGCCGCCAGGCACCGCCTTGCACCAGGTCTGCTCGGTGCCACCCAA
JMFF031L23+ AACAGTTATCCCTGTGCCGCCAGGCACCGCCTTGCACCAGGTCTGCTCGGTGCCACCCAA
JMFF039O12+ AACAGTTATCCCTGTGCCGCCAGGCACCGCCTTGCACCAGGTCTGCTCGGTGCCACCCAA
JMSF028I06+ AACAGTTATCCCTGTGCCGCCAGGCACCGCCTTGCACCAGGTCTGCTCGGTGCCACCCAA
JMSF045P05+ AACAGTTATCCCTGTGCCGCCAGGCACCGCCTTGCACCAGGTCTGCTCGGTGCCACCCAA
JMSF007E05+ AACAGTTATCCCTGTGCCGCCAGGCACCGCCTTGCACCAGGTCTGCTCGGTGCCACCCAA
                      ____________________________________________________________
consensus AACAGTTATCCCTGTGCCGCCAGGCACCGCCTTGCACCAGGTCTGCTCGGTGCCACCCAA
 
. : . : . : . : . : . :
JMSF023H06+ CTGGCGGCTCAGCCGCGAGTTGGCGGTGGTTGCCTGCTCCGCCGCCATGAAATTTCCGAG
JMFF031L23+ CTGGCGGCTCAGCCGCGAGTTGGCGGTGGTTGCCTGCTCCGCCGCCATGAAATTTCCGAG
JMFF039O12+ CTGGCGGCTCAGCCGCGAGTTGGCGGTGGTTGCCTGCTCCGCCGCCATGAAATTTCCGAG
JMSF028I06+ CTGGCGGCTCAGCCGCGAGTTGGCGGTGGTTGCCTGCTCCGCCGCCATGAAATTTCCGAG
JMSF045P05+ CTGGCGGCTCAGCCGCGAGTTGGCGGTGGTTGCCTGCTCCGCCGCCATGAAATTTCCGAG
JMSF007E05+ CTGGCGGCTCAGCCGCGAGTTGGCGGTGGTTGCCTGCTCCGCCGCCATGAAATTTCCGAG
                      ____________________________________________________________
consensus CTGGCGGCTCAGCCGCGAGTTGGCGGTGGTTGCCTGCTCCGCCGCCATGAAATTTCCGAG
 
. : . : . : . : . : . :
JMSF023H06+ TGAT
JMFF031L23+ TGATGGGTTTAGAGTTTGGGGATCGAAGAC
JMFF039O12+ TGATGGGTTTAGAGTTTGGGGATCGGAGA
JMSF028I06+ TGATGGGTTTAGAGTTTGGGGATCGGAGACAAATAATT
JMSF045P05+ TGATGGGTTTAGAGTTTGGGGATCGGAGACAAATAATTGAAGTGTTTGCGGTAGAAGTAA
JMSF007E05+ TGATGGGTTTAGAGTTTGGGGATCGGAGACAAATAATTGAAGTGTTTGCGGTAGAAGTAA
                      ____________________________________________________________
consensus TGATGGGTTTAGAGTTTGGGGATCGGAGACAAATAATTGAAGTGTTTGCGGTAGAAGTAA
 
. : . : . : . : . : . :
JMSF045P05+ AGATACTT
JMSF007E05+ AGATACTTATTGAATCAGGACCACTAGAATTCGTTTGAGTACACGTTAGTAGATTGATCC
                      ____________________________________________________________
consensus AGATACTTATTGAATCAGGACCACTAGAATTCGTTTGAGTACACGTTAGTAGATTGATCC