Previous Contig 004864:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS018D06Sequence638004864 (3)gb:AK118785_18167471e-85Arabidopsis thaliana At3g20440 mRNA for putative 1,4-alpha-glucan branching enzy
JMSF005B23Sequence289004864 (3)531009258 (3)gb:AY351386_16016842e-31Nicotiana benthamiana DNA gyrase A subunit mRNA, complete cds.
JMSF007D02Sequence306004864 (3)658022204gb:AK118785_18167473e-34Arabidopsis thaliana At3g20440 mRNA for putative 1,4-alpha-glucan branching enzy

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS018D06+ ATCAGGATCAGGTCTAATTTCCTCAAGTTCTTCTTCTGTTTGAGGTCCATTTGGCC
                      ____________________________________________________________
consensus ATCAGGATCAGGTCTAATTTCCTCAAGTTCTTCTTCTGTTTGAGGTCCATTTGGCC
 
. : . : . : . : . : . :
JMFS018D06+ CAAATATTTGCTCAAACAACTTAGCTGCAATCTCAAAACGTGATTTACCGTACTGGTCTT
                      ____________________________________________________________
consensus CAAATATTTGCTCAAACAACTTAGCTGCAATCTCAAAACGTGATTTACCGTACTGGTCTT
 
. : . : . : . : . : . :
JMFS018D06+ CACCAGGTTCCCAATATTCATCATTTGCTTTTTTGAACATCTCTTCTGCAGTAACACTAT
                      ____________________________________________________________
consensus CACCAGGTTCCCAATATTCATCATTTGCTTTTTTGAACATCTCTTCTGCAGTAACACTAT
 
. : . : . : . : . : . :
JMFS018D06+ CACCTTTATCATAGTCATCCACATAATTGTACTGTTGAAAATAGATTGTGTCTGCTTCTT
                      ____________________________________________________________
consensus CACCTTTATCATAGTCATCCACATAATTGTACTGTTGAAAATAGATTGTGTCTGCTTCTT
 
. : . : . : . : . : . :
JMFS018D06+ CTCCAGGACGTAATTTATCATCAAGTATAATAAGCCAATATCCATAATCATCATGGCCAA
                      ____________________________________________________________
consensus CTCCAGGACGTAATTTATCATCAAGTATAATAAGCCAATATCCATAATCATCATGGCCAA
 
. : . : . : . : . : . :
JMFS018D06+ AATGACCCTCTCTGGCACAATTTTCAGTTGGTGACCATCCATTAAAATCGCCAACAATTG
                      ____________________________________________________________
consensus AATGACCCTCTCTGGCACAATTTTCAGTTGGTGACCATCCATTAAAATCGCCAACAATTG
 
. : . : . : . : . : . :
JMFS018D06+ CACAATAGCGAGCACCTGGAGCCCACTCCAAGAAATCCACTCGATGCTGCGGATTCCGGT
                      ____________________________________________________________
consensus CACAATAGCGAGCACCTGGAGCCCACTCCAAGAAATCCACTCGATGCTGCGGATTCCGGT
 
. : . : . : . : . : . :
JMFS018D06+ GCATACCCATCATATCAAATCCGGAAGCCATCTCCTTGAGATTGAGGTGACGATTAAGAA
                      ____________________________________________________________
consensus GCATACCCATCATATCAAATCCGGAAGCCATCTCCTTGAGATTGAGGTGACGATTAAGAA
 
. : . : . : . : . : . :
JMFS018D06+ TCTCGTCTTTCAAGTCCTTCAGTAATTTATGCCTTTCACGTAAAAACTGAGCAAAAGCTT
                      ____________________________________________________________
consensus TCTCGTCTTTCAAGTCCTTCAGTAATTTATGCCTTTCACGTAAAAACTGAGCAAAAGCTT
 
. : . : . : . : . : . :
JMFS018D06+ TGTTGGTAATGGCGTATTTGGAGAGGAACCCAACTGGGTCAATTCCGTTTTCGTCGTCGG
JMSF005B23+ GGTCAATTCCGTTTTCGTCGTCGG
JMSF007D02+ CGTCGG
                      ____________________________________________________________
consensus TGTTGGTAATGGCGTATTTGGAGAGGAACCCAACTGGGTCAATTCCGTTTTCGTCGTCGG
 
. : . : . : . : . : . :
JMFS018D06+ ACCGGTTCCTTTTCTGCTTCGGTGGCCGTTGTTTCTGCCCTT
JMSF005B23+ ACCGGTTCCTTTTCTGCTTCGGTGGCCGTTGTTTCTGCCCTTGTGGCTGAGGCTGCTCGG
JMSF007D02+ ACCGGTTCCTTTTCTGCTTCGGTGGCCGTTGTTTCTGCCCTTGTGGCTGAGGCTGCTCGG
                      ____________________________________________________________
consensus ACCGGTTCCTTTTCTGCTTCGGTGGCCGTTGTTTCTGCCCTTGTGGCTGAGGCTGCTCGG
 
. : . : . : . : . : . :
JMSF005B23+ CCGCAGAGCACCTCCACTTCCCCCTAGTGCGAAGGGCAACTCGATTAAGGATTCTGCCAT
JMSF007D02+ CCGCAGAGCACCTCCACTTCCCCCTAGTGCGAAGGGCAACTCGATTAAGGATTCTGCCAT
                      ____________________________________________________________
consensus CCGCAGAGCACCTCCACTTCCCCCTAGTGCGAAGGGCAACTCGATTAAGGATTCTGCCAT
 
. : . : . : . : . : . :
JMSF005B23+ GGCTTTGAATCAGTACAAATTGGGGATGAGTTTTGCTATTGCTTCTCTGAAATTGGGAGT
JMSF007D02+ GGCTTTGAATCAGTACAAATTGGGGATGAGTTTTGCTATTGCTTCTCTGAAATTGGGAGT
                      ____________________________________________________________
consensus GGCTTTGAATCAGTACAAATTGGGGATGAGTTTTGCTATTGCTTCTCTGAAATTGGGAGT
 
. : . : . : . : . : . :
JMSF005B23+ TGAGACGATGGTTGAAGATAGCATTGTTTGAGAGATGAATTGCAGCGGCGTTTGTGATTG
JMSF007D02+ TGAGACGATGGTTGAAGATAGCATTGTTTGAGAGATGAATTGCAGCGGCGTTTGTGATTG
                      ____________________________________________________________
consensus TGAGACGATGGTTGAAGATAGCATTGTTTGAGAGATGAATTGCAGCGGCGTTTGTGATTG
 
. : . : . : . : . : . :
JMSF005B23+ ATTGCATAGTTAGATGTGAACTGT
JMSF007D02+ ATTGCATAGTTAGATGTGAACTGTAAGCTCTAGAGTGAGCTATGGAACTGTAAGTCTGCC
                      ____________________________________________________________
consensus ATTGCATAGTTAGATGTGAACTGTAAGCTCTAGAGTGAGCTATGGAACTGTAAGTCTGCC