Previous Contig 004862:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF007C19Sequence366004862 (6)764011364 (6)
JMSF013F19Sequence235002430 (6)gb:AF227623_17788613e-04Euphorbia esula unknown mRNA.757004862 (6)
JMSF015P09Sequence335004862 (6)gb:BT014908_16418983e-04Arabidopsis thaliana At5g54075 gene, complete cds.>gb:BT015029_1641999 Arabidops777022687gb:BT009663_16401240.026Arabidopsis thaliana At4g00370 gene, complete cds.>gb:AK118390_1816369 Arabidops
JMSF025C24Sequence635004862 (6)gb:BT014908_16418982e-06Arabidopsis thaliana At5g54075 gene, complete cds.>gb:BT015029_1641999 Arabidops743023160pir|T01445|T014452e-16hypothetical protein F24O1.7 - Arabidopsis thaliana>gb:AE005173_893904 Arabidops
JMSF026B12Sequence691004862 (6)gb:BT014908_16418982e-06Arabidopsis thaliana At5g54075 gene, complete cds.>gb:BT015029_1641999 Arabidops782023209gb:BT014908_16418983e-06Arabidopsis thaliana At5g54075 gene, complete cds.>gb:BT015029_1641999 Arabidops
JMSF041K06Sequence675004862 (6)gb:BT014908_16418982e-07Arabidopsis thaliana At5g54075 gene, complete cds.>gb:BT015029_1641999 Arabidops666011364 (6)gb:AY058177_15643139e-04Arabidopsis thaliana At2g24280/F27D4.19 mRNA, complete cds.>gb:AY142011_1582848

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF013F19- TCCTTGGTATAATGCCAACAGATTATACCTCCNTCTCACAT
                      ____________________________________________________________
consensus TCCTTGGTATAATGCCAACAGATTATACCTCCNTCTCACAT
 
. : . : . : . : . : . :
rJMSF013F19- ACTATGCTAAGGTAATGAATTAGTCNCAAAACTGCNACCACTCAGAAGCAAACATTACAG
                      ____________________________________________________________
consensus ACTATGCTAAGGTAATGAATTAGTCNCAAAACTGCNACCACTCAGAAGCAAACATTACAG
 
. : . : . : . : . : . :
rJMSF013F19- TACACTCAATCAAAAATATGAAACTGTTAGTTGCATCTATCATCACGAACTAAAACCTAA
                      ____________________________________________________________
consensus TACACTCAATCAAAAATATGAAACTGTTAGTTGCATCTATCATCACGAACTAAAACCTAA
 
. : . : . : . : . : . :
rJMSF013F19- GATAACAGCCACCCAGTGACGAAGCTTCAATTCAGACTCTCATCTTTCCACGGATACCCA
                      ____________________________________________________________
consensus GATAACAGCCACCCAGTGACGAAGCTTCAATTCAGACTCTCATCTTTCCACGGATACCCA
 
. : . : . : . : . : . :
rJMSF013F19- ATATTATATTTCTCTCTATGAATCCAATTAAACCGAGGAGATTAACTTTCTCCTAAACCG
                      ____________________________________________________________
consensus ATATTATATTTCTCTCTATGAATCCAATTAAACCGAGGAGATTAACTTTCTCCTAAACCG
 
. : . : . : . : . : . :
rJMSF013F19- CAACACCCAATCCCTAACCGAATTAATTATACACAACTATATATGAAGCGATTAATTGAG
                      ____________________________________________________________
consensus CAACACCCAATCCCTAACCGAATTAATTATACACAACTATATATGAAGCGATTAATTGAG
 
. : . : . : . : . : . :
rJMSF013F19- ATGCTAATCTTCTTCCAAACAGAATATAAATGCTAATCAACTGAGGAATTGAAGAAATTG
                      ____________________________________________________________
consensus ATGCTAATCTTCTTCCAAACAGAATATAAATGCTAATCAACTGAGGAATTGAAGAAATTG
 
. : . : . : . : . : . :
rJMSF013F19- CAACTAACTGACCTCGATATGATAATGAATCAATAACTGTTTATCAAACCATCAGCTTCG
JMSF025C24+ CGATGATGAATCAATAACTGTTGATCAAACCATCAGCTTCG
JMSF026B12+ ATGAATCAATAACTGTTGATCAAACCATCAGCTTCG
                      ____________________________________________________________
consensus CAACTAACTGACCTCGATATGATGATGAATCAATAACTGTTGATCAAACCATCAGCTTCG
 
. : . : . : . : . : . :
rJMSF013F19- GAATTTCATTAAACCCTTATTGCTTCCATTTGCGCTAGTCTGATAGATAGTCTCAG
JMSF025C24+ GAATTCCATTAAACCCTTATTGCTTCCATTTGCGCTAGTCTGATAGATAGTCTCAGACTC
JMSF026B12+ GAATTCCATTAAACCCTTATTGCTTCCATTTGCGCTAGTCTGATAGATAGTCTCAGACTC
                      ____________________________________________________________
consensus GAATTCCATTAAACCCTTATTGCTTCCATTTGCGCTAGTCTGATAGATAGTCTCAGACTC
 
. : . : . : . : . : . :
JMSF025C24+ TCAGTTCAACAACCAAAACTTCAGAAATTAAATTTCCCACATCGGGCAGCTATTAAACTT
JMSF015P09+ GAAATTAAATGTCCCACATTGGAAAACTATAAAAATG
JMSF026B12+ TCAGTTCAACAACCAAAACTTCAGAAATTAAATTTCCCACATCGGGCAGCTATTAAACTT
JMSF041K06+ TCCCACACCGGCCAACTATGAAACTG
                      ____________________________________________________________
consensus TCAGTTCAACAACCAAAACTTCAGAAATTAAATTTCCCACATCGGGCAGCTATTAAACTT
 
. : . : . : . : . : . :
JMSF025C24+ GAAATCAAAATATAAGGTTCTATTTGCGAGAGTTAGTCACGACCTTACTTGAACAGGATC
JMSF015P09+ GAAACCAAAATATAAGGTTCCATTTGTGAGAGTTGGTCACGATNTTACTTGAACNGGATC
JMSF026B12+ GAAATCAAAATATAAGGTTCTATTTGCGAGAGTTAGTCACGACCTTACTTGAACAGGATC
JMSF041K06+ GAAACCAAAATATAAGGTTCAATTTGTGAAACTTGGTCACGACCATACTTGAACAGGATC
                      ____________________________________________________________
consensus GAAATCAAAATATAAGGTTCTATTTGTGAGAGTTGGTCACGACCTTACTTGAACAGGATC
 
. : . : . : . : . : . :
JMSF025C24+ TGTTCTATAGGCTCGTACCTCTGTATCCTTGAGTTCTAAGGAGACAGGAAACTAAGCCTG
JMSF015P09+ TGTTCTATAGATTCGTACCTCTGTATCCNTGAGTTNTAAGGNGACAGGAAACTAAGCCTG
JMSF026B12+ TGTTCTATAGGCTCGTACCTCTGTATCCTTGAGTTCTAAGGAGACAGGAAACTAAGCCTG
JMSF041K06+ TGTTCTGTAGGCTTGTACCTCTGTATCCTTGAGTTCAAAGGAGACAGGAAACTAAGCCTG
                      ____________________________________________________________
consensus TGTTCTATAGGCTCGTACCTCTGTATCCTTGAGTTCTAAGGAGACAGGAAACTAAGCCTG
 
. : . : . : . : . : . :
JMSF025C24+ GTGGATGAATCATGGCCAAGGGGCTAGAGCGTGAGTAACAGCACCGTACCTTCACCGGGC
JMSF015P09+ GTGGATGAGATATGGCCNGGAGGCTAGAGCGTGAATAACGGCNCCGTACCTTCGCCGGGC
JMSF026B12+ GTGGATGAATCATGGCCAAGGGGCTAGAGCGTGAGTAACAGCACCGTACCTTCACCGGGC
JMSF041K06+ GTGGATGAGATATGGCCAAGAAGCTAGAGCGTGAGTAACAGGACCGTACCTTCGCCAGGC
JMSF007C19+ GGC
                      ____________________________________________________________
consensus GTGGATGAGTTATGGCCAAGGGGCTAGAGCGTGAGTAACAGCACCGTACCTTCGCCGGGC
 
. : . : . : . : . : . :
JMSF025C24+ GGAGCCGTCGAGGATCGTTCCTGGCCGCCTAGCCGCGGCTGGGATGGCCTCTTGTCTGTC
JMSF015P09+ GGAGCTGTAGAGGATCGTTCCCGGCCGTCTAGCCGCGGCTGGGATGGCCTNTTGGTTGTN
JMSF026B12+ GGAGCCGTCGAGGATCGTTCCTGGCCGCCTAGCCGCGGCTGGGATGGCCTCTTGTCTGTC
JMSF041K06+ GGAGCTGTTGAGGATCGTTCCCGGCCGTCTAGCCGCGGCTGGGATGGCCTCTTGGCTGTC
JMSF007C19+ GGAGCTGTTGAGGATCGTTCCCGGCCGTCTAGCCGCGGCTGGGATGGCCTCTTGGCTGTC
                      ____________________________________________________________
consensus GGAGCTGTTGAGGATCGTTCCCGGCCGTCTAGCCGCGGCTGGGATGGCCTCTTGGCTGTC
 
. : . : . : . : . : . :
JMSF025C24+ TGACAGGCTTCCCTTCTTTTT
JMSF015P09+ TGACAGGCTTCCCATCTTTTT
JMSF026B12+ TGACAGGCTTCCCTTCTTTTT
JMSF041K06+ TGACAGGCTTCCCATCTTTTTGTTTTTCCCCCTTTTTTCAATTTTCATTGGTGGCTTCTT
JMSF007C19+ TGACAGGCTTCCCATCTTTTTGTTTTTCCCCCTTTTTTCAATTTTCATTGGTGGCTTCTT
                      ____________________________________________________________
consensus TGACAGGCTTCCCATCTTTTTGTTTTTCCCCCTTTTTTCAATTTTCATTGGTGGCTTCTT
 
. : . : . : . : . : . :
JMSF041K06+ CGGTTCTTCCTAAAATGGAGCTGCAGAACAGTAGAACACTATGAAAGTTCTACGTTCTCG
JMSF007C19+ CGGTTCTTCCTAAAATGGAGCTGCAGAACAGTAGAACACTATGAAAGTTCTACGTTCTCG
                      ____________________________________________________________
consensus CGGTTCTTCCTAAAATGGAGCTGCAGAACAGTAGAACACTATGAAAGTTCTACGTTCTCG
 
. : . : . : . : . : . :
JMSF041K06+ GGATCTTTAAAGTGATGCATTAATCTATGAACAAGAAGCGTTTGTAGTCCAACGGTTAGG
JMSF007C19+ GGATCTTTAAAGTGATGCATTAATCTATGAACAAGAAGCGTTTGTAGTCCAACGGTTAGG
                      ____________________________________________________________
consensus GGATCTTTAAAGTGATGCATTAATCTATGAACAAGAAGCGTTTGTAGTCCAACGGTTAGG
 
. : . : . : . : . : . :
JMSF041K06+ ATAATTGCCTTCCAAGCAATAGACCCGGGTTTGACTCCCG
JMSF007C19+ ATAATTGCCTTCCAAGCAATAGACCCGGGTTTGACTCCCGGCAAACGCATTACTTTCCCT
                      ____________________________________________________________
consensus ATAATTGCCTTCCAAGCAATAGACCCGGGTTTGACTCCCGGCAAACGCATTACTTTCCCT
 
. : . : . : . : . : . :
JMSF007C19+ CTTTTGTTCAATAATGAAGGGAGCGGAAGCAGAGTCATGAATTGTCTTGCACGCAGAGTC
                      ____________________________________________________________
consensus CTTTTGTTCAATAATGAAGGGAGCGGAAGCAGAGTCATGAATTGTCTTGCACGCAGAGTC