Previous Contig 004859:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF016A14Sequence549004859 (4)gb:SLY12529_17154343e-54S.latifolia mRNA for hypothetical protein, clone CCLS52.792008947 (3)gb:SLY12529_17154344e-54S.latifolia mRNA for hypothetical protein, clone CCLS52.
JMFF037N05Sequence574004859 (4)gb:SLY12529_17154341e-56S.latifolia mRNA for hypothetical protein, clone CCLS52.773008947 (3)gb:SLY12529_17154342e-43S.latifolia mRNA for hypothetical protein, clone CCLS52.
JMFS092B01Sequence619004859 (4)gb:AY123995_15800742e-65Arabidopsis thaliana AT3g15410/MJK13_7 mRNA, complete cds.>gb:BT001058_1635313 A
JMSF007C06Sequence353004859 (4)gb:SLY12529_17154343e-26S.latifolia mRNA for hypothetical protein, clone CCLS52.776008947 (3)gb:SLY12529_17154341e-53S.latifolia mRNA for hypothetical protein, clone CCLS52.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS092B01+ GAT
                      ____________________________________________________________
consensus GAT
 
. : . : . : . : . : . :
JMFS092B01+ GCATTCAGTTCTGTAAGCATTGTGCATGATGAAAACAAATTCTCAGATAGCACTGGTAGC
                      ____________________________________________________________
consensus GCATTCAGTTCTGTAAGCATTGTGCATGATGAAAACAAATTCTCAGATAGCACTGGTAGC
 
. : . : . : . : . : . :
JMFS092B01+ TTGTTTCCCTCCACTTCCAACTTCATTAATTTTGAACAGTTTGCTAGATCTTCTGGCAAT
JMFF037N05+ CCCTCCACTTCCAACTTCATTAATTTTGAACAGTTTGCTAGATCTTCTGGCAAT
JMFF016A14+ TTGAACAGTTTGCTAGATCTTCTGGCAAT
                      ____________________________________________________________
consensus TTGTTTCCCTCCACTTCCAACTTCATTAATTTTGAACAGTTTGCTAGATCTTCTGGCAAT
 
. : . : . : . : . : . :
JMFS092B01+ CCCGAAATATTATTGTTTGATGCCTTGAGTTCTGCTAGATTTGAACATCTTCCAAGGGAA
JMFF037N05+ CCCGAAATATTATTGTTTGATGCCTTGAGTTCTGCTAGATTTGAACATCTTCCAAGGGAA
JMFF016A14+ CCCGAAATATTATTGTTTGATGCCTTGAGTTCTGCTAGATTTGAACATCTTCCAAGGGAA
                      ____________________________________________________________
consensus CCCGAAATATTATTGTTTGATGCCTTGAGTTCTGCTAGATTTGAACATCTTCCAAGGGAA
 
. : . : . : . : . : . :
JMFS092B01+ TCAGGAAGATCATTTAGTTGGTTGTTTGAGCAATCAAACTTGACAAGAGCTGCTGCTGCT
JMFF037N05+ TCAGGAAGATCATTTAGTTGGTTGTTTGAGCAATCAAACTTGACAAGAGCTGCTGCTGCT
JMFF016A14+ TCAGGAAGATCATTTAGTTGGTTGTTTGAGCAATCAAACTTGACAAGAGCTGCTGCTGCT
                      ____________________________________________________________
consensus TCAGGAAGATCATTTAGTTGGTTGTTTGAGCAATCAAACTTGACAAGAGCTGCTGCTGCT
 
. : . : . : . : . : . :
JMFS092B01+ CCAATTACTTCTGGAATACTCTGAATCACATTAAATGACACATCCAATGATTTGAGCATT
JMFF037N05+ CCAATTACTTCTGGAATACTCTGAATCACANTAAATGACACATCCAATGATTTGAGCATT
JMFF016A14+ CCAATTACTTCTGGAATACTCTGAATCACATTAAATGACACATCCAATGATTTGAGCATT
                      ____________________________________________________________
consensus CCAATTACTTCTGGAATACTCTGAATCACATTAAATGACACATCCAATGATTTGAGCATT
 
. : . : . : . : . : . :
JMFS092B01+ TGAAGCTCTCCAATAGCAGCTGGAAGGCATGTAAGCTTATTGTGGCTAACATTCAGCACA
JMFF037N05+ TGAAGCTCTCCAATAGCAGCTGGAAGGCATGTAAGCTTATTGTGGCTAACATTCAGCACA
JMFF016A14+ TGAAGCTCTCCAATAGCAGCTGGAAGGCATGTAAGCTTATTGTGGCTAACATTCAGCACA
JMSF007C06+ CTCCAATAGCAGCTGGAAGGCATGTAAGCTTATTGTGGCTAACATTCAGCACA
                      ____________________________________________________________
consensus TGAAGCTCTCCAATAGCAGCTGGAAGGCATGTAAGCTTATTGTGGCTAACATTCAGCACA
 
. : . : . : . : . : . :
JMFS092B01+ GTTAACATAGGTAAATTACGGAGGTCTTCCTTCAATGATTCAACATCATTATGAGCCAAA
JMFF037N05+ GTTAACATAGGTAAATTACGGAGGTCTTCCTTCAATGATTCAACATCATTATGAGCCAAA
JMFF016A14+ GTTAACATAGGTAAATTACGGAGGTCTTCCTTCAATGATTCAACATCATTATGAGCCAAA
JMSF007C06+ GTTAACATAGGTAAATTACGGAGGTCTTCCTTCAATGATTCAACATCATTATGAGCCAAA
                      ____________________________________________________________
consensus GTTAACATAGGTAAATTACGGAGGTCTTCCTTCAATGATTCAACATCATTATGAGCCAAA
 
. : . : . : . : . : . :
JMFS092B01+ ATCAACTTCTGCAGCTCTACTGCCTCCCACCATTTCTCATCCCCGCTAACTGCATCCAAG
JMFF037N05+ ATCAACTTCTGCAGCTCTACTGCCTCCCACCATTTCTCATCCCCGCTAACTGCATCCAAG
JMFF016A14+ ATCAACTTCTGCAGCTCTACTGCCTCCCACCATTTCTCATCCCCGCTAACTGCATCCAAG
JMSF007C06+ ATCAACTTCTGCAGCTCTACTGCCTCCCACCATTTCTCATCCCCGCTAACTGCATCCAAG
                      ____________________________________________________________
consensus ATCAACTTCTGCAGCTCTACTGCCTCCCACCATTTCTCATCCCCGCTAACTGCATCCAAG
 
. : . : . : . : . : . :
JMFS092B01+ CTTTGGTAGACCTCGTCTGGCACTTCCCTGAGAGAACGATTCGATAAGTTGAGTGAACCA
JMFF037N05+ CTTTGGTAGACCTCGTCTGGCACTTCCCTGAGAGAACGATTCGATAAGTTGAGTGAACCA
JMFF016A14+ CTTTGGTAGACCTCGTCTGGCACTTCCCTGAGAGAACGATTCGATAAGTTGAGTGAACCA
JMSF007C06+ CTTTGGTAGACCTCGTCTGGCACTTCCCTGAGAGAACGATTCGATAAGTTGAGTGAACCA
                      ____________________________________________________________
consensus CTTTGGTAGACCTCGTCTGGCACTTCCCTGAGAGAACGATTCGATAAGTTGAGTGAACCA
 
. : . : . : . : . : . :
JMFS092B01+ GAGGTTCTCGCAGCTTTCAAAACTCGATCCATGGCGGATTTTGCTGCATAAGCGAGTCGT
JMFF037N05+ GAGGTTCTCGCAGCTTTCAAAACTCGATCCATGGCGGATTTTGCTGCATAAGCGAGTCGT
JMFF016A14+ GAGGTTCTCGCAGCTTTCAAAACTCGATCCATGGCGGATTTTGCTGCATAAGCGAGTCGT
JMSF007C06+ GAGGTTCTCGCAGCTTTCAAAACTCGATCCATGGCGGATTTTGCTGCATAAGCGAGTCGT
                      ____________________________________________________________
consensus GAGGTTCTCGCAGCTTTCAAAACTCGATCCATGGCGGATTTTGCTGCATAAGCGAGTCGT
 
. : . : . : . : . : . :
JMFS092B01+ GACTCGGCGATTCGGA
JMFF037N05+ GACTCGGCGATTCGGACAGGAATCTCAGATCGATCTAATT
JMFF016A14+ GACTCGGCGATTCGGACAGGAATCTCAGATCGATCAAATT
JMSF007C06+ GACTCGGCGATTCGGACAGGAATCTCAGATCGATCTAATTCCCTCTGTTGGCAGAAGACC
                      ____________________________________________________________
consensus GACTCGGCGATTCGGACAGGAATCTCAGATCGATCTAATTCCCTCTGTTGGCAGAAGACC