Previous Contig 004858:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF007C04Sequence359004858 (3)gb:AP004346_18405843e-50Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC clone:P065589008075 (6)gb:AB007644_15101371e-22Arabidopsis thaliana genomic DNA, chromosome 5, TAC clone:K19P17.>gb:BT015927_16
JMSF021I23Sequence650004858 (3)pir|T00407|T004072e-6360S ribosomal protein L30 [imported] - Arabidopsis thaliana>gb:AC002388_1530617 747004858 (3)pir|T00407|T004072e-6360S ribosomal protein L30 [imported] - Arabidopsis thaliana>gb:AC002388_1530617

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF021I23- ATGTTTGAACATTGTACCACATAACAAA
                      ____________________________________________________________
consensus ATGTTTGAACATTGTACCACATAACAAA
 
. : . : . : . : . : . :
rJMSF021I23- AAAGATAGGGGTAGGAAGTAAGATGATGTGAAAAACATGACCAAAAAAATAAAATAAAAC
                      ____________________________________________________________
consensus AAAGATAGGGGTAGGAAGTAAGATGATGTGAAAAACATGACCAAAAAAATAAAATAAAAC
 
. : . : . : . : . : . :
rJMSF021I23- AAAACTTTTGATGAGCAGAGATGAAATGTCCTCCTTGGGCTCAATGAAGCATTTGATTTT
JMSF021I23+ GATGAGCAGAGATGAAATGTCCTCCTTGGGCTCAATGAAGCATTTGATTTT
                      ____________________________________________________________
consensus AAAACTTTTGATGAGCAGAGATGAAATGTCCTCCTTGGGCTCAATGAAGCATTTGATTTT
 
. : . : . : . : . : . :
rJMSF021I23- GGGACAAAATATATCACATGACAACACAGCAAAAAGACATTTACTCCTCCATGCGCTTTT
JMSF021I23+ GGGACAAAATATATCACATGACAACACAGCAAAAAGACATTTACTCCTCCATGCGCTTTT
                      ____________________________________________________________
consensus GGGACAAAATATATCACATGACAACACAGCAAAAAGACATTTACTCCTCCATGCGCTTTT
 
. : . : . : . : . : . :
rJMSF021I23- CTTCTGATTGTTGTTGTGAAACCTTGACCTTGATGGGCAAGGTGAGGGATGGATCTTGTT
JMSF021I23+ CTTCTGATTGTTGTTGTGAAACCTTGACCTTGATGGGCAAGGTGAGGGATGGATCTTGTT
                      ____________________________________________________________
consensus CTTCTGATTGTTGTTGTGAAACCTTGACCTTGATGGGCAAGGTGAGGGATGGATCTTGTT
 
. : . : . : . : . : . :
rJMSF021I23- GGAGAACAGAAGGAGCTTTGACCAAGTGGATACCCTGCTCCAGTTCCCTTGCTGCTTCTT
JMSF021I23+ GGAGAACAGAAGGAGCTTTGACCAAGTGGATACCCTGCTCCAGTTCCCTTGCTGCTTCTT
                      ____________________________________________________________
consensus GGAGAACAGAAGGAGCTTTGACCAAGTGGATACCCTGCTCCAGTTCCCTTGCTGCTTCTT
 
. : . : . : . : . : . :
rJMSF021I23- TCTGCTTTCGAAGTTTGTTGGGTCTCATCCTGTTTTTGTGGTGAGCAGCCTCCCTAGCAA
JMSF021I23+ TCTGCTTTCGAAGTTTGTTGGGTCTCATCCTGTTTTTGTGGTGAGCAGCCTCCCTAGCAA
                      ____________________________________________________________
consensus TCTGCTTTCGAAGTTTGTTGGGTCTCATCCTGTTTTTGTGGTGAGCAGCCTCCCTAGCAA
 
. : . : . : . : . : . :
rJMSF021I23- TTCTGACTTTATCGATTTTCTTTATGGCCTTCAAAGTGTTTTCTGTTACATTCTTGTCAA
JMSF021I23+ TTCTGACTTTATCGATTTTCTTTATGGCCTTCAAAGTGTTTTCTGTTACATTCTTGTCAA
JMSF007C04+ TCTGACTTTATCGATTTTCTTTATGGCCTTCAAAGTGTTTTCTGTTACATTCTNGTCAA
                      ____________________________________________________________
consensus TTCTGACTTTATCGATTTTCTTTATGGCCTTCAAAGTGTTTTCTGTTACATTCTTGTCAA
 
. : . : . : . : . : . :
rJMSF021I23- ATCTCTCTGGCCTATTTCTCTTCCTCTCAAATTCAAATGTTGCGTCCTGGGTCATGTCCT
JMSF021I23+ ATCTCTCTGGCCTATTTCTCTTCCTCTCAAATTCAAATGTTGCGTCCTGGGTCATGTCCT
JMSF007C04+ ATCTCTCTGGCCTATTTCTCTTCCTCTCAAATTCAAATGTTGCGTCCTGGGTCATGTCCT
                      ____________________________________________________________
consensus ATCTCTCTGGCCTATTTCTCTTCCTCTCAAATTCAAATGTTGCGTCCTGGGTCATGTCCT
 
. : . : . : . : . : . :
rJMSF021I23- TTCCATGTAACCGTCTATAGGCCTTAGTCCACTTAACCTTACGAGGATTCCTCTTCATCT
JMSF021I23+ TTCCATGTAACCGTCTATAGGCCTTAGTCCACTTAACCTTACGAGGATTCCTCTTCATCT
JMSF007C04+ TTCCATGTAACCGTCTATAGGCCTTAGTCCACTTAACCTTACGAGGATTCCTCTTCATCT
                      ____________________________________________________________
consensus TTCCATGTAACCGTCTATAGGCCTTAGTCCACTTAACCTTACGAGGATTCCTCTTCATCT
 
. : . : . : . : . : . :
rJMSF021I23- TAAAGTTCTTGTGACATTTAGATCTGCAGAACCGAAAAATCTTTGCATCGTTTCGAACAA
JMSF021I23+ TAAAGTTCTTGTGACATTTAGATCTGCAGAACCGAAAAATCTTTGCATCGTTTCGAACAA
JMSF007C04+ TAAAGTTCTTGTGACATTTAGATCTGCAGAACCGAAAAATCTTTGCATCGTTTCGAACAA
                      ____________________________________________________________
consensus TAAAGTTCTTGTGACATTTAGATCTGCAGAACCGAAAAATCTTTGCATCGTTTCGAACAA
 
. : . : . : . : . : . :
rJMSF021I23- ATTGAATACCATGGCCTGGGTAGATAGTTGATGAGCAAAACCAGCACTTTTCCAACCTCA
JMSF021I23+ ATTGAATACCATGGCCTGGGTAGATAGTTGATGAGCAAAACCAGCACTTTTCCAACCTCA
JMSF007C04+ ATTGAATACCATGGCCTGGGTAGATAGTTGATGAGCAAAACCAGCACTTTTCCAACCTCA
                      ____________________________________________________________
consensus ATTGAATACCATGGCCTGGGTAGATAGTTGATGAGCAAAACCAGCACTTTTCCAACCTCA
 
. : . : . : . : . : . :
rJMSF021I23- TTATGTCTTCAACGGCGACCGCTGTCTTCAAAGGATGGCTGTGCAGGAGAACCGTCT
JMSF021I23+ TTATGTCTTCAACGGCGACCGCTGTCTTCAAAGGATGGCTGTGCAGGAGAACCGTCT
JMSF007C04+ TTATGTCTTCAACGGCGACCGCTGTCTTCAAAGGATGGCTGTGCAGGAGAACCGTCTCTC
                      ____________________________________________________________
consensus TTATGTCTTCAACGGCGACCGCTGTCTTCAAAGGATGGCTGTGCAGGAGAACCGTCTCTC