Previous Contig 004855:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF010C19Sequence169004855 (2)741006535 (64)sp|P34921|G3PC_DIACA1e-77Glyceraldehyde 3-phosphate dehydrogenase, cytosolic (EC 1.2.1.12).
JMSF007A15Sequence267004855 (2)

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF010C19+ CANCTCCAACAATTCNTAAATCCCAGTATGAAGTGTA
                      ____________________________________________________________
consensus CANCTCCAACAATTCNTAAATCCCAGTATGAAGTGTA
 
. : . : . : . : . : . :
JMFF010C19+ AGCCAAACCCCCCCAATANTAAAAAATGGGGAAAAGAGCGTTAAAGTAACAAGTAATTAT
JMSF007A15+ AAGAGCGTTAAAGTAACAAGTAATTAT
                      ____________________________________________________________
consensus AGCCAAACCCCCCCAATANTAAAAAATGGGGAAAAGAGCGTTAAAGTAACAAGTAATTAT
 
. : . : . : . : . : . :
JMFF010C19+ CTTGGAATATTCACCATCCAGATCTCAGGGTATTTATTTTATTTATTTATTTATTTTAAT
JMSF007A15+ CTTGGAATATTCACCATCCAGATCTCAGGGTATTTATTTTATTTATTTATTTATTTTAAT
                      ____________________________________________________________
consensus CTTGGAATATTCACCATCCAGATCTCAGGGTATTTATTTTATTTATTTATTTATTTTAAT
 
. : . : . : . : . : . :
JMFF010C19+ TTCAAACTCCCT
JMSF007A15+ TTCAAACTCCCTACAGGGCTAGTTCCAATTTATGAGAAGATAAAGGGGGGTTGAAAACAA
                      ____________________________________________________________
consensus TTCAAACTCCCTACAGGGCTAGTTCCAATTTATGAGAAGATAAAGGGGGGTTGAAAACAA
 
. : . : . : . : . : . :
JMSF007A15+ TAGTGGCAAGAGACAATTGTACGGAACAAATGGTTGGAAATGAAATTGAGGAGATCCAAG
                      ____________________________________________________________
consensus TAGTGGCAAGAGACAATTGTACGGAACAAATGGTTGGAAATGAAATTGAGGAGATCCAAG
 
. : . : . : . : . : . :
JMSF007A15+ TAAAGGGAAAAAGGAAGGCGCAGGCTGAGGGTGGGGCGTAGGTGGCGAATGCGATAAGTC
                      ____________________________________________________________
consensus TAAAGGGAAAAAGGAAGGCGCAGGCTGAGGGTGGGGCGTAGGTGGCGAATGCGATAAGTC