Previous Contig 004854:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF027K21Sequence521004854 (3)gb:MSA248334_16870209e-14Medicago sativa subsp. X varia mRNA for Enod93 protein.
JMSF007A09Sequence202004854 (3)113011346 (7)gb:AF207906_17769603e-15Zantedeschia aethiopica catalase 1 (cat1) mRNA, complete cds.
JMSF042B05Sequence628004854 (3)gb:MSA248334_16870202e-14Medicago sativa subsp. X varia mRNA for Enod93 protein.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF027K21+ AACCCAA
JMSF042B05+ CCCAA
                      ____________________________________________________________
consensus AACCCAA
 
. : . : . : . : . : . :
JMFF027K21+ AAAAAAAAAANCATAATACTTCATTATTTGAAGGTACACAAAGGATAAGAAGAGTTGATC
JMSF042B05+ AAAAAAAAAAACATAATACTTCATTATTTGAAGGTACACAAAGGATAAGAAGAGTTGATC
                      ____________________________________________________________
consensus AAAAAAAAAAACATAATACTTCATTATTTGAAGGTACACAAAGGATAAGAAGAGTTGATC
 
. : . : . : . : . : . :
JMFF027K21+ TTGATCATCTTTCCTCTGATACAACACAGCACCTGGCATGGTCGAGAGCACAACTACTAT
JMSF042B05+ TTGATCATCTTTCCTCTGATACAACACAGCACCTGGCATGGTCGAGAGCACAACTACTAT
                      ____________________________________________________________
consensus TTGATCATCTTTCCTCTGATACAACACAGCACCTGGCATGGTCGAGAGCACAACTACTAT
 
. : . : . : . : . : . :
JMFF027K21+ GTCATCGCCTTAGGTTGTTTTGTCGTAATGGGTGTTCCTCCTCGCACATTCCAGGATTGT
JMSF042B05+ GTCATCGCCTTAGGTTGTTTTGTCGTAATGGGTGTTCCTCCTCGCACATTCCAGGATTGT
                      ____________________________________________________________
consensus GTCATCGCCTTAGGTTGTTTTGTCGTAATGGGTGTTCCTCCTCGCACATTCCAGGATTGT
 
. : . : . : . : . : . :
JMFF027K21+ TTTGCCAGCGGTGATGAAGTATGCAGCAATGGAAGCTGCAGATATAATAAGTGCCTGAGC
JMSF042B05+ TTTGTCAGCGGTGATGAAGTATGCAGCAATGGAAGCTGCAGATATAATAAGTGCCTGAGC
                      ____________________________________________________________
consensus TTTGTCAGCGGTGATGAAGTATGCAGCAATGGAAGCTGCAGATATAATAAGTGCCTGAGC
 
. : . : . : . : . : . :
JMFF027K21+ AGTGTAATTGAGGTTTGCTTTCGCCCAAGGAATCGTTCGGACAGCAACCAATGTTGGAAC
JMSF042B05+ AGTGTAATTGAGGTTTGCTTTCGCCCAAGGAATCGTTCGGACAGCAACCAATGTTGGAAC
                      ____________________________________________________________
consensus AGTGTAATTGAGGTTTGCTTTCGCCCAAGGAATCGTTCGGACAGCAACCAATGTTGGAAC
 
. : . : . : . : . : . :
JMFF027K21+ AGCGCTGGAAACACATGCAATTGCAGCAGCCTTGGCGCCAGCACGAACACCCTCTTGGGT
JMSF042B05+ AGCGCTGGAAACACATGCAATTGCAGCAGCCTTGGCGCCAGCACGAACACCCTCTTGGGT
                      ____________________________________________________________
consensus AGCGCTGGAAACACATGCAATTGCAGCAGCCTTGGCGCCAGCACGAACACCCTCTTGGGT
 
. : . : . : . : . : . :
JMFF027K21+ ACACTCTTGACTCCTGCGGATCTTTGCTTCCTCATAAGGAGAAGCAATCAAGAACGGCCT
JMSF042B05+ ACACTCTTGACTCCTGCGGATCTTTGCTTCCTCATAAGGAGAAGCAATCAAGAACGGCCT
                      ____________________________________________________________
consensus ACACTCTTGACTCCTGCGGATCTTTGCTTCCTCATAAGGAGAAGCAATCAAGAACGGCCT
 
. : . : . : . : . : . :
JMFF027K21+ GTCCATTTGGAATCTTGATGAAATCCCCATTTTTTTTTATTTATCTGTTCTCGAGAACCC
JMSF042B05+ GTCCATTTGGAATCTTGATGAAATCCCCATTTTTTTTTATTTATCTGTTCTCGAGAACCC
JMSF007A09+ ATTTATCTGTTCTCGAGAACCC
                      ____________________________________________________________
consensus GTCCATTTGGAATCTTGATGAAATCCCCATTTTTTTTTATTTATCTGTTCTCGAGAACCC
 
. : . : . : . : . : . :
JMFF027K21+ CAATTCTGCGTCTAAGCGATCAACTCAAATACAT
JMSF042B05+ CAATTCTGCGTCTAAGCGATCAACTCAAATACATACGCAATAATTGAAACAGATAGCAGT
JMSF007A09+ CAATTCTGCGTCTAAGCGATCAACTCAAATACATACGCAATAATTGAAACAGATAGCAGT
                      ____________________________________________________________
consensus CAATTCTGCGTCTAAGCGATCAACTCAAATACATACGCAATAATTGAAACAGATAGCAGT
 
. : . : . : . : . : . :
JMSF042B05+ TTAAATATATAATGGAATCTTGACGGAGACAACTACTCTATATTATTAGAGTAGAGAGTA
JMSF007A09+ TTAAATATATAATGGAATCTTGACGGAGACAACTACTCTATATTATTAGAGTAGAGAGTA
                      ____________________________________________________________
consensus TTAAATATATAATGGAATCTTGACGGAGACAACTACTCTATATTATTAGAGTAGAGAGTA
 
. : . : . : . : . : . :
JMSF042B05+ GAGAAGAAATTGAGAAAAAAGC
JMSF007A09+ GAGAAGAAATTGAGAAAAAAGCGAACTTGGCTTTTCCGGCGGCTTTGTTACTTTATGGCC
                      ____________________________________________________________
consensus GAGAAGAAATTGAGAAAAAAGCGAACTTGGCTTTTCCGGCGGCTTTGTTACTTTATGGCC