Previous Contig 004841:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF006O20Sequence270004841 (3)gb:AP004845_18458730.014Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ12
JMSF015A05Sequence336004841 (3)gb:AP004845_18458732e-13Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ12815004841 (3)gb:AP004845_18458731e-49Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ12

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF015A05- GTTCAGTTGTTCTACATTCCTATCTACATATTTCATGTGCAT
                      ____________________________________________________________
consensus GTTCAGTTGTTCTACATTCCTATCTACATATTTCATGTGCAT
 
. : . : . : . : . : . :
rJMSF015A05- GTATATATATATATATAGATATAGATAGCGGCTTCCTTTAAAAGAACATATGAAGACCTT
                      ____________________________________________________________
consensus GTATATATATATATATAGATATAGATAGCGGCTTCCTTTAAAAGAACATATGAAGACCTT
 
. : . : . : . : . : . :
rJMSF015A05- GATACAATAGTCGGGTGGGTTGAACTGTAAAACTCGAGTGTACCCGGGGTAGAACGTGAT
                      ____________________________________________________________
consensus GATACAATAGTCGGGTGGGTTGAACTGTAAAACTCGAGTGTACCCGGGGTAGAACGTGAT
 
. : . : . : . : . : . :
rJMSF015A05- CAGAGTTTCGACATCTGGAATCTGGAAAGACGTTGTCAATGCCAGCTAGCTTTTGCCTTG
                      ____________________________________________________________
consensus CAGAGTTTCGACATCTGGAATCTGGAAAGACGTTGTCAATGCCAGCTAGCTTTTGCCTTG
 
. : . : . : . : . : . :
rJMSF015A05- TTATCGATGCTATTGAAATTTAAAAAAACTCTCCAGTCCTTGCTCCAGCTCAAGGACTCT
                      ____________________________________________________________
consensus TTATCGATGCTATTGAAATTTAAAAAAACTCTCCAGTCCTTGCTCCAGCTCAAGGACTCT
 
. : . : . : . : . : . :
rJMSF015A05- ATTTCTGAGGATCTCGACCTCTCTAGCTAGCTCTTCGTCCCGTTGTTTCATTGCCTCGAT
                      ____________________________________________________________
consensus ATTTCTGAGGATCTCGACCTCTCTAGCTAGCTCTTCGTCCCGTTGTTTCATTGCCTCGAT
 
. : . : . : . : . : . :
rJMSF015A05- TTCCTGCCTACGCAATCCCTCCTTCCTAGCTTCTGACCGGGCGCTTCTTTGCACCTCTAA
                      ____________________________________________________________
consensus TTCCTGCCTACGCAATCCCTCCTTCCTAGCTTCTGACCGGGCGCTTCTTTGCACCTCTAA
 
. : . : . : . : . : . :
rJMSF015A05- GATGACAGCAACTCCTGCAACCGTAAATATAAACAGTTCCCCTAGAAGATCAGCAGCAAG
                      ____________________________________________________________
consensus GATGACAGCAACTCCTGCAACCGTAAATATAAACAGTTCCCCTAGAAGATCAGCAGCAAG
 
. : . : . : . : . : . :
rJMSF015A05- TTGAACAGCCTTTTCTTCATTTAGAGGGCGAATCGCAACATCAATTGCACGTCCATAGAT
                      ____________________________________________________________
consensus TTGAACAGCCTTTTCTTCATTTAGAGGGCGAATCGCAACATCAATTGCACGTCCATAGAT
 
. : . : . : . : . : . :
rJMSF015A05- ACGCCTTTGCAACTTCGTTGTGAATCTATGATTCGTCTGGGCAAGATTGATGATGAGTTG
JMSF015A05+ TCTATGATTCGTCTGGGCAAGATTGATGATGAGTTG
                      ____________________________________________________________
consensus ACGCCTTTGCAACTTCGTTGTGAATCTATGATTCGTCTGGGCAAGATTGATGATGAGTTG
 
. : . : . : . : . : . :
rJMSF015A05- CCTGAACTCGGGATGAATGCCGGCCTCTTTCTTGAGGCGTTTGCCGATAGGTTTGCAGAA
JMSF015A05+ CCTGAACTCGGGATGAATGCCGGCCTCTTTCTTGAGGCGTTTGCCGATAGGTTTGCAGAA
JMSF006O20+ CTTGAGGCGTTTGCCGATAGGTTTGCAGAA
                      ____________________________________________________________
consensus CCTGAACTCGGGATGAATGCCGGCCTCTTTCTTGAGGCGTTTGCCGATAGGTTTGCAGAA
 
. : . : . : . : . : . :
rJMSF015A05- TGTTTTGAGAGCAAGTGAACCCAGCTTCGCTAATGGCAATATCATTGCAAAAAGCTAATA
JMSF015A05+ TGTTTTGAGAGCAAGTGAACCCAGCTTCGCTAATGGCAATATCATTGCAAAAAGCTAATA
JMSF006O20+ TGTTTTGAGAGCAAGTGAACCCAGCTTCGCTAATGGCAATATCATTGCAAAAAGCTAATA
                      ____________________________________________________________
consensus TGTTTTGAGAGCAAGTGAACCCAGCTTCGCTAATGGCAATATCATTGCAAAAAGCTAATA
 
. : . : . : . : . : . :
rJMSF015A05- GATATAACTCCAAAAATGTTATCTTTACTTACTACTAACCCAATTCTCAGCCGGAATTTC
JMSF015A05+ GATATAACTCCAAAAATGTTATCTTTACTTACTACTAACCCAATTCTCAGCCGGAATTTC
JMSF006O20+ GATATAACTCCAAAAATGTTATCTTTACTTACTACTAACCCAATTCTCAGCCGGAATTTC
                      ____________________________________________________________
consensus GATATAACTCCAAAAATGTTATCTTTACTTACTACTAACCCAATTCTCAGCCGGAATTTC
 
. : . : . : . : . : . :
rJMSF015A05- AAAGAAAAACTTCACTTCGTACTTCGTACACTATATGTGGATGCTTTTCTGGA
JMSF015A05+ AAAGAAAAACTTCACTTCGTACTTCGTACACTATATGTGGATGCTTTTCTGGACAGGCAG
JMSF006O20+ AAAGAAAAACTTCACTTCGTACTTCGTACACTATATGTGGATGCTTTTCTGGACAGGCAG
                      ____________________________________________________________
consensus AAAGAAAAACTTCACTTCGTACTTCGTACACTATATGTGGATGCTTTTCTGGACAGGCAG
 
. : . : . : . : . : . :
JMSF015A05+ TGAGGACTTGGGACGATAGTGGTGGTTCCGTGTTTGGCTTTCCGACAGTTTTCCTTGGCC
JMSF006O20+ TGAGGACTTGGGACGATAGTGGTGGTTCCGTGTTTGGCTTTCCGACAGTTTTCCTTGGCC
                      ____________________________________________________________
consensus TGAGGACTTGGGACGATAGTGGTGGTTCCGTGTTTGGCTTTCCGACAGTTTTCCTTGGCC