Previous Contig 004840:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF015A11Sequence423004840 (11)gb:AY088186_15732083e-05Arabidopsis thaliana clone 4267 mRNA, complete sequence.670004840 (11)gb:AY088186_15732082e-20Arabidopsis thaliana clone 4267 mRNA, complete sequence.
JMSF006O06Sequence304004840 (11)237022188
JMSF020A06Sequence686004840 (11)gb:AY088186_15732083e-27Arabidopsis thaliana clone 4267 mRNA, complete sequence.644004840 (11)gb:AY088186_15732082e-26Arabidopsis thaliana clone 4267 mRNA, complete sequence.
JMSF021M08Sequence653004840 (11)gb:AY088186_15732083e-27Arabidopsis thaliana clone 4267 mRNA, complete sequence.639004840 (11)gb:AY088186_15732089e-24Arabidopsis thaliana clone 4267 mRNA, complete sequence.
JMSF033E17Sequence686004840 (11)gb:AY088186_15732082e-26Arabidopsis thaliana clone 4267 mRNA, complete sequence.639004840 (11)gb:AY088186_15732081e-24Arabidopsis thaliana clone 4267 mRNA, complete sequence.
JMSF035B22Sequence689004840 (11)gb:AY088186_15732083e-27Arabidopsis thaliana clone 4267 mRNA, complete sequence.569004840 (11)gb:AY088186_15732086e-21Arabidopsis thaliana clone 4267 mRNA, complete sequence.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF033E17- AAAATTCTGAAAAAGGATCTTACAACT
rJMSF021M08- AAAATTCTGAAAAAGGATCTTACAACT
rJMSF035B22- AAAATTCTGAAAAAGGATCTTACAACT
rJMSF020A06- AAAATTCTGAAAAAGGATCTTACAACT
rJMFF015A11- GCTGCTGCATCATCATCACATGCTACAAAATTCTGAAAAAGGATCTTACAACT
                      ____________________________________________________________
consensus GCTGCTGCATCATCATCACATGCTACAAAATTCTGAAAAAGGATCTTACAACT
 
. : . : . : . : . : . :
rJMSF033E17- ACTCTAATAAAGCCTAATTTACAATAATTATATTTTTTAAAAAATTAAGAAATTAGGAAA
rJMSF021M08- ACTCTAATAAAGCCTAATTTACAATAATTATATTTTTTAAAAAATTAAGAAATTAGGAAA
rJMSF035B22- ACTCTAATAAAGCCTAATTTACAATAATTATATTTTTTAAAAAATTAAGAAATTAGGAAA
rJMSF020A06- ACTCTAATAAAGCCTAATTTACAATAATTATATTTTTTAAAAAATTAAGAAATTAGGAAA
rJMFF015A11- ACTCTAATAAAGCCTAATTTACAATAATTATATTTTTTAAAAAATTAAGAAATTAGGAAA
                      ____________________________________________________________
consensus ACTCTAATAAAGCCTAATTTACAATAATTATATTTTTTAAAAAATTAAGAAATTAGGAAA
 
. : . : . : . : . : . :
rJMSF033E17- AAAATAAAGAAAATTCCTAGCCTAATGTTCTACACTGTCTAAAACTCTTCTTTCTTTTTT
rJMSF021M08- AAAATAAAGAAAATTCCTAGCCTAATGTTCTACACTGTCTAAAACTCTTCTTTCTTTTTT
rJMSF035B22- AAAATAAAGAAAATTCCTAGCCTAATGTTCTACACTGTCTAAAACTCTTCTTTCTTTTTT
rJMSF020A06- AAAATAAAGAAAATTCCTAGCCTAATGTTCTACACTGTCTAAAACTCTTCTTTCTTTTTT
rJMFF015A11- AAAATAAAGAAAATTCCTAGCCTAATGTTCTACACTGTCTAAAACTCTTCTTTCTTTTTT
                      ____________________________________________________________
consensus AAAATAAAGAAAATTCCTAGCCTAATGTTCTACACTGTCTAAAACTCTTCTTTCTTTTTT
 
. : . : . : . : . : . :
rJMSF033E17- GTTTTTTAATTTTTTTTTTCCTAAGACCTAAAATACGATTAAAATGAATTACCATTTACC
rJMSF021M08- GTTTTTTAATTTTTTTTTTCCTAAGACCTAAAATACGATTAAAATGAATTACCATTTACC
rJMSF035B22- GTTTTTTAATTTTTTTTTTCCTAAGACCTAAAATACGATTAAAATGAATTACCATTTACC
rJMSF020A06- GTTTTTTAATTTTTTTTTTCCTAAGACCTAAAATACGATTAAAATGAATTACCATTTACC
rJMFF015A11- GTTTTTTAATTTTTTTTTTCCTAANACCTAAAATACGATTAAAATGAATTACCATTTACC
JMSF035B22+ AAATACGATTAAAATGAATTACCATTTACC
JMSF033E17+ TACGATTAAAATGAATTACCATTTACC
JMSF020A06+ TACGATTAAAATGAATTACCATTTACC
                      ____________________________________________________________
consensus GTTTTTTAATTTTTTTTTTCCTAAGACCTAAAATACGATTAAAATGAATTACCATTTACC
 
. : . : . : . : . : . :
rJMSF033E17- ACCATCATCATCACGCATCATTTGGTAAATTCCCAGCAGTTAAACCACATTTGATTGTTT
rJMSF021M08- ACCATCATCATCACGCATCATTTGGTAAATTCCCAGCAGTTAAACCACATTTGATTGTTT
rJMSF035B22- ACCATCATCATCACGCATCATTTGGTAAATTCCCAGCAGTTAAACCACATTTGATTGTTT
rJMSF020A06- ACCATCATCATCACGCATCATTTGGTAAATTCCCAGCAGTTAAACCACATTTGATTGTTT
rJMFF015A11- ACCATCATCATCACGCATCATTTGGTAAATTCCCAGCAGTTAAACCACATTTGATTGTTT
JMSF035B22+ ACCATCATCATCACGCATCATTTGGTAAATTCCCAGCAGTTAAACCACATTTGATTGTTT
JMSF033E17+ ACCATCATCATCACGCATCATTTGGTAAATTCCCAGCAGTTAAACCACATTTGATTGTTT
JMSF021M08+ ATCATCACGCATCATTTGGTAAATTCCCAGCAGTTAAACCACATTTGATTGTTT
JMSF020A06+ ACCATCATCATCACGCATCATTTGGTAAATTCCCAGCAGTTAAACCACATTTGATTGTTT
                      ____________________________________________________________
consensus ACCATCATCATCACGCATCATTTGGTAAATTCCCAGCAGTTAAACCACATTTGATTGTTT
 
. : . : . : . : . : . :
rJMSF033E17- AGCAAGGATTGGTCTCGGGCGGGTCGAANAGCTCCGGGCCGAGCATGGTTCGGCAAATCG
rJMSF021M08- AGCAAGGATTGGTCTCGGGCGGGTCGAANAGCTCCGGGCCGAGCATGGTTCGGCAAATCG
rJMSF035B22- AGCAAGGATTGGTCTCGGGCGGGTCGAANAGCTCCGGGCCGAGCATGGTTCGGCAAATCG
rJMSF020A06- AGCAAGGATTGGTCTCGGGCGGGTCGAANAGCTCCGGGCCGAGCATGGTTCGGCAAATCG
rJMFF015A11- AGCAAGGATTGGTCTCGGGCGGGTCNAAAAGCTCCGGGCCGAGCATGGTTCGGCAAATCG
JMSF035B22+ AGCAAGGATTGGTCTCGGGCGGGTCGAAGAGCTCCGGGCCGAGCATGGTTCGGCAAATCG
JMSF033E17+ AGCAAGGATTGGTCTCGGGCGGGTCGAAGAGCTCCGGGCCGAGCATGGTTCGGCAAATCG
JMSF021M08+ AGCAAGGATTGGTCTCGGGCGGGTCGAAGAGCTCCGGGCCGAGCATGGTTCGGCAAATCG
JMSF020A06+ AGCAAGGATTGGTCTCGGGCGGGTCGAAGAGCTCCGGGCCGAGCATGGTTCGGCAAATCG
                      ____________________________________________________________
consensus AGCAAGGATTGGTCTCGGGCGGGTCGAAGAGCTCCGGGCCGAGCATGGTTCGGCAAATCG
 
. : . : . : . : . : . :
rJMSF033E17- GGCAAACGGGGTGCTTGGCGAGCCACGTATCGGCGCATTCTANATGGAAGCCGNGGTTGC
rJMSF021M08- GGCAAACGGGGNGCTTGGCGAGCCACGTATCGGCGCATTCTANATGGAAGCCGNGGTTGC
rJMSF035B22- GGCAAACGGGGTGCTTGGCGAGCCACGTATCGGCGCATTCTAGATGGAAGCCGNGGTTGC
rJMSF020A06- GGCAAACGGGGTGCTTGGCGAGCCACGTATCGGCGCATTCTANATGGAAGCCGNGGTTGC
rJMFF015A11- GGCAAACGGGGTGCTTGGCGAGCC-CGTATCGGCGCATTCTAAATGGAAGCCGTGGTTGC
JMSF035B22+ GGCAAACGGGGTGCTTGGCGAGCCACGTATCGGCGCATTCTAGATGGAAGCCGTGGTTGC
JMSF033E17+ GGCAAACGGGGTGCTTGGCGAGCCACGTATCGGCGCATTCTAGATGGAAGCCGTGGTTGC
JMSF021M08+ GGCAAACGGGGTGCTTGGCGAGCCACGTATCGGCGCATTCTAGATGGAAGCCGTGGTTGC
JMSF020A06+ GGCAAACGGGGTGCTTGGCGAGCCACGTATCGGCGCATTCTAGATGGAAGCCGTGGTTGC
                      ____________________________________________________________
consensus GGCAAACGGGGTGCTTGGCGAGCCACGTATCGGCGCATTCTAGATGGAAGCCGTGGTTGC
 
. : . : . : . : . : . :
rJMSF033E17- AGCCGGGGACCACCCTCGCCGCTTGCTCGCTGCCGATGTCGTCCAGGCACACCGCGCAAT
rJMSF021M08- AGCCGGGGACCACCCTCGCCGCTTGCTCGCTGCCGATGTCGTCCAGGCACACCGCGCAAT
rJMSF035B22- AGCCGGGGACCACCCTCGCCGCTTGCTCGCTGCCGATGTCGTCCAGGCACACCGCGCAAT
rJMSF020A06- AGCCGGGGACCACCCTCGCCGCTTGCTCGCTGCCGATGTCGTCCAGGCACACCGCGCAAT
rJMFF015A11- AGCCGGGGACCACCCTCGCCGCTTGCTCGCTGCCNATGTCGTCCAGGCACACCGCGCAAT
JMSF035B22+ AGCCGGGGACCACCCTCGCCGCTTGCTCGCTGCCGATGTCGTCCAGGCACACCGCGCAAT
JMSF033E17+ AGCCGGGGACCACCCTCGCCGCTTGCTCGCTGCCGATGTCGTCCAGGCACACCGCGCAAT
JMSF021M08+ AGCCGGGGACCACCCTCGCCGCTTGCTCGCTGCCGATGTCGTCCAGGCACACCGCGCAAT
JMFF015A11+ GCAAT
JMSF020A06+ AGCCGGGGACCACCCTCGCCGCTTGCTCGCTGCCGATGTCGTCCAGGCACACCGCGCAAT
                      ____________________________________________________________
consensus AGCCGGGGACCACCCTCGCCGCTTGCTCGCTGCCGATGTCGTCCAGGCACACCGCGCAAT
 
. : . : . : . : . : . :
rJMSF033E17- CGNGGCCCATCACCAAATCCTTGCCGGTGATCGCCGGAAGCTTCTCCAGCTGCGCGGCGG
rJMSF021M08- CGNGGCCCATCACCAAATCCTTGCCGGTGATCGCCGGAAGCTTCTCCAGCTGCGCGGCGG
rJMSF035B22- CGTGGCCCATCACCAAATCCTTGCCGGTGATCGCCGGAAGCTTCTCCAGCTGCGCGGCGG
rJMSF020A06- CGNGGCCCATCACCAAATCCTTGCCGGTGATCGCCGGAAGCTTCTCCAGCTGCGCGGCGG
rJMFF015A11- CGNGGCCCATCACCAAATCCTTGCCGGNGATCGCCGGAAGCTTCTCCAGCTGCNCGGCGG
JMSF035B22+ CGTGGCCCATCACCAAATCCTTGCCGGTGATCGCCGGAAGCTTCTCCAGCTGCGCGGCGG
JMSF033E17+ CGTGGCCCATCACCAAATCCTTGCCGGTGATCGCCGGAAGCTTCTCCAGCTGCGCGGCGG
JMSF021M08+ CGTGGCCCATCACCAAATCCTTGCCGGTGATCGCCGGAAGCTTCTCCAGCTGCGCGGCGG
JMFF015A11+ CGTGGCCCATCACCAAATCCTTGCCGGTGATCGCCGGAAGCTTCTCCAGCTGCGCGGCGG
JMSF020A06+ CGTGGCCCATCACCAAATCCTTGCCGGTGATCGCCGGAAGCTTCTCCAGCTGCGCGGCGG
                      ____________________________________________________________
consensus CGTGGCCCATCACCAAATCCTTGCCGGTGATCGCCGGAAGCTTCTCCAGCTGCGCGGCGG
 
. : . : . : . : . : . :
rJMSF033E17- AGAGCCCCTTCTCTTTCGTCCCTTTCATCACCTCCTGGCCGCGCTCCGGGTCGGCGGCGC
rJMSF021M08- ANAGCCCCTTCTCTTTCGTCCCTTTCATCACCTCCNGGCCGCGCTCCGGGTCGGCGGCGC
rJMSF035B22- ANAGCCCCTTCTCTTTCGTCCCTTTCATCACCTCCTGGCCGCGCTCCGGGTCGGCGGCGC
rJMSF020A06- AGAGCCCCTTCTCTTTCGTCCCTTTCATCACCTCCTGGCCGCGCTCCGGGTCGGCGGCGC
rJMFF015A11- AAAGCCCCTTCTCTTTCGTCCCTTTCATCACCTCCTGGCCGCGCTCCGGGTCGGCGGCGC
JMSF035B22+ AGAGCCCCTTCTCTTTCGTCCCTTTCATCACCTCCTGGCCGCGCTCCGGGTCGGCGGCGC
JMSF033E17+ AGAGCCCCTTCTCTTTCGTCCCTTTCATCACCTCCTGGCCGCGCTCCGGGTCGGCGGCGC
JMSF021M08+ AGAGCCCCTTCTCTTTCGTCCCTTTCATCACCTCCTGGCCGCGCTCCGGGTCGGCGGCGC
JMFF015A11+ AGAGCCCCTTCTCTTTCGTCCCTTTCATCACCTCCTGGCCGCGCTCCGGGTCGGCGGCGC
JMSF020A06+ AGAGCCCCTTCTCTTTCGTCCCTTTCATCACCTCCTGGCCGCGCTCCGGGTCGGCGGCGC
JMSF006O06+ GCGC
                      ____________________________________________________________
consensus AGAGCCCCTTCTCTTTCGTCCCTTTCATCACCTCCTGGCCGCGCTCCGGGTCGGCGGCGC
 
. : . : . : . : . : . :
rJMSF033E17- CGCCGTTCTGGTAGGTGGCGGCGTACCAGAGCAAGCAGATGTACACCAGGAACACGGCGC
rJMSF021M08- CGCCGTTCTGGTAGGTGGCGGCGTACCAGAGCAAGCAGATGTACACCAGGAACACGGCGC
rJMSF035B22- CG
rJMSF020A06- CGCCGTTCTGGTAGGTGGCGGCGTACCAGAGCAAGCAGATGTACACCAGGAACACGGCGC
rJMFF015A11- CGCCGTTCTGGTAGGTGGCGGCGTACCAGAGCAAGCAGATGTACACCAGGAACACGGCGC
JMSF035B22+ CGCCGTTCTGGTAGGTGGCGGCGTACCAGAGCAAGCAGATGTACACCAGGAACACGGCGC
JMSF033E17+ CGCCGTTCTGGTAGGTGGCGGCGTACCAGAGCAAGCAGATGTACACCAGGAACACGGCGC
JMSF021M08+ CGCCGTTCTGGTAGGTGGCGGCGTACCAGAGCAAGCAGATGTACACCAGGAACACGGCGC
JMFF015A11+ CGCCGTTCTGGTAGGTGGCGGCGTACCAGAGCAAGCAGATGTACACCAGGAACACGGCGC
JMSF020A06+ CGCCGTTCTGGTAGGTGGCGGCGTACCAGAGCAAGCAGATGTACACCAGGAACACGGCGC
JMSF006O06+ CGCCGTTCTGGTAGGTGGCGGCGTACCAGAGCAAGCAGATGTACACCAGGAACACGGCGC
                      ____________________________________________________________
consensus CGCCGTTCTGGTAGGTGGCGGCGTACCAGAGCAAGCAGATGTACACCAGGAACACGGCGC
 
. : . : . : . : . : . :
rJMSF033E17- TCATGCCGGCGC
rJMSF021M08- TCATGCCGGCGC
rJMSF020A06- TCATGCCGGCGCAGGGG
rJMFF015A11- TCATGCCGGCGCAGGGGA
JMSF035B22+ TCATGCCGGCGCAGGGGAGAAACAGAGCCAAAAACACGGAGAGAAGCATTCTTAGTAGTA
JMSF033E17+ TCATGCCGGCGCAGGAGAGAAACAGAGCCAAAAACACGGAGAGAAGCATTCTTAGTAGTA
JMSF021M08+ TCATGCCGGCGCAGGGGAGAAACAGAGCCAAAAACACGGAGAGAAGCATTCTTAGTAGTA
JMFF015A11+ TCATGCCGGCGCAGGGGAGAAACAGAGCCAAAAACACGGAGAGAAGCATTCTTAGTAGTA
JMSF020A06+ TCATGCCGGCGCAGGGGAGAAACAGAGCCAAAAACACGGAGAGAAGCATTCTTAGTAGTA
JMSF006O06+ TCATGCCGGCGCAGGGGAGAAACAGAGCCAAAAACACGGAGAGAAGCATTCTTAGTAGTA
                      ____________________________________________________________
consensus TCATGCCGGCGCAGGGGAGAAACAGAGCCAAAAACACGGAGAGAAGCATTCTTAGTAGTA
 
. : . : . : . : . : . :
JMSF035B22+ GCTAAATATATGAATTCGAATG-AAAAATTTTAGAAAACTGGGAATGTGGGTTTTTCAAG
JMSF033E17+ GCTAAATATATGAATTCGAATG-AAAAATTTTAGAAAACTGGGAATGTGGGTTTTTCAAG
JMSF021M08+ GCTAAATATATGAATTCGAATG-AAAAATTTTAGAAAACTGGGAATGTGGGTTTTTCAAG
JMFF015A11+ GCTAAATATATGAATTCGAATG-AAAAATTTTAGAAAACTGGGAATGTGGGTTTTTCAAG
JMSF020A06+ GCTAAATATATGAATTCGAATG-AAAAATTTTAGAAAACTGGGAATGTGGGTTTTTCAAG
JMSF006O06+ GCTAAATATATGAATTCGAATGAAAAAATTTTAGAAAACTGGGAATGTGGGTTTTTCAAG
                      ____________________________________________________________
consensus GCTAAATATATGAATTCGAATG-AAAAATTTTAGAAAACTGGGAATGTGGGTTTTTCAAG
 
. : . : . : . : . : . :
JMSF035B22+ GCGATTCAGGGAAGCATGAGAGAAGAATTAATTAAATGTTATTTGAAAATGGAGGGCGGC
JMSF033E17+ GCGATTCAGGGAAGCATGAGAGAAGAATTAATTAAATGTTATTTGAAAATGGAGGGCGGC
JMSF021M08+ GCGATTCAGGGAAGCATGAGAGAAGAATTAATTAAATGTTATTTGAAAATGGAGGGCGGC
JMFF015A11+ GCGATTCAGGGAAGCATGAGAGAAGAATTAATTAAATGTTATTTGAAAATGGAGGGCGGC
JMSF020A06+ GCGATTCAGGGAAGCATGAGAGAAGAATTAATTAAATGTTATTTGAAAATGGAGGGCGGC
JMSF006O06+ GCGATTCAGGGAAGCATGAGAGAAGAATTAATTAAATGTTATTTGAAAATGGAGGGCGGC
                      ____________________________________________________________
consensus GCGATTCAGGGAAGCATGAGAGAAGAATTAATTAAATGTTATTTGAAAATGGAGGGCGGC
 
. : . : . : . : . : . :
JMSF035B22+ GATGGTGGCGGCGGAGAGAGAATATTTGAGTGGAGTGCAAAGCACACCAATTTCACGG
JMSF033E17+ GATGGTGGCGGCGGAGAGAGAATATTTGAGTGGAGTGCAAAGCACACCAATTTCACGGTC
JMSF021M08+ GATGGTGGCGGCGGAGAGAGAATATTTGAGTGGAGTGCAAAGCACACCAATTTCACGGTC
JMFF015A11+ GATGGTGGCGGCGGAGAGAGAATATTTGAGTGGAGTGCAAAGCACACCAATTTCACGGT
JMSF020A06+ GATGGTGGCGGCGGAGAGAGAATATTTGAGTGGAGTGCAAAGCACACCAATTTCACGGTC
JMSF006O06+ GATGGTGGCGGCGGAGAGAGAATATTTGAGTGGAGTGCAAAGCACACCAATTTCACGGTC
                      ____________________________________________________________
consensus GATGGTGGCGGCGGAGAGAGAATATTTGAGTGGAGTGCAAAGCACACCAATTTCACGGTC