Previous Contig 004833:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF006M16Sequence242004833 (2)
JMSF006N16Sequence242004833 (2)249014022 (7)gb:AP003935_18354958e-11Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P066

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF006N16+ AA
JMSF006M16+ AA
                      ____________________________________________________________
consensus AA
 
. : . : . : . : . : . :
JMSF006N16+ TGACAACTAACTAAAACCCCAGCAATGGATCGTGTCTGTCCCGGTGTGCCGGGATAGGCT
JMSF006M16+ TGACAACTAACTAAAACCCCAGCAATGGATCGTGTCTGTCCCGGTGTGCCGGGATAGGCT
                      ____________________________________________________________
consensus TGACAACTAACTAAAACCCCAGCAATGGATCGTGTCTGTCCCGGTGTGCCGGGATAGGCT
 
. : . : . : . : . : . :
JMSF006N16+ GCGAGGGAGAGGAGACCGGTTCCCGACGACGTCTTGTAGAGTCGTAGTGAGGTAGCGAGC
JMSF006M16+ GCGAGGGAGAGGAGACCGGTTCCCGACGACGTCTTGTAGAGTCGTAGTGAGGTAGCGAGC
                      ____________________________________________________________
consensus GCGAGGGAGAGGAGACCGGTTCCCGACGACGTCTTGTAGAGTCGTAGTGAGGTAGCGAGC
 
. : . : . : . : . : . :
JMSF006N16+ TACTGAGGATGTGAGGTGTGAGCTGCGAACCTGTGACTCTGAGGCGAATGGCGATGAATA
JMSF006M16+ TACTGAGGATGTGAGGTGTGAGCTGCGAACCTGTGACTCTGAGGCGAATGGCGATGAATA
                      ____________________________________________________________
consensus TACTGAGGATGTGAGGTGTGAGCTGCGAACCTGTGACTCTGAGGCGAATGGCGATGAATA
 
. : . : . : . : . : . :
JMSF006N16+ TCAGTCTTTCTTCATTCTCCTTTGATCAGACAATAGGGAATGAATAGGAGGGAATTTAGC
JMSF006M16+ TCAGTCTTTCTTCATTCTCCTTTGATCAGACAATAGGGAATGAATAGGAGGGAATTTAGC
                      ____________________________________________________________
consensus TCAGTCTTTCTTCATTCTCCTTTGATCAGACAATAGGGAATGAATAGGAGGGAATTTAGC