Previous Contig 004829:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFN003A15Sequence554004829 (2)gb:AY084706_15697926e-43Arabidopsis thaliana clone 1156 mRNA, complete sequence.
JMSF006M01Sequence392004829 (2)gb:AP003488_18299004e-19Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P043374004838 (18)gb:AF388948_17950742e-14Elaeis oleifera calmodulin mRNA, partial cds.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFN003A15+ GAGAATACCCATAGAAAGGAACAGCTTGGTGA
                      ____________________________________________________________
consensus GAGAATACCCATAGAAAGGAACAGCTTGGTGA
 
. : . : . : . : . : . :
JMFN003A15+ TTCGGGTGGCGCCGGTGATGGAACGGGGAAGCAGCCACCGCCTGCGGCGGCGCTCCTGTT
                      ____________________________________________________________
consensus TTCGGGTGGCGCCGGTGATGGAACGGGGAAGCAGCCACCGCCTGCGGCGGCGCTCCTGTT
 
. : . : . : . : . : . :
JMFN003A15+ GGATAGTACCATTGTACGTAATTTGGGGGTGGCGTCGAGGTAGCTCTTGCTCCAATGTTG
                      ____________________________________________________________
consensus GGATAGTACCATTGTACGTAATTTGGGGGTGGCGTCGAGGTAGCTCTTGCTCCAATGTTG
 
. : . : . : . : . : . :
JMFN003A15+ TGCCCTTGTGGAGGCGGGGAGGTAGTGGTGGTGGGAGGTGGTTTGGGGCGGCGGGCGCCG
                      ____________________________________________________________
consensus TGCCCTTGTGGAGGCGGGGAGGTAGTGGTGGTGGGAGGTGGTTTGGGGCGGCGGGCGCCG
 
. : . : . : . : . : . :
JMFN003A15+ AGAGAAGACAGGTTGCAGTTGGCACGGCGGCCGTTGATGACCGGCGACGGATCGCCGCAA
                      ____________________________________________________________
consensus AGAGAAGACAGGTTGCAGTTGGCACGGCGGCCGTTGATGACCGGCGACGGATCGCCGCAA
 
. : . : . : . : . : . :
JMFN003A15+ GCTTTCCGGGCGGACTCGGCATCCTTAAAAGTGACAAAACCATAGCCCTTGGATCTGCCG
JMSF006M01+ AAGTAACAAAACCATAGCCTTNGGATCTGCCG
                      ____________________________________________________________
consensus GCTTTCCGGGCGGACTCGGCATCCTTAAAAGTGACAAAACCATAGCCTTTGGATCTGCCG
 
. : . : . : . : . : . :
JMFN003A15+ GTGAGCTTGTCGGAGATGATTACGGCCTCCAAGATCTCGCCGTACTTGTCGAAGTGCTCT
JMSF006M01+ GTGAGCTTGTTGGAGATGATGACAGCCTCCAAAATCTCACCAAACTTCTCAAAGTGCTCT
                      ____________________________________________________________
consensus GTGAGCTTGTTGGAGATGATTACGGCCTCCAAGATCTCGCCGTACTTGTCGAAGTGCTCT
 
. : . : . : . : . : . :
JMFN003A15+ CTCATGGTCTCCAATGGCGTCTCCCATGCCAGCCCTCCGACAAACACCTTCGTCAACGTT
JMSF006M01+ CTCATGGCCTCCTTCGGCGTCTCCCACGCCAACCCTCCGACGAACACCTTCGTCAACGTG
                      ____________________________________________________________
consensus CTCATGGTCTCCTTTGGCGTCTCCCATGCCAGCCCTCCGACGAACACCTTCGTCAACGTT
 
. : . : . : . : . : . :
JMFN003A15+ GTGTC
JMSF006M01+ GTGTCACCCAAGTTATTCTGCCCGGCGACGACGCTGCTGTTAAGGTTGCTCATTGTCATC
                      ____________________________________________________________
consensus GTGTCACCCAAGTTATTCTGCCCGGCGACGACGCTGCTGTTAAGGTTGCTCATTGTCATC
 
. : . : . : . : . : . :
JMSF006M01+ TCCGAACCCAATCCACCACAATCTCCCTATATATATAACCTCGCACTCTGCAAACCTTAA
                      ____________________________________________________________
consensus TCCGAACCCAATCCACCACAATCTCCCTATATATATAACCTCGCACTCTGCAAACCTTAA
 
. : . : . : . : . : . :
JMSF006M01+ TTAGAATAGAATAGAAGAGAGAGAGAAAGAGAGTCAACAAGGGGTTTGAGAAGAAATGGC
                      ____________________________________________________________
consensus TTAGAATAGAATAGAAGAGAGAGAGAAAGAGAGTCAACAAGGGGTTTGAGAAGAAATGGC
 
. : . : . : . : . : . :
JMSF006M01+ GAGAGATTACATATATAAACAGGCCAGGGAGATGGAAGTAGTGGGGAGGGAGGTAGTGTC
                      ____________________________________________________________
consensus GAGAGATTACATATATAAACAGGCCAGGGAGATGGAAGTAGTGGGGAGGGAGGTAGTGTC