Previous Contig 004828:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF031M22Sequence615004828 (8)gb:AB022216_15150355e-37Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MGD8.>gb:AY064673_1566570004828 (8)gb:AB022216_15150354e-37Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MGD8.>gb:AY064673_1566
JMFN011C01Sequence577004828 (8)gb:AB022216_15150354e-37Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MGD8.>gb:AY064673_1566
JMFN037N17Sequence570004828 (8)gb:AB022216_15150354e-37Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MGD8.>gb:AY064673_1566
JMFN039O06Sequence577004828 (8)gb:AB022216_15150354e-37Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MGD8.>gb:AY064673_1566
JMFN042D18Sequence297004828 (8)gb:AY086696_15717401e-27Arabidopsis thaliana clone 268652 mRNA, complete sequence.
JMSF006L24Sequence360004828 (8)gb:AB022216_15150357e-31Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MGD8.>gb:AY064673_1566367004828 (8)gb:AP003562_18308165e-18Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC clone:B110

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF031M22+ TTTTTTTTTTGCCGGTTG
                      ____________________________________________________________
consensus TTTTTTTTTTGCCGGTTG
 
. : . : . : . : . : . :
JMFN039O06+ GGACAAATAAAGCCCATCAAATTATTAAAAGAGTAATAGAGCCAGAATCCAT
JMFN011C01+ GGACAAATAAAGCCCATCAAATTATTAAAAGAGTAATAGAGCCAGAATCCAT
rJMFF031M22- AATTATTAAAAGAGTAATAGAGCCAGAATCCAT
JMFN037N17+ GACAAATAAAGCCCATCAAATTATTAAAAGAGTAATAGAGCCAGAATCCAT
rJMSF006L24- GGACAAATAAAGCCCATCAAATTATTAAAAGAGTAATAGAGCCAGAATCCAT
JMFF031M22+ AATAACTAGGACAAATAAAGCCCATCAAATTATTAAAAGAGTAATAGAGCCAGAATCCAT
                      ____________________________________________________________
consensus AATAACTAGGACAAATAAAGCCCATCAAATTATTAAAAGAGTAATAGAGCCAGAATCCAT
 
. : . : . : . : . : . :
JMFN039O06+ ACAGATATTACACTAATGCAAAACACAG-TCACCATTGAACTCAAAACAAAAGTGTTTCA
JMFN011C01+ ACAGATATTACACTAATGCAAAACACAG-TCACCATTGAACTCAAAACAAAAGTGTTTCA
rJMFF031M22- ACAGATATTACACTAATGCAAAACACAG-TCACCATTGAACTCAAAACAAAAGTGTTTCA
JMFN037N17+ ACAGATATTACACTAATGCAAAACACAG-TCACCATTGAACTCAAAACAAAAGTGTTTCA
rJMSF006L24- ACAGATATTACACTAATGCAAAACACAGCTCACCATTGAACTCNAAACAAAAGTGTTTCA
JMFF031M22+ ACAGATATTACACTAATGCAAAACACAG-TCACCATTGAACTCAAAACAAAAGTGTTTCA
                      ____________________________________________________________
consensus ACAGATATTACACTAATGCAAAACACAG-TCACCATTGAACTCAAAACAAAAGTGTTTCA
 
. : . : . : . : . : . :
JMFN039O06+ AGAATTCCAAGCTTCATAGCTGATGAGAGCAAGCAAACCTCATATTCTCTTTCTGCAAAT
JMFN011C01+ AGAATTCCAAGCTTCATAGCTGATGAGAGCAAGCAAACCTCATATTCTCTTTCTGCAAAT
rJMFF031M22- AGAATTCCAAGCTTCATAGCTGATGAGAGCAAGCAAACCTCATATTCTCTTTCTGCAAAT
JMFN037N17+ AGAATTCCAAGCTTCATAGCTGATGAGAGCAAGCAAACCTCATATTCTCTTTCTGCAAAT
rJMSF006L24- AGAATTCCAAGCTTCATAGCTGATGAGAGCAAGCAAACCTCATATTCTCTTTCTGCAAAT
JMFF031M22+ AGAATTCCAAGCTTCATAGCTGATGAGAGCAAGCAAACCTCATATTCTCTTTCTGCAAAT
                      ____________________________________________________________
consensus AGAATTCCAAGCTTCATAGCTGATGAGAGCAAGCAAACCTCATATTCTCTTTCTGCAAAT
 
. : . : . : . : . : . :
JMFN039O06+ TACTCAACTCAGAGCTGGACTGGTGCAGGCTTGTAGTCAATGATGAGAACTTTCTCCAAT
JMFN011C01+ TACTCAACTCAGAGCTGGACTGGTGCAGGCTTGTAGTCAATGATGAGAACTTTCTCCAAT
rJMFF031M22- TACTCAACTCAGAGCTGGACTGGTGCAGGCTTGTAGTCAATGATGAGAACTTTCTCCAAT
JMFN037N17+ TACTCACTTCAGAGCTGGACTGGTGCAGGCTTGTAGTCAATGATGAGAACTTTCTCCAAT
rJMSF006L24- TACTCAACTCAGAGCTGGACTGGTGCAGGCTTGTAGTCAATGATGAGAATTTTCTCCAAT
JMFF031M22+ TACTCAACTCAGAGCTGGACTGGTGCAGGCTTGTAGTCAATGATGAGAACTTTCTCCAAT
                      ____________________________________________________________
consensus TACTCAACTCAGAGCTGGACTGGTGCAGGCTTGTAGTCAATGATGAGAACTTTCTCCAAT
 
. : . : . : . : . : . :
JMFN039O06+ TGCGGAAGGAGTTTGTTCGCGTACTCAACATGATCGGGGTGAGCAATGTACTCAGCAACA
JMFN011C01+ TGCGGAAGGAGTTTGTTCGCGTACTCAACATGATCGGGGTGAGCAATGTACTCAGCAACA
rJMFF031M22- TGCGGAAGGAGTTTGTTCGCGTACTCAACATGATCGGGGTGAGCAATGTACTCAGCAACA
JMFN037N17+ TGCGGAAGGAGTTTGTTCGCGTACTCAACATGATCGGGGTGAGCAATGTACTCAGCAACA
rJMSF006L24- TGCGGAAGGAGTTTGTTCGCGTACTCAACATGATCGGGGTGAGCAATGTACTCAGCANCA
JMFN042D18+ TCGGGGTGAGCAAGGTAGTCAGCAACA
JMFF031M22+ TGCGGAAGGAGTTTGTTCGCGTACTCAACATGATCGGGGTGAGCAATGTACTCAGCAACA
JMSF006L24+ TGCGGAAGGAGTTTGTTCGCGTACTCAACATGATCGGGGTGAGCAATGTACTCAGCAACA
                      ____________________________________________________________
consensus TGCGGAAGGAGTTTGTTCGCGTACTCAACATGATCGGGGTGAGCAATGTACTCAGCAACA
 
. : . : . : . : . : . :
JMFN039O06+ CCTTCACAGCTCTCGAAACTCGATTCAAACACATGAGTGAAGCCTTGGTGAAGGTTCTCT
JMFN011C01+ CCTTCACAGCTCTCGAAACTCGATTCAAACACATGAGTGAAGCCTTGGTGAAGGTTCTCT
rJMFF031M22- CCTTCACAGCTCTCGAAACTCGATTCAAACACATGAGTGAAGCCTTGGTGAAGGTTCTCT
JMFN037N17+ CCTTCACAGCTCTCGAAACTCGATTCAAACACATGAGTGAAGCCTTGGTGAAGGTTCTCT
rJMSF006L24- CCTTCACAGCTCTCGAAACTCGATTCAAACACATGAGTGAAGCCTTGGTGAAGGTTCTCT
JMFN042D18+ CCTTCACAGCTCTCGAAACTCGATTCAAACACATGAGTGAAGCCTTGGTGAAGGTTCTCT
JMFF031M22+ CCTTCACAGCTCTCGAAACTCGATTCAAACACATGAGTGAAGCCTTGGTGAAGGTTCTCT
JMSF006L24+ CCTTCACAGCTCTCGAAACTCGATTCAAACACATGAGTGAAGCCTTGGTGAAGGTTCTCT
                      ____________________________________________________________
consensus CCTTCACAGCTCTCGAAACTCGATTCAAACACATGAGTGAAGCCTTGGTGAAGGTTCTCT
 
. : . : . : . : . : . :
JMFN039O06+ ATGCTTACATCTTTACCCCAGCGGAAAGACTTCATGGGTTGGATGAGATTGACGAGATTA
JMFN011C01+ ATGCTTACATCTTTACCCCAGCGGAAAGACTTCATGGGTTGGATGAGATTGACGAGATTA
rJMFF031M22- ATGCTTACATCTTTACCCCAGCGGAAAGACTTCATGGGTTGGATGAGATTGACGAGATTA
JMFN037N17+ ATGCTTACATCTTTACCCCAGCGGAAAGACTTCATGGGTTGGATGAGATTGACGAGATTA
rJMSF006L24- ATGCTTACNTCTTTA
JMFN042D18+ ATGCTTACATCTTTACCCCAGCGGAAAGACTTCATGGGTTGGATGAGATTGACGAGATTA
JMFF031M22+ ATGCTTACATCTTTACCCCAGCGGAAAGACTTCATGGGTTGGATGAGATTGACGAGATTA
JMSF006L24+ ATGCTTACATCTTTACCCCAGCGGAAAGACTTCATGGGTTGGATGAGATTGACGAGATTA
                      ____________________________________________________________
consensus ATGCTTACATCTTTACCCCAGCGGAAAGACTTCATGGGTTGGATGAGATTGACGAGATTA
 
. : . : . : . : . : . :
JMFN039O06+ GCGTATTGTTTGATAAGCTGATCGATCTCTTCTTGGGGGATCCCATCTTTGAACTTGCCC
JMFN011C01+ GCGTATTGTTTGATAAGCTGATCGATCTCTTCTTGGGGGATCCCATCTTTGAACTTGCCC
rJMFF031M22- GCGTATTGTTTGATAAGCTGATCGATCTCTTCTTGGGGGATCCCATCTTTGAACTTGCCC
JMFN037N17+ GCGTATTGTTTGATAAGCTGATCGATCTCTTCTTGGGGGATCCCATCTTTGAACTTGCCC
JMFN042D18+ GCGTATGGTTTGATAAGCTGATCGATCTCTTCTTGGGGGATCCCATCTTTGAACTTGCCC
JMFF031M22+ GCGTATTGTTTGATAAGCTGATCGATCTCTTCTTGGGGGATCCCATCTTTGAACTTGCCC
JMSF006L24+ GCGTATTGTTTGATAAGCTGATCGATCTCTTCTTGGGGGATCCCATCTTTGAACTTGCCC
                      ____________________________________________________________
consensus GCGTATTGTTTGATAAGCTGATCGATCTCTTCTTGGGGGATCCCATCTTTGAACTTGCCC
 
. : . : . : . : . : . :
JMFN039O06+ AGCACAATGTGCTTCACTTCTCCTCCTTTAGATGCCTCACCGTCCGCCATTAAACTTCCC
JMFN011C01+ AGCACAATGTGCTTCACTTCTCCTCCTTTAGATGCCTCACCGTCAGCCATTAAACTTCCC
rJMFF031M22- AGCACAATGTGCTTCACTTCTCCTCCTTTAGATGCCTCACCGTCCGCCATTAAACTTCCC
JMFN037N17+ AGCACAATGTGCTTCACTTCTCCTCCTTTAGATGCCTCACCGTCCGCCATTAAACTTCCC
JMFN042D18+ AGCACAATGTGCTTCACTTCTCCTCCTTTAGATGCCTCACCGTCCGCCATTAAACTTCCC
JMFF031M22+ AGCACAATGTGCTTCACTTCTCCTCCTTTAGATGCCTCACCGTCCGCCATTAAACTTCCC
JMSF006L24+ AGCACAATGTGCTTCACTTCTCCTCCTTTAGATGCCTCACCGTCCGCCATTAAACTTCCC
                      ____________________________________________________________
consensus AGCACAATGTGCTTCACTTCTCCTCCTTTAGATGCCTCACCGTCCGCCATTAAACTTCCC
 
. : . : . : . : . : . :
JMFN039O06+ TTTCCCTCTTCTCACCGCAACAAGACTTTGGTGGATCGGA
JMFN011C01+ TTTCCCTCTTCTCACCGCAACAAGACTTTGGTGGATCGGAGTC
rJMFF031M22- TTTCCCTCTTCTCACCGCAACAAGACTTTGGTGGATCGGAGTCTATCAAGTGT
JMFN037N17+ TTTCCCTCTTCTCACCGCAACAAGACTTTGGTGGATCGGA
JMFN042D18+ TTTCCCTCTTCTCACCGCAACAAGACTTTG
JMFF031M22+ TTTCCCTCTTCTCACCGCAACAAGACTTTGGTGGATCGGAGTCTATCAAGTGT
JMSF006L24+ TTTCCCTCTTCTCACCGCAACAAGACTTTGGTGGATCGGAGTCTATCAAGTGTCAACTCA
                      ____________________________________________________________
consensus TTTCCCTCTTCTCACCGCAACAAGACTTTGGTGGATCGGAGTCTATCAAGTGTCAACTCA