Previous Contig 004823:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF004D15Sequence468004823 (15)gb:AY485789_11784122e-66Capsicum annuum 60S ribosomal protein L19 mRNA, complete cds.581004823 (15)gb:AY485789_11784124e-62Capsicum annuum 60S ribosomal protein L19 mRNA, complete cds.
JMFF006P01Sequence481004823 (15)gb:AY485789_11784125e-68Capsicum annuum 60S ribosomal protein L19 mRNA, complete cds.775004823 (15)gb:AY485789_11784123e-87Capsicum annuum 60S ribosomal protein L19 mRNA, complete cds.
JMFF016A22Sequence515004823 (15)gb:AY485789_11784127e-75Capsicum annuum 60S ribosomal protein L19 mRNA, complete cds.771004823 (15)gb:AY485789_11784123e-85Capsicum annuum 60S ribosomal protein L19 mRNA, complete cds.
JMFF051G06Sequence502004823 (15)gb:AY485789_11784121e-71Capsicum annuum 60S ribosomal protein L19 mRNA, complete cds.538021934sp|P49693|R19C_ARATH3e-4160S ribosomal protein L19-3.>pir|E85028|E85028 probable ribosomal protein L19 [i
JMSF006K17Sequence410004823 (15)gb:AY485789_11784125e-55Capsicum annuum 60S ribosomal protein L19 mRNA, complete cds.
JMSF006K19Sequence385007288 (10)gb:AF410311_17971256e-31Arabidopsis thaliana AT3g18860/MCB22_3 mRNA, complete cds.>gb:AP002039_1821566 A286004823 (15)gb:AY389581_11782192e-16Hyacinthus orientalis ribosomal protein L19 (RPL19) mRNA, complete cds.
JMSF016F15Sequence508004823 (15)gb:AY485789_11784127e-71Capsicum annuum 60S ribosomal protein L19 mRNA, complete cds.757004823 (15)gb:AY485789_11784123e-87Capsicum annuum 60S ribosomal protein L19 mRNA, complete cds.
JMSF024B15Sequence642004823 (15)gb:AY485789_11784122e-87Capsicum annuum 60S ribosomal protein L19 mRNA, complete cds.779004823 (15)gb:AY485789_11784123e-87Capsicum annuum 60S ribosomal protein L19 mRNA, complete cds.
JMSF025P02Sequence585004823 (15)gb:AY485789_11784125e-86Capsicum annuum 60S ribosomal protein L19 mRNA, complete cds.748004823 (15)gb:AY485789_11784121e-86Capsicum annuum 60S ribosomal protein L19 mRNA, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF006P01- AACTCATATTGTCATAT
rJMSF024B15- AATCCTTAACTCATATTGTCATAT
                      ____________________________________________________________
consensus AATCCTTAACTCATATTGTCATAT
 
. : . : . : . : . : . :
rJMFF004D15- ACACCAAAAACTGT--GAAGTAAAAAATACTGCC
rJMFF006P01- AGGTTACATTGTCTCATCAAAACAAAACACCAAAAACTGT--GAAGTAAAAAATACTGCC
rJMSF024B15- AGGTTACATTGTCTCATCAAAACAAAACACCAAAAACTGT--GAAGTAAAAAATACTGCC
rJMSF025P02- GTCTCATCAAAACAAAACACCAAAAACTGGTGGAAGTAAAAAATACTGCC
rJMSF016F15- AAAACAAAACACCAAAAACTGGT-GAAGTAAAAAATACTGCC
                      ____________________________________________________________
consensus AGGTTACATTGTCTCATCAAAACAAAACACCAAAAACTGT--GAAGTAAAAAATACTGCC
 
. : . : . : . : . : . :
rJMFF004D15- ATTCTAAAGACATAAAACTGGGAAAGATTCACCAAGTCCTTGGAATCAAAGACCAGGGCT
rJMFF006P01- ATTCTAAAGACATAAAACTGGGAAAGATTCACCAAGTCCTTGGAATCAAAGACCAGGGCT
rJMSF024B15- ATTCTAAAGACATAAAACTGGGAAAGATTCACCAAGTCCTTGGAATCAAAGACCAGGGCT
rJMSF025P02- ATTCTAAAGACATAAAACTGGGAAAGATTCACCAAGTCCTTGGAATCAAAGACCAGGGCT
rJMSF016F15- ATTCTAAAGACATAAAACTGGGAAAGATTCACCAAGTCCTTGGAATCAAAGACCAGGGCT
                      ____________________________________________________________
consensus ATTCTAAAGACATAAAACTGGGAAAGATTCACCAAGTCCTTGGAATCAAAGACCAGGGCT
 
. : . : . : . : . : . :
rJMFF004D15- TCACTTCTTAGACTTCTTAGATCCCTGTGCTGGCTGAGTTTGAGGCACTGGTGCTGGAGC
rJMFF006P01- TCACTTCTTAGACTTCTTAGATCCCTGTGCTGGCTGAGTTTGAGGCACTGGTGCTGGAGC
rJMSF024B15- TCACTTCTTAGACTTCTTAGATCCCTGTGCTGGCTGAGTTTGAGGCACTGGTGCTGGAGC
rJMSF025P02- TCACTTCTTAGACTTCTTAGATCCCTGTGCTGGCTGAGTTTGAGGCACTGGTGCTGGAGC
rJMSF016F15- TCACTTCTTAGACTTCTTAGATCCCTGTGCTGGCTGAGTTTGAGGCACTGGTGCTGGAGC
rJMFF016A22- GC
rJMSF006K19- CCTGTGCTGGCTGAGTTTGAGGCACTGGTGCTGGAGC
JMSF024B15+ CTTAGATCCCTGTGCTGGCTGAGTTTGAGGCACTGGTGCTGGAGC
                      ____________________________________________________________
consensus TCACTTCTTAGACTTCTTAGATCCCTGTGCTGGCTGAGTTTGAGGCACTGGTGCTGGAGC
 
. : . : . : . : . : . :
rJMFF004D15- TTCCCTCTCTGCTGGGCCCTTAGCCAAACGTTCCTCTCGCCTAGCAAACTTTCTTTCTCT
rJMFF006P01- TTCCCTCTCTGCTGGGCCCTTAGCCAAACGTTCCTCTCGCCTAGCAAACTTTCTTTCTCT
rJMSF024B15- TTCCCTCTCTGCTGGGCCCTTAGCCAAACGTTCCTCTCGCCTAGCAAACTTTCTTTCTCT
rJMSF025P02- TTCCCTCTCTGCTGGGCTCTTAGCCAAACGTTCCTCTCGCCTAGCAAACTTTCTTTCTCT
rJMSF016F15- TTCCCTCTCTGCTGGGCCCTTAGCCAAACGTTCCTCTCGCCTAGCAAACTTTCTTTCTCT
rJMFF016A22- TTCCCTCTCTGCTGGGCCCTTAGCCAAACGTTCCTCTCGCCTAGCAAACTTTCTTTCTCT
rJMSF006K19- TTCCCTCTCTGCTGGGCCCTTATCCNANCGTTCCTCTCGCCTAGCAAANTNTCTTTCTCN
JMSF024B15+ TTCCCTCTCTGCTGGGCCCTTAGCCAAACGTTCCTCTCGCCTAGCAAACTTTCTTTCTCT
JMSF025P02+ CTTAGCCAAACGTTCCTCTCGCCTAGCAAACTTTCTTTCTCT
                      ____________________________________________________________
consensus TTCCCTCTCTGCTGGGCCCTTAGCCAAACGTTCCTCTCGCCTAGCAAACTTTCTTTCTCT
 
. : . : . : . : . : . :
rJMFF004D15- GCTTGCCTTGTTCTTGGCCCTCTTAGCCTCAAACTGGTCAGACAAGGTCTTTTCTCTGGC
rJMFF006P01- GCTTGCCTTGTTCTTGGCCCTCTTAGCCTCAAACTGGTCAGACAAGGTCTTTTCTCTGGC
rJMSF024B15- GCTTGCCTTGTTCTTGGCCCTCTTAGCCTCAAACTGGTCAGACAAGGTCTTTTCTCTGGC
rJMSF025P02- GCTTGCCTTGTTCTTGGCCCTCTTAGCCTCAAACTGGTCAGACAAGGTCTTTTCTCTGGC
rJMSF016F15- GCTTGCCTTGTTCTTGGCCCTCTTAGCCTCAAACTGGTCAGACAAGGTCTTTTCTCTGGC
rJMFF016A22- GCTTGCCTTGTTCTTGGCCCTCTTAGCCTCAAACTGGTCAGACAAGGTCTTTTCTCTGGC
JMSF016F15+ TCAAANTGGTCAGACAAGGTNTTTTNTNTGGC
JMFF016A22+ CTTAGCCTCAAACTGGTCAGACAAGGTCTTTTCTCTGGC
rJMSF006K19- GCTTGCCGTGNTCTTGGCCCTCTTAGCCTCAAACTGGTCAGACAAGGTCTTTTCTCTGGN
JMSF024B15+ GCTTGCCTTGTTCTTGGCCCTCTTAGCCTCAAACTGGTCAGACAAGGTCTTTTCTCTGGC
JMFF051G06+ TCAGACAAGGTCTTTTCTCTGGC
JMFF006P01+ GC
JMSF025P02+ GCTTGCCTTGTTCTTGGCCCTCTTAGCCTCAAACTGGTCAGACAAGGTCTTTTCTCTGGC
                      ____________________________________________________________
consensus GCTTGCCTTGTTCTTGGCCCTCTTAGCCTCAAACTGGTCAGACAAGGTCTTTTCTCTGGC
 
. : . : . : . : . : . :
rJMFF004D15- CTTTTCAGCCTTCGACTTGTGAATGCTCTCCATCAGGACACGTTTGTTCTTGAAAACATT
rJMFF006P01- CTTTTCAGCCTTCGACTTGTGAATGCTCTCCATCAGGACACGTTTGTTCTTGAAAACATT
rJMSF024B15- CTTTTCAGCCTTCGACTTGTGAATGCTCTCCATCAGGACACGTTTGTTCTTGAAAACATT
rJMSF025P02- CTTTTCAGCCTTCGACTTGTGAATGCTCTCCATCAGGACACGTTTGTTCTTGAAAACATT
rJMSF016F15- CTTTTCAGCCTTCGACTTGTGAATGCTCTCCATCAGGACACGTTTGTTCTTGAAAACATT
rJMFF016A22- CTTTTCAGCCTTCGACTTGTGAATGCTCTCCATCAGGACACGTTTGTTCTTGAAAACATT
JMSF016F15+ CTTTTCAGCCTTCGACTTGTGAATGCTCTCCATCAGGACACGTTTGTTCTTGAAAACATT
JMFF016A22+ CTTTTCAGCCTTCGACTTGTGAATGCTCTCCATCAGGACACGTTTGTTCTTGAAAACATT
rJMSF006K19- CTTTTCAGCCTTCGACTTGTGAATGCTCTCCATCANGACANGTTTGTTCTTGAAAACATN
JMSF024B15+ CTTTTCAGCCTTCGACTTGTGAATGCTCTCCATCAGGACACGTTTGTTCTTGAAAACATT
JMFF051G06+ CTTTTCAGCCTTCGACTTGTGAATGCTCTCCATCAGGACACGTTTGTTCTTGAAAACATT
JMFF004D15+ CCTTCGACTTGTGAATGCTCTCCATCAGGACACGTTTGTTCTTGAAAACATT
JMFF006P01+ CTTTTCAGCCTTCGACTTGTGAATGCTCTCCATCAGGACACGTTTGTTCTTGAAAACATT
JMSF025P02+ CTTTTCAGCCTTCGACTTGTGAATGCTCTCCATCAGGACACGTTTGTTCTTGAAAACATT
                      ____________________________________________________________
consensus CTTTTCAGCCTTCGACTTGTGAATGCTCTCCATCAGGACACGTTTGTTCTTGAAAACATT
 
. : . : . : . : . : . :
rJMFF004D15- ACCCTTAACCTTCATGTACATGTCATGATACATGTGTTTGTCAATCTTCTTAGACTCCCG
rJMFF006P01- ACCCTTAACCTTCATGTACATGTCATGATACATGTGTTTGTCAATCTTCTTAGACTCCCG
rJMSF024B15- ACCCTTAACCTTCATGTACATGTCATGATACATGTGTTTGTCAATCTTCTTAGACTCCCG
rJMSF025P02- ACCCTTAACCTTCATGTACATGTCATGATACATGTGTTTGTCAATCTTCTTAGACTCCCG
rJMSF016F15- ACCCTTAACCTTCATGTACATGTCATGATACATGTGTTTGTCAATCTTCTTAGACTCCCG
rJMFF016A22- ACCCTTAACCTTCATGTACATGTCATGATACATGTGTTTGTCAATCTTCTTAGACTCCCG
JMSF016F15+ ACCCTTAACCTTCATGTACATGTCATGATACATGTGTTTGTCAATCTTCTTAGACTCCCG
JMFF016A22+ ACCCTTAACCTTCATGTACATGTCATGATACATGTGTTTGTCAATCTTCTTAGACTCCCG
rJMSF006K19- ACCCTTAACCTTCATGTACATGTCATGATACATGTGTTTGTCNATCNTCTTAGACTCCCN
JMSF024B15+ ACCCTTAACCTTCATGTACATGTCATGATACATGTGTTTGTCAATCTTCTTAGACTCCCG
JMFF051G06+ ACCCTTAACCTTCATGTACATGTCATGATACATGTGTTTGTCAATCTTCTTAGACTCCCG
JMFF004D15+ ACCCTTAACCTTCATGTACATGTCATGATACATGTGTTTGTCAATCTTCTTAGACTCCCG
JMFF006P01+ ACCCTTAACCTTCATGTACATGTCATGATACATGTGTTTGTCAATCTTCTTAGACTCCCG
JMSF025P02+ ACCCTTAACCTTCATGTACATGTCATGATACATGTGTTTGTCAATCTTCTTAGACTCCCG
JMSF006K17+ TTCATGTACATGTCATGATACATGTGTTTGTCAATCTTCTTAGACTCCCG
                      ____________________________________________________________
consensus ACCCTTAACCTTCATGTACATGTCATGATACATGTGTTTGTCAATCTTCTTAGACTCCCG
 
. : . : . : . : . : . :
rJMFF004D15- GTACTTGCGAAGTAAGCGCCTCAGAACTCTCATTCTCCTCATCCATAGCACTTTAGTGGG
rJMFF006P01- GTACTTGCGAAGTAAGCGCCTCAGAACTCTCATTCTCCTCATCCATAGCACTTTAGTGGG
rJMSF024B15- GTACTTGCGAAGTAAGCGCCTCAGAACTCTCATTCTCCTCATCCATAGCACTTTAGTGGG
rJMSF025P02- GTACTTGCGAAGTAAGCGCCTCAGAACTCTCATTCTCCTCATCCATAGCACTTTAGTGGG
rJMSF016F15- GTACTTGCGAAGTAAGCGCCTCAGAACTCTCATTCTCCTCATCCATAGCACTTTAGTGGG
rJMFF016A22- GTACTTGCGAAGTAAGCGCCTCAGAACTCTCATTCTCCTCATCCATAGCACTTTAGTGGG
JMSF016F15+ GTACTTGCGAAGTAAGCGCCTCAGAACTCTCATTCTCCTCATCCATAGCACTTTAGTGGG
JMFF016A22+ GTACTTGCGAAGTAAGCGCCTCAGAACTCTCATTCTCCTCATCCATAGCACTTTAGTGGG
rJMSF006K19- GTACNTGCG
JMSF024B15+ GTACTTGCGAAGTAAGCGCCTCAGAACTCTCATTCTCCTCATCCATAGCACTTTAGTGGG
JMFF051G06+ GTACTTGCGAAGTAAGCGCCTCAGAACTCTCATTCTCCTCATCCATAGCACTTTAGTGGG
JMFF004D15+ GTACTTGCGAAGTAAGCGCCTCAGAACTCTCATTCTCCTCATCCATAGCACTTTAGTGGG
JMFF006P01+ GTACTTGCGAAGTAAGCGCCTCAGAACTCTCATTCTCCTCATCCATAGCACTTTAGTGGG
JMSF025P02+ GTACTTGCGAAGTAAGCGCCTCAGAACTCTCATTCTCCTCATCCATAGCACTTTAGTGGG
JMSF006K17+ GTACTTGCGAAGTAAGCGCCTCAGAACTCTCATTCTCCTCATCCATAGCACTTTAGTGGG
                      ____________________________________________________________
consensus GTACTTGCGAAGTAAGCGCCTCAGAACTCTCATTCTCCTCATCCATAGCACTTTAGTGGG
 
. : . : . : . : . : . :
rJMFF004D15- CAACCTGGCCTCTCTAGTACCCTTGCGCTTACCATATCCAGAATGACGGCCCTTCCTCTT
rJMFF006P01- CAACCTGGCCTCTCTAGTACCCTTGCGCTTACCATATCCAGAATGACGGCCCTTCCTCTT
rJMSF024B15- CAACCTGGCCTCTCTAGTACCCTTGCGCTTACCATATCCAGAATGACGGCCCTTCCTCTT
rJMSF025P02- CAACCTGGCCTCTCTAGTACCCTTGCGCTTACCATATCCAGAATGACGGCCCTTCCTCTT
rJMSF016F15- CAACCTGGCCTCTCTAGTACCCTTGCGCTTACCATATCCAGAATGACGGCCCTTCCTCTT
rJMFF016A22- CAACCTGGCCTCTCTAGTACCCTTGCGCTTACCATATCCAGAATGACGGCCCTTCCTCTT
JMSF016F15+ CAACCTGGCCTCTCTAGTACCCTTGCGCTTACCATATCCAGAATGACGGCCCTTCCTCTT
JMFF016A22+ CAACCTGGCCTCTCTAGTACCCTTGCGCTTACCATATCCAGAATGACGGCCCTTCCTCTT
JMSF024B15+ CAACCTGGCCTCTCTAGTACCCTTGCGCTTACCATATCCAGAATGACGGCCCTTCCTCTT
JMFF051G06+ CAACCTGGCCTCTCTAGTACCCTTGCGCTTACCATATCCAGAATGACGGCCCTTCCTCTT
JMFF004D15+ CAACCTGGCCTCTCTAGTACCCTTGCGCTTACCATATCCAGAATGACGGCCCTTCCTCTT
JMFF006P01+ CAACCTGGCCTCTCTAGTACCCTTGCGCTTACCATATCCAGAATGACGGCCCTTCCTCTT
JMSF025P02+ CAACCTGGCCTCTCTAGTACCCTTGCGCTTACCATATCCAGAATGACGGCCCTTCCTCTT
JMSF006K17+ CAACCTGGCCTCTCTAGTACCCTTGCGCTTACCATATCCAGAATGACGGCCCTTCCTCTT
                      ____________________________________________________________
consensus CAACCTGGCCTCTCTAGTACCCTTGCGCTTACCATATCCAGAATGACGGCCCTTCCTCTT
 
. : . : . : . : . : . :
rJMFF004D15- GGCCTCCTTCATCCGACGAGCACGAGACCTTGAGTGAATCTTGGTTGGCTTCCTGATGAT
rJMFF006P01- GGCCTCCTTCATCCGACGAGCACGAGACCTTGAGTGAATCTTGGTTGGCTTCCTGATGAT
rJMSF024B15- GGCCTCCTTCATCCGACGAGCACGAGACCTTGAGTGAATCTTGGTTGGCTTCCTGATGAT
rJMSF025P02- GGCCTCCTTCATCCGACGAGCACGAGACCTTGAGTGAATCTTGGTTGGCTTCCTGATGAT
rJMSF016F15- GGCCTCCTTCATCCGACGAGCACGAGACCTTGAGTGAATCTTGGTTGGCTTCCTGATGAT
rJMFF016A22- GGCCTCCTTCATCCGACGAGCACGAGACCTTGAGTGAATCTTGGTTGGCTTCCTGATGAT
JMSF016F15+ GGCCTCCTTCATCCGACGAGCACGAGACCTTGAGTGAATCTTGGTTGGCTTCCTGATGAT
JMFF016A22+ GGCCTCCTTCATCCGACGAGCACGAGACCTTGAGTGAATCTTGGTTGGCTTCCTGATGAT
JMSF024B15+ GGCCTCCTTCATCCGACGAGCACGAGACCTTGAGTGAATCTTGGTTGGCTTCCTGATGAT
JMFF051G06+ GGCCTCCTTCATCCGACGAGCACGAGACCTTGAGTGAATCTTGGTTGGCTTCCTGATGAT
JMFF004D15+ GGCCTCCTTCATCCGACGAGCACGAGACCTTGAGTGAATCTTGGTTGGCTTCCTGATGAT
JMFF006P01+ GGCCTCCTTCATCCGACGAGCACGAGACCTTGAGTGAATCTTGGTTGGCTTCCTGATGAT
JMSF025P02+ GGCCTCCTTCATCCGACGAGCACGAGACCTTGAGTGAATCTTGGTTGGCTTCCTGATGAT
JMSF006K17+ GGCCTCCTTCATCCGACGAGCACGAGACCTTGAGTGAATCTTGGTTGGCTTCCTGATGAT
                      ____________________________________________________________
consensus GGCCTCCTTCATCCGACGAGCACGAGACCTTGAGTGAATCTTGGTTGGCTTCCTGATGAT
 
. : . : . : . : . : . :
rJMFF004D15- GAAACCATC
rJMFF006P01- GAAACCATCCTTCACCAATTTCCTTATGTTTTGCCGAGAGTTGGCCATGGAGATCTCGTT
rJMSF024B15- GAAACCATCCTTCACCAATTTCCTTATGTTTTGCCGAGAGTTGGCCATGGAGATCTCGTT
rJMSF025P02- GAAACCATCCTTCACCAATTTCCTTATGTTTTGCCGAGAGTTGGCCATGGAGATCTCGTT
rJMSF016F15- GAAACCATCCTTCACCAATTTCCTTATGTTTTGCCGAGAGTTGGCCATGGAGATCTCGTT
rJMFF016A22- GAAACCATCCTTCACCAATTTCCTTATGTTTTGCCGAGAGTTGGCCATGGAGATCTCGTT
JMSF016F15+ GAAACCATCCTTCACCAATTTCCTTATGTTTTGCCGAGAGTTGGCCATGGAGATCTCGTT
JMFF016A22+ GAAACCATCCTTCACCAATTTCCTTATGTTTTGCCGAGAGTTGGCCATGGAGATCTCGTT
JMSF024B15+ GAAACCATCCTTCACCAATTTCCTTATGTTTTGCCGAGAGTTGGCCATGGAGATCTCGTT
JMFF051G06+ GAAACCATCCTTCACCAATTTCCTTATGTTTTGCCGAGAGTTGGCCATGGAGATCTCGTT
JMFF004D15+ GAAACCATCCTTCACCAATTTCCTTATGTTTTGCCGAGAGTTGGCCATGGAGATCTCGTT
JMFF006P01+ GAAACCATCCTTCACCAATTTCCTTATGTTTTGCCGAGAGTTGGCCATGGAGATCTCGTT
JMSF025P02+ GAAACCATCCTTCACCAATTTCCTTATGTTTTGCCGAGAGTTGGCCATGGAGATCTCGTT
JMSF006K17+ GAAACCATCCTTCACCAATTTCCTTATGTTTTGCCGAGAGTTGGCCATGGAGATCTCGTT
                      ____________________________________________________________
consensus GAAACCATCCTTCACCAATTTCCTTATGTTTTGCCGAGAGTTGGCCATGGAGATCTCGTT
 
. : . : . : . : . : . :
rJMFF006P01- GACTTCATTTGGGTCGAGCCAGACCTTGCCTCTGCCGCACTTGAGCACGCTGGCGGAGAG
rJMSF024B15- GACTTCATTTGGGTCGAGCCAGACCTTGCCTCTGCCGCACTTGAGCACGCTGGCGGAGAG
rJMSF025P02- GACTTCATTTGGGTCGAGCCAGACCTTGCCTCTGCCGCACTTGAGCACGCTGGCGGAGAG
rJMSF016F15- GACTTCATTTGGGTCGAGCCAGACCTTGCCTCTGCCGCACTTGAGCACGCTGGCGGAGAG
rJMFF016A22- GACTTCATTTGGGTCGAGCCAGACCTTGCCTCTGCCGCACTTGAGCACGCTGGCGGANAG
JMSF016F15+ GACTTCATTTGGGTCGAGCCAGACCTTGCCTCTGCCGCACTTGAGCACGCTGGCGGAGAG
JMFF016A22+ GACTTCATTTGGGTCGAGCCAGACCTTGCCTCTGCCGCACTTGAGCACGCTGGCGGAGAG
JMSF024B15+ GACTTCATTTGGGTCGAGCCAGACCTTGCCTCTGCCGCACTTGAGCACGCTGGCGGAGAG
JMFF051G06+ GACTTCATTTGGGTCGAGCCAGACCTTGCCTCTGCCGCACTTGAGCACGCTGGCGGAGAG
JMFF004D15+ GACTTCATTTGGGTCGAGCCAGACCTTGCCTCTGCCGCACTTGAGCACGCTGGCGGAGAG
JMFF006P01+ GACTTCATTTGGGTCGAGCCAGACCTTGCCTCTGCCGCACTTGAGCACGCTGGCGGAGAG
JMSF025P02+ GACTTCATTTGGGTCGAGCCAGACCTTGCCTCTGCCGCACTTGAGCACGCTGGCGGAGAG
JMSF006K17+ GACTTCATTTGGGTCGAGCCAGACCTTGCCTCTGCCGCACTTGAGCACGCTGGCGGAGAG
                      ____________________________________________________________
consensus GACTTCATTTGGGTCGAGCCAGACCTTGCCTCTGCCGCACTTGAGCACGCTGGCGGAGAG
 
. : . : . : . : . : . :
rJMFF006P01- CCGCTTCTGTAACTTCAGCGACACCATTTTCGGT
rJMSF024B15- CCGCTTCTGTAACTTCAGCGACACCATTTTCGGTTCC
rJMSF025P02- CCGCTTCTGTAACTTCAGCGACACCATTTTCGGTTCCT
rJMSF016F15- CCGCTTCTGTAACTTCAGCGACACCATTTTCGGTTCCTCTCGATNGGCGGCGATAC
rJMFF016A22- CCGCTTCTGTAACTTCA
JMSF016F15+ CCGCTTCTGTAACTTCAGCGACACCATTTTCGGTTCCTCTCGATTGGCGGCGATAC
JMFF016A22+ CCGCTTCTGTAACTTCAGCGACACCATTTTCGGTTCCTCTCGATTGGCGGCGATAC
JMSF024B15+ CCGCTTCTGTAACTTCAGCGACACCATTTTCGGTTCCTCTCGATTGGCGGCGATAC
JMFF051G06+ CCGCTTCTGTAACTTCAGCGACACCATTTTCGGTTCCTCTCGATTGGCGGCGATACAAT
JMFF004D15+ CCGCTTCTGTAACTTCAGCGACACCATTTTCGGTTCCTCTCGATTGGCGGCGATAC
JMFF006P01+ CCGCTTCTGTAACTTCAGCGACACCATTTTCGGTTCCTCTCGATTGGCGGCGATACAAT
JMSF025P02+ CCGCTTCTGTAACTTCAGCGACACCATTTTCGGTTCCTCTCGATTGGCGGCGATACAAT
JMSF006K17+ CCGCTTCTGTAACTTCAGCGACACCATTTTCGGTTCCTCTCGATTGGCGGCGATACAATC
                      ____________________________________________________________
consensus CCGCTTCTGTAACTTCAGCGACACCATTTTCGGTTCCTCTCGATTGGCGGCGATACAATC