Previous Contig 004819:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS056A10Sequence627004819 (3)
JMSF006J17Sequence418004819 (3)230011344 (2)
JMSF050L22Sequence577004819 (3)613009361 (4)pir|T48587|T485873e-54peptide transporter-like protein - Arabidopsis thaliana>gb:ATT22N19_1555307 Arab

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS056A10+ GCACCCAAATATGCAACGCAGTGACGA
                      ____________________________________________________________
consensus GCACCCAAATATGCAACGCAGTGACGA
 
. : . : . : . : . : . :
JMFS056A10+ CCATCAAGCAGTCAAAATGTAAGACTAAAAGTATTGCCTTGTTATGTAGCAGAGTTTTAA
                      ____________________________________________________________
consensus CCATCAAGCAGTCAAAATGTAAGACTAAAAGTATTGCCTTGTTATGTAGCAGAGTTTTAA
 
. : . : . : . : . : . :
JMFS056A10+ TTATTTTAAGAGTATTTCCATTTTTTGTTTTAATTTCACTATCGACCATGGAGACTAATT
                      ____________________________________________________________
consensus TTATTTTAAGAGTATTTCCATTTTTTGTTTTAATTTCACTATCGACCATGGAGACTAATT
 
. : . : . : . : . : . :
JMFS056A10+ TACTCACTGAATTATTTTAAAACAAGTGTCAAATAATGTGATTGAATCCAAGCTGGATTT
                      ____________________________________________________________
consensus TACTCACTGAATTATTTTAAAACAAGTGTCAAATAATGTGATTGAATCCAAGCTGGATTT
 
. : . : . : . : . : . :
JMFS056A10+ TTTTAAAAAGTGTCAAAATAATGCGTTTGAATCCAATAATTTTTTTTAAAAAATTACCTT
                      ____________________________________________________________
consensus TTTTAAAAAGTGTCAAAATAATGCGTTTGAATCCAATAATTTTTTTTAAAAAATTACCTT
 
. : . : . : . : . : . :
JMFS056A10+ GTGGTATGCTTTTCCTAATCCACATATCCCCATTGACAACATTAGAACCCACAATGACAA
                      ____________________________________________________________
consensus GTGGTATGCTTTTCCTAATCCACATATCCCCATTGACAACATTAGAACCCACAATGACAA
 
. : . : . : . : . : . :
JMFS056A10+ AGTCAAATTCTGAAGCAGCAGGCGAATCAATGGTCCTCCCATCCGAATCCTCAAAAAGAC
JMSF050L22+ AGCAGGCGAATTAATGGTCCTCCCATCCGAATCCTCAAAANGAG
JMSF006J17+ AGCAGGCAAAGTAATGGTCCTCCCATCCGAATCCTCAAAAAGAG
                      ____________________________________________________________
consensus AGTCAAATTCTGAAGCAGCAGGCGAATTAATGGTCCTCCCATCCGAATCCTCAAAAAGAG
 
. : . : . : . : . : . :
JMFS056A10+ AATAGAAATCAACACAATCCATAGAAAATGTG
JMSF050L22+ AATACAAATCAGCACAATCCATGGAAAATGTGAGGCGTTCTGGTGTTAGATCAAGCCCAA
JMSF006J17+ AATAGAAATCAACACAATCCATGG-AAATGTGTGGCGTTGCGGTGTTAGATCAAGCGCAA
                      ____________________________________________________________
consensus AATAGAAATCAACACAATCCATGGAAAATGTGTGGCGTTGTGGTGTTAGATCAAGCGCAA
 
. : . : . : . : . : . :
JMSF050L22+ CATCTCCAATTAACAATGCAGCGNTGAANCGAGTACTGGGAATACCTCTGAGCAACAATG
JMSF006J17+ CATCACCAATTAACAAAGCGGCGCTGAAACAAGTACTGGGAATACCACTGAGCAGCAATG
                      ____________________________________________________________
consensus CATCTCCAATTAACAATGCGGCGCTGAAACGAGTACTGGGAATACCTCTGAGCAGCAATG
 
. : . : . : . : . : . :
JMSF050L22+ GCGAAGCGTCGAA
JMSF006J17+ GCGAAACGTCGAAGTAGAGGAGGAGGGCGGTGTGGCGGAGGAAAGCTTATCACAGGGCGG
                      ____________________________________________________________
consensus GCGAAGCGTCGAAGTAGAGGAGGAGGGCGGTGTGGCGGAGGAAAGCTTATCACAGGGCGG
 
. : . : . : . : . : . :
JMSF006J17+ AGCACTGGAGCAGAAACCCTAAAGTCTCTAAAATAATTGCGCTAAATGCGGTGTTTATGC
                      ____________________________________________________________
consensus AGCACTGGAGCAGAAACCCTAAAGTCTCTAAAATAATTGCGCTAAATGCGGTGTTTATGC
 
. : . : . : . : . : . :
JMSF006J17+ ACGATGAGAAGAAATGCAAGAAAATACAATTACGTCTATACAATAAATAATAATTTGGTC
                      ____________________________________________________________
consensus ACGATGAGAAGAAATGCAAGAAAATACAATTACGTCTATACAATAAATAATAATTTGGTC