Previous Contig 004818:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF043B01Sequence638004818 (5)gb:AB020745_15146071e-48Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MJE7.203010274 (4)
JMSF002H02Sequence375004818 (5)gb:AB020745_15146072e-26Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MJE7.763010274 (4)gb:AB020745_15146073e-82Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MJE7.
JMSF005E03Sequence366004818 (5)gb:AB020745_15146071e-19Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MJE7.
JMSF005F03Sequence366004818 (5)gb:AB020745_15146074e-20Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MJE7.
JMSF006J16Sequence302004818 (5)323010274 (4)gb:AB020745_15146077e-12Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MJE7.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF043B01+ AGTGAGCATG
                      ____________________________________________________________
consensus AGTGAGCATG
 
. : . : . : . : . : . :
JMFF043B01+ TCATACTGAGACTGCAAACACCTAAGCTGTTTCTGCAACTCCAAAGCTTCAGATTTAAAG
                      ____________________________________________________________
consensus TCATACTGAGACTGCAAACACCTAAGCTGTTTCTGCAACTCCAAAGCTTCAGATTTAAAG
 
. : . : . : . : . : . :
JMFF043B01+ CTACGGTAGCATCCCTTATGTCTNTCAATCCTTCTTCACTTCCAAAAACTGCTTCTTGGT
                      ____________________________________________________________
consensus CTACGGTAGCATCCCTTATGTCTNTCAATCCTTCTTCACTTCCAAAAACTGCTTCTTGGT
 
. : . : . : . : . : . :
JMSF002H02+ CT
JMFF043B01+ TGTCCCTCCTGGTTGAGAAGGCTGAAATGCTATCATAAGCAAAGTCTAAGTCCTCCCCCT
                      ____________________________________________________________
consensus TGTCCCTCCTGGTTGAGAAGGCTGAAATGCTATCATAAGCAAAGTCTAAGTCCTCCCCCT
 
. : . : . : . : . : . :
JMSF002H02+ CCAAGAGCTTCCCTTCTTGTAGAAATTGTTCATATTGGGAAACTTCGGAGGGCGAAAGGA
JMSF005F03+ TCGGAGGGCGAAAGGA
JMSF005E03+ TCGGAGGNCGAAAGGA
JMFF043B01+ CCAAGAGCTTCCCTTCTTGTAGAAATTGTTCATATTGGGAAACTTCGGAGGGCGAAAGGA
                      ____________________________________________________________
consensus CCAAGAGCTTCCCTTCTTGTAGAAATTGTTCATATTGGGAAACTTCGGAGGGCGAAAGGA
 
. : . : . : . : . : . :
JMSF002H02+ CGTTGGAAGGGCGGAGGCTAGAGCAAAGCCAATCGAGAATGGGTCGAGTGTCGTCATATT
JMSF005F03+ CGTTGGAAGGGCGGAGGCTAGAGCAAAGCCAATCGAGAATGGGTCGAGTGTCGTCATATT
JMSF005E03+ CGTTGGAAGGGCGGAGNCTAGAGCAAAGCCAATCGAGAATGGGTCGAGTGTCGTCATATT
JMFF043B01+ CGTTGGAAGGGCGGAGGCTAGAGCAAAGCCAATCGAGAATGGGTCGAGTGTCGTCATATT
                      ____________________________________________________________
consensus CGTTGGAAGGGCGGAGGCTAGAGCAAAGCCAATCGAGAATGGGTCGAGTGTCGTCATATT
 
. : . : . : . : . : . :
JMSF002H02+ GGAATGGCCATTCAAAGCTGTCGGGATCGAGCGATTCGTGGCCTTCATAGCCCAAGTCTC
JMSF005F03+ GGAATGGCCATTCAAAGCTGTCGGGATCGAGCGATTCGTGGCCTTCATAGCCCAAGTCTC
JMSF005E03+ GGAATGGCCATTCAAAGCTGTCGGGATCGAGCGATTCGTGGCCTTCATAGCCCAAGTCTC
JMFF043B01+ GGAATGGCCATTCAAAGCTGTCGGGATCGAGCGATTCGTGGCCTTCATAGCCCAAGTCTC
JMSF006J16+ TC
                      ____________________________________________________________
consensus GGAATGGCCATTCAAAGCTGTCGGGATCGAGCGATTCGTGGCCTTCATAGCCCAAGTCTC
 
. : . : . : . : . : . :
JMSF002H02+ CCAGCAGTGCGCACAGACGCGCACCGCTCATCTTTGATTGTTCACTACGACTGTTATGCT
JMSF005F03+ CCAGCAGTGCGCACAGACGCGCACCGCTCATCTTTGATTGTTCACTACGACTGTTATGCT
JMSF005E03+ CCAGCAGTGCGCACAGACGCGCACCGCTCATCTTTGATTGTTCACTACGACTGTTATGCT
JMFF043B01+ CCAGCAGTGCGCACAGACGCGCACCGCTCATCTTTGATTGTTCACTACGACTGTTATGCT
JMSF006J16+ CCAGCAGTGCGCACAGACGCGCACCGCTCATCTTTGATTGTTCACTACGACTGTTATGCT
                      ____________________________________________________________
consensus CCAGCAGTGCGCACAGACGCGCACCGCTCATCTTTGATTGTTCACTACGACTGTTATGCT
 
. : . : . : . : . : . :
JMSF002H02+ ACTTTCACCGCCTCTCTTCTTCAGCAAAGCAGTGGGTGTTGCTTCAGATCCGAGGCAGAG
JMSF005F03+ ACTTTCACCGCCTCTCTTCTTCAGCAAAGCAGTGGGTGTTGCTTCAGATCCGAGGCAGAG
JMSF005E03+ ACTTTCACCGCCTCTCTTCTTCAGCAAAGCAGTGGGTGTTGCTTCAGATCCGAGGCAGAG
JMFF043B01+ ACTTTCACCGCCTCTCTTCTTCAGCAAAGCAGTGGGTGTTGCTTCAGATCCGAGGCAGAG
JMSF006J16+ ACTTTCACCGCCTCTCTTCTTCAGCAAAGCAGTGGGTGTTGCTTCAGATCCGAGGCAGAG
                      ____________________________________________________________
consensus ACTTTCACCGCCTCTCTTCTTCAGCAAAGCAGTGGGTGTTGCTTCAGATCCGAGGCAGAG
 
. : . : . : . : . : . :
JMSF002H02+ GCGGTTACAGTTGGGCCATTTTCATTGCAATTGTGTAGCAAAACTGATAGGCCTTTCGGT
JMSF005F03+ GCGGTTACAGTTGGGCCATTTTCATTGCAATTGTGTAGCAAAACTGATAGGCCTTTCGGT
JMSF005E03+ GCGGTTACAGTTGGGCCATTTTCATTGCAATTGTGTAGCAAAACTGATAGGCCTTTCGGT
JMFF043B01+ GCGGTTACAGTTGGGCCATTTTCATTGCAATTGTGTAGCAAAACTGATAGGCCTTTCGGT
JMSF006J16+ GCGGTTACAGTTGGGCCATTTTCATTGCAATTGTGTAGCAAAACTGATAGGCCTTTCGGT
                      ____________________________________________________________
consensus GCGGTTACAGTTGGGCCATTTTCATTGCAATTGTGTAGCAAAACTGATAGGCCTTTCGGT
 
. : . : . : . : . : . :
JMSF002H02+ GAGGGAGAGAG
JMSF005F03+ GAGGGAGAGAGTGAGAGCTGCTTTTGGCGCCGGCCAAAGTCGATTGGGC
JMSF005E03+ GAGGGAGAGAGTGAGAGCTGCTTTTGGCGCCGGCCAAAGTCGATTGGGC
JMFF043B01+ GAGGGAGAGAGTGAGAGCTGCTTTTGGCGCCGGCCAAAGTCGATTGGGCGATTTTTTCAT
JMSF006J16+ GAGGGAGAGAGTGAGAGCTGCTTTTGGCGCCGGCCAAAGTCGATTGGGCGATTTTTTCAT
                      ____________________________________________________________
consensus GAGGGAGAGAGTGAGAGCTGCTTTTGGCGCCGGCCAAAGTCGATTGGGCGATTTTTTCAT
 
. : . : . : . : . : . :
JMFF043B01+ GAGCTTTACCAAATTTGAATATCAC
JMSF006J16+ GAGCTTTACCAAATTTGAATTTCACAATCTGGGAAAATAGCCATTTTGCCTTTACTTTCC
                      ____________________________________________________________
consensus GAGCTTTACCAAATTTGAATTTCACAATCTGGGAAAATAGCCATTTTGCCTTTACTTTCC