Previous Contig 004811:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF006F22Sequence557004811 (4)sp|P58905|AT11_LYCES9e-50Ammonium transporter 1, member 1 (LeAMT1;1).449010184 (3)sp|P58905|AT11_LYCES4e-10Ammonium transporter 1, member 1 (LeAMT1;1).
JMFF042A10Sequence655004811 (4)gb:AF182188_17749405e-68Lotus japonicus putative ammonium transporter AMT1;1 mRNA, complete cds.309010184 (3)
JMSF006I07Sequence329004811 (4)gb:AY135020_15817314e-33Lotus japonicus ammonium transporter (Amt1;2) mRNA, complete cds.388022180sp|O04161|AT12_LYCES6e-14Ammonium transporter 1, member 2 (LeAMT1;2).>pir|T06585|T06585 ammonium transpor
JMSF030P02Sequence642004811 (4)sp|P58905|AT11_LYCES9e-83Ammonium transporter 1, member 1 (LeAMT1;1).461010184 (3)gb:AF182188_17749403e-25Lotus japonicus putative ammonium transporter AMT1;1 mRNA, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF030P02+ CCAAGAGCCCGTTGCACACGTCCGTCACGTTCCAATGCCCGGACAGA
                      ____________________________________________________________
consensus CCAAGAGCCCGTTGCACACGTCCGTCACGTTCCAATGCCCGGACAGA
 
. : . : . : . : . : . :
JMSF030P02+ ATCCTTTTTCCGAACAACGTCGTCAGCGCCGCCGTGCATCCGGCTAAAGTGGTGGTCACG
                      ____________________________________________________________
consensus ATCCTTTTTCCGAACAACGTCGTCAGCGCCGCCGTGCATCCGGCTAAAGTGGTGGTCACG
 
. : . : . : . : . : . :
JMSF030P02+ GCGGTCCGCCCCACCGCGCTCCATTGCCCGTAGCTGCCGCCGACGGCGGCGTCGGGATAC
                      ____________________________________________________________
consensus GCGGTCCGCCCCACCGCGCTCCATTGCCCGTAGCTGCCGCCGACGGCGGCGTCGGGATAC
 
. : . : . : . : . : . :
JMSF030P02+ GTGACTAAAATTTTGTTAAACGAACCGGGGTTAAACCCGTACCACCCGAACCATAACAGA
                      ____________________________________________________________
consensus GTGACTAAAATTTTGTTAAACGAACCGGGGTTAAACCCGTACCACCCGAACCATAACAGA
 
. : . : . : . : . : . :
JMSF030P02+ AAGGTTCCTAAAACTACTAACGAAGCACTATGGCCACGAAGCGCCACGGACCTTCAATGA
                      ____________________________________________________________
consensus AAGGTTCCTAAAACTACTAACGAAGCACTATGGCCACGAAGCGCCACGGACCTTCAATGA
 
. : . : . : . : . : . :
JMSF030P02+ GTGCTCCGTATAAACCGGCGATTCCGCCCACCATATGAACCACGCCCGAACCGGCGAAGT
JMFF042A10+ GT
                      ____________________________________________________________
consensus GTGCTCCGTATAAACCGGCGATTCCGCCCACCATATGAACCACGCCCGAACCGGCGAAGT
 
. : . : . : . : . : . :
JMSF030P02+ CAATAACTCCGGTTCCGAATAAGAGATTGTTGTTGTTAAACGCGCTGGCCCAACCGTCAA
JMFF042A10+ CAATAACTCCGGTTCCGAATAAGAGATTGTTGTTGTTAAACGCGCTGGCCCAACCGTCAA
                      ____________________________________________________________
consensus CAATAACTCCGGTTCCGAATAAGAGATTGTTGTTGTTAAACGCGCTGGCCCAACCGTCAA
 
. : . : . : . : . : . :
JMSF030P02+ CGGACCAGAACCAGTGGGAGACGACCGGGTAAACAAAACCGGTGAGGAAAGCCGAGTAGA
JMFF006F22+ AAACCGGTGAGGAAAGCCGAGTAGA
JMFF042A10+ CGGACCAGAACCAGTGGGAGACGACCGGGTAAACAAAACCGGTGAGGAAAGCCGAGTAGA
                      ____________________________________________________________
consensus CGGACCAGAACCAGTGGGAGACGACCGGGTAAACAAAACCGGTGAGGAAAGCCGAGTAGA
 
. : . : . : . : . : . :
JMSF030P02+ TGAGATAAGCCACGAACTGGGTCCGCTCGGCTATGGAGCCGCTGGTGATGCCGGCGGCGG
JMFF006F22+ TGAGATAAGCCACGAACTGGGTCCGCTCGGCTATGGAGCCGCTGGTGATGCCGGCGGCGG
JMFF042A10+ TGAGATAAGCCACGAACTGGGTCCGCTCGGCTATGGAGCCGCTGGTGATGCCGGCGGCGG
                      ____________________________________________________________
consensus TGAGATAAGCCACGAACTGGGTCCGCTCGGCTATGGAGCCGCTGGTGATGCCGGCGGCGG
 
. : . : . : . : . : . :
JMSF030P02+ CTATGGCGAAAGCCCATTGGTAAAGGAAGTTGCTGTAGTCGAGGGCGGCGGCGCCGTCGG
JMFF006F22+ CTATGGCGAAAGCCCATTGGTAAAGGAAGTTGCTGTAGTCGAGGGCGGCGGCGCCGTCGG
JMFF042A10+ CTATGGCGAAAGCCCATTGGTAAAGGAAGTTGCTGTAGTCGAGGGCGGCGGCGCCGTCGG
                      ____________________________________________________________
consensus CTATGGCGAAAGCCCATTGGTAAAGGAAGTTGCTGTAGTCGAGGGCGGCGGCGCCGTCGG
 
. : . : . : . : . : . :
JMSF030P02+ GGATGTTCTTCAAGCCGAAGAAGTGGTGGCCGATGAAGCCGTTGGAATTTCCGCC
JMFF006F22+ GGATGTTCTTCAAGCCGAAGAAGTGGTGGCCGATGAAGCCGTTGGAATTTCCGCCGGTGC
JMFF042A10+ GGATGTTCTTCAAGCCGAAGAAGTGGTGGCCGATGAAGCCGTTGGAATTTCCGCCGGTGC
                      ____________________________________________________________
consensus GGATGTTCTTCAAGCCGAAGAAGTGGTGGCCGATGAAGCCGTTGGAATTTCCGCCGGTGC
 
. : . : . : . : . : . :
JMFF006F22+ CGAAGGCGAAGGCGAAGCCGAAGAGGTAGTAGAAGAGGCCGCCGGCGGCGGCGTCGAGGA
JMFF042A10+ CGAAGGCGAAGGCGAAGCCGAAGAGGTAGTAGAAGAGGCCGCCGGCGGCGGCGTCGAGGA
JMSF006I07+ CCGGCGGCGGCGTCGAGGA
                      ____________________________________________________________
consensus CGAAGGCGAAGGCGAAGCCGAAGAGGTAGTAGAAGAGGCCGCCGGCGGCGGCGTCGAGGA
 
. : . : . : . : . : . :
JMFF006F22+ CGTTGGTGAGCATGATGTTCATGGTGTTCTTGGCGCGGACGGAGCCGGCGCAGAGCATGG
JMFF042A10+ CGTTGGTGAGCATGATGTTCATGGTGTTCTTGGCGCGGACGGAGCCGGCGCAGAGCATGG
JMSF006I07+ CGTTGGTGAGCATAATGTTCATGGTGTTCTTGGCGCGGACGGAGCCGGCGCAGAGCATGG
                      ____________________________________________________________
consensus CGTTGGTGAGCATGATGTTCATGGTGTTCTTGGCGCGGACGGAGCCGGCGCAGAGCATGG
 
. : . : . : . : . : . :
JMFF006F22+ CGAAGCCGAGCTGCATGGAGAAGACTAAGTAAGCGGAGAAGAGGAG
JMFF042A10+ CGAAGCCGAGCTGCATGGAGAAGACTAAGTAAGCGGAGAAGAGGAG
JMSF006I07+ CGAACCCCAGCTGCATGGCGAACACCAGGTAGGCGGAGAAGAGGAGGTACGTGTTGTCCA
                      ____________________________________________________________
consensus CGAAGCCGAGCTGCATGGAGAAGACTAAGTAAGCGGAGAAGAGGAGGTACGTGTTGTCCA
 
. : . : . : . : . : . :
JMSF006I07+ CCGCGAATTTCGTGGCCGTCAGTTGGGCGGAGAAGGCCGTCAACTGGCCGCAGATGAAGT
                      ____________________________________________________________
consensus CCGCGAATTTCGTGGCCGTCAGTTGGGCGGAGAAGGCCGTCAACTGGCCGCAGATGAAGT
 
. : . : . : . : . : . :
JMSF006I07+ TCGCCGCACCCGTCGCGTTCACGGCTCCGCCCAGAAGTGGGCTGAGCTCGGAGGCGGAGC
                      ____________________________________________________________
consensus TCGCCGCACCCGTCGCGTTCACGGCTCCGCCCAGAAGTGGGCTGAGCTCGGAGGCGGAGC
 
. : . : . : . : . : . :
JMSF006I07+ AGCTCAAAGAGGCCATAGTTGTCGAAGAAATTAAAGGCTTTGGAAGTGGAACTAAATATG
                      ____________________________________________________________
consensus AGCTCAAAGAGGCCATAGTTGTCGAAGAAATTAAAGGCTTTGGAAGTGGAACTAAATATG