Previous Contig 004809:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF020H01Sequence569004809 (13)gb:COTFIB_16483872e-05Gossypium hirsutum ORF with two tentative start codons, complete cds.694004809 (13)gb:AC123513_11924107e-28Dictyostelium discoideum strain AX4 chromosome 2 map 2779865-2840915, *** SEQUEN
JMFF023B09Sequence524004809 (13)gb:CR382398_13748700.028Plasmodium falciparum chromosome 6, complete sequence; segment 1/5.622004809 (13)gb:COTFIB_16483872e-05Gossypium hirsutum ORF with two tentative start codons, complete cds.
JMFF043F06Sequence646004809 (13)gb:CR382398_13748700.045Plasmodium falciparum chromosome 6, complete sequence; segment 1/5.494004809 (13)gb:AC123513_11924104e-27Dictyostelium discoideum strain AX4 chromosome 2 map 2779865-2840915, *** SEQUEN
JMFF047I06Sequence428004809 (13)gb:CR382398_13748700.019Plasmodium falciparum chromosome 6, complete sequence; segment 1/5.242021789
JMFN003M16Sequence627004809 (13)pir|S65062|S650621e-05fiber protein E6 (clone CKE6-4A) - upland cotton>gb:GHU30506_1680151 Gossypium h
JMFN004O06Sequence543004809 (13)pir|JU0465|JU04654e-05extensin precursor - curled-leaved tobacco>gb:TOBEXT_1725420 N.plumbaginifolia e
JMFN005N11Sequence627004809 (13)pir|S65062|S650620.014fiber protein E6 (clone CKE6-4A) - upland cotton>gb:GHU30506_1680151 Gossypium h
JMFS063D12Sequence640004809 (13)pir|S65062|S650626e-10fiber protein E6 (clone CKE6-4A) - upland cotton>gb:GHU30506_1680151 Gossypium h
JMSF006F18Sequence464006554 (5)164004809 (13)
JMSF006H20Sequence387004809 (13)

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF043F06- ATAAGTATTAAACATTTTATCATAGACATATATATATC
rJMSF006F18- ATTTTATCATANACATATATATATC
rJMFF023B09- TAGTTTAATTAACATTTTTATAAGTATTAAACATTTTATCATAGACATATATATATC
                      ____________________________________________________________
consensus TAGTTTAATTAACATTTTTATAAGTATTAAACATTTTATCATAGACATATATATATC
 
. : . : . : . : . : . :
rJMFF043F06- AA-ACAGAAATGATATTGGAATAATAAATAAGACATGCA-TGCACTCGATGGTATGTATC
rJMSF006F18- AANGCGGAAATGATATTGGAANAATANATAAGACATGCAGTGCACTCGATGGTATGTATC
rJMFF023B09- AA-ACAGAAATGATATTGGAATAATAAATAAGACATGCA-TGCACTCGATGGTATGTATC
rJMFF020H01- AATAAATAAGACATGCA-TGCACTCGATGGTATGTATC
                      ____________________________________________________________
consensus AA-ACAGAAATGATATTGGAATAATAAATAAGACATGCA-TGCACTCGATGGTATGTATC
 
. : . : . : . : . : . :
rJMFF043F06- ATCATCATCATCACACATTTGCTCAAAATACCTTTAA-TTTAATCAGCTGTGTAAATTAC
rJMSF006F18- ATCATCNTCATCACACATTTGCTCAAAATTACTTTAAGTTNAATCAGCTGTGTAAATTAC
rJMFF023B09- ATCATCATCATCACACATTTGCTCAAAATTACTTTAA-TTTAATCAGCTGTGTAAATTAC
rJMFF020H01- ATCATCATCATCACACATTTGCTCAAAATTACTTTAA-TTTAATCAGCTGTGTAAATTAC
                      ____________________________________________________________
consensus ATCATCATCATCACACATTTGCTCAAAATTACTTTAA-TTTAATCAGCTGTGTAAATTAC
 
. : . : . : . : . : . :
rJMFF043F06- GCAATGAAGATGAAAATCTCGATCTCACGGCATGTCGTCTTCATCCTGGAACTGCTCCTC
rJMSF006F18- GCAATGAAGATGANAATCT
rJMFF023B09- GCAATGAAGATGAAAATCTCGATCTCAAGGCATGTCGTCTTCATCCTGGAACTGCTCCTC
rJMFF020H01- GCAATGAAGATGAAAATCTCGATCTCAAGGCATGTCGTCTTCATCCTGGAACTGCTCCTC
                      ____________________________________________________________
consensus GCAATGAAGATGAAAATCTCGATCTCAAGGCATGTCGTCTTCATCCTGGAACTGCTCCTC
 
. : . : . : . : . : . :
rJMFF043F06- GTTCTGGTAGTTGTTGTTCTCCATGAAATTGTTGTTGCTGTTCTGGAACTGCTTTTTAAA
rJMFF023B09- GTTCTGGTAGTTGTTGTTCTCCATGAAATTGTTGTTGCTGTTCTGGAACTGCTTTTTAAA
rJMFF020H01- GTTCTGGTAGTTGTTGTTCTCCATGAAATTGTTGTTGCTGTTCTGGAACTGCTTTTTAAA
                      ____________________________________________________________
consensus GTTCTGGTAGTTGTTGTTCTCCATGAAATTGTTGTTGCTGTTCTGGAACTGCTTTTTAAA
 
. : . : . : . : . : . :
rJMFF043F06- ATCTTCAAGGTTAATCCCTGCGTTCTCCAATGGATGTCTTGCGTACCTTTCAGTGTTGGT
rJMFF023B09- ATCTTCAAGGTTAATCCCTGCGTTCTCCAATGGATGTCTTGCGTACCTTTCAGTGTTGGT
rJMFF020H01- ATCTTCAAGGTTAATCCCTGCGTTCTCCAATGGATGTCTTGCGTACCTTTCAGTGTTGGT
JMFF020H01+ GTCTTGCGTACCTTTCAGTGTTGGT
JMFS063D12+ GTACCTTTCAGTGTTGGT
                      ____________________________________________________________
consensus ATCTTCAAGGTTAATCCCTGCGTTCTCCAATGGATGTCTTGCGTACCTTTCAGTGTTGGT
 
. : . : . : . : . : . :
rJMFF043F06- ATCGCAGTAGTACTTCCCGTTCTCCAAGAACCTGGTGTCGCTCATGCCCATCTTCTCAAC
rJMFF023B09- ATCGTAGTAGTACTTCCCGTTCTCCAAGAACCTGGTGTCGCTCATGCCCATCTTCTCAAC
rJMFF020H01- ATCGTAGTAGTACTTCCCGTTCTCCAAGAACCTGGTGTCGCTCATGCCCATCTTCTCAAC
JMFF020H01+ ATCGTAGTAGTACTTCCCGTTCTCCAAGAACCTGGTGTCGCTCATGCCCATCTTCTCAAC
JMFS063D12+ ATCGTAGTAGTACTTCCCGTTCTCCAAGAACCTGGTGTCGCTCATGCCCATCTTCTCAAC
JMFN005N11+ CCCGTTCTCCAAGAACCTGGTGTCGCTCATGCCCATCTTCTCAAC
JMFN003M16+ CCCGTTCTCCAAGAACCTGGTGTCGCTCATGCCCATCTTCTCAAC
JMFF043F06+ TCTCCAAGAACCT-GTGTCGCTCATGCCCAT-TTCTCAAC
                      ____________________________________________________________
consensus ATCGTAGTAGTACTTCCCGTTCTCCAAGAACCTGGTGTCGCTCATGCCCATCTTCTCAAC
 
. : . : . : . : . : . :
rJMFF043F06- TTTGTTCCCCGCCGCCGCATTGTAGCGGTTGTTGGTGGTGGTGGACGAACTTTCTTCTTG
rJMFF023B09- TTTGTTCCCCGCCGCCGCATTGTAGCGGTTGTTGGTGGTGGTGGGGAAGCTTTCTTCTTG
rJMFF020H01- TTTGTTCCCCGCCGCCGCATTGTAGCGGTTGTTGGTGGTGGTGGGGAAGCTTTCTTCTTG
JMFF020H01+ TTTGTTCCCCGCCGCCGCATTGTAGCGGTTGTTGGTGGTGGTGGGGAAGCTTTCTTCTTG
JMFS063D12+ TTTGTTCCCCGCCGCCGCATTGTAGCGGTTGTTGGTGGTGGTGGGGAAGCTTTCTTCTTG
JMFN005N11+ TTTGTTCNCCGCCGCCGCATTGTAGCGGTTGTTGGTGGTGGTGGGGAAGCTTTCTTCTTG
JMFN003M16+ TTTGTTCCCCGCCGCCGCATTGTAGCGGTTGTTGGTGGTGGTGGGGAAGCTTTCTTCTTG
JMFN004O06+ TGTTGGTGGTGGT-GGGAAGCTTTCTTCTTG
JMFF043F06+ -TTGTTCNCCGCCGCCGCATTGTAGCGGTTGTTGGTGGTGGTGGGGAAGCTTTCTTCTTG
                      ____________________________________________________________
consensus TTTGTTCCCCGCCGCCGCATTGTAGCGGTTGTTGGTGGTGGTGGGGAAGCTTTCTTCTTG
 
. : . : . : . : . : . :
rJMFF043F06- GCGGCCGCCGCCGCCGTAATA-TCGCTGCTGCGGCGGCTG
rJMFF023B09- GCGGCCGCCGCCGCCGTAGTAGTTGCTGCTGCGGCGGCTGTTGTAGTAGTTGTTTCTGGC
rJMFF020H01- GCGGCCGCCGCCGCCGTAGTAGTTGCTGCTGCGGCGGCTGTTGTAGTAGTTGTTTCTGGC
JMFF020H01+ GCGGCCGCCGCCGCCGTAGTAGTTGCTGCTGCGGCGGCTGTTGTAGTAGTTGTTTCTGGC
JMFS063D12+ GCGGCCGCCGCCGCCGTAGTAGTTGCTGCTGCGGCGGCTGTTGTAGTAGTTGTTTCTGGC
JMFN005N11+ GCGGCCGCCGCCGCCGTAGTAGTTGCTGCTGCGGCGGCTGTTGTAGTAGTTGTTTCTGGC
JMFN003M16+ GCGGCCGCCGCCGCCGTAGTAGTTGCTGCTGCGGCGGCTGTTGTAGTAGTTGTTTCTGGC
JMFN004O06+ GCGGCCGCCGCCGCCGTAGTAGTTGCTGCTGCGGCGGCTGTTGTAGTAGTTGTTTCTGGC
JMFF043F06+ GCGGCCGCCGCCGCCGTAGTAGTTGCTGCTGCGGCGGCTGTTGTAGTAGTTGTTTCTGGC
JMFF023B09+ CGTAGTAGTTGCTGCTGCGGCGGCTGTTGTAGTAGTTGTTTCTGGC
                      ____________________________________________________________
consensus GCGGCCGCCGCCGCCGTAGTAGTTGCTGCTGCGGCGGCTGTTGTAGTAGTTGTTTCTGGC
 
. : . : . : . : . : . :
rJMFF023B09- GGTGTAGCTGTTGTAGCGGTTGTTGTTATCGGCGGCGGTGGTGAATTCCTCGCCGGCGAA
rJMFF020H01- GGTGTAGCTGTTGTAGCGGTTGTTGTTATCGGCGGCGGTGGTGAATTCCTCGCCGGCGAA
JMFF020H01+ GGTGTAGCTGTTGTAGCGGTTGTTGTTATCGGCGGCGGTGGTGAATTCCTCGCCGGCGAA
JMFS063D12+ GGTGTAGCTGTTGTAGCGGTTGTTGTTATCGGCGGCGGTGGTGAATTCCTCGCCGGCGAA
JMFN005N11+ GGTGTAGCTGTTGTAGCGGTTGTTGTTATCGGCGGCGGTGGTGAATTCCTCGCCGGCGAA
JMFN003M16+ GGTGTAGCTGTTGTAGCGGTTGTTGTTATCGGCGGCGGTGGTGAATTCCTCGCCGGCGAA
JMFN004O06+ GGTGTAGCTGTTGTAGCGGTTGTTGTTATCGGCGGCGGTGGTGAATTCCTCGCCGGCGAA
JMFF043F06+ GGTGTAGCTGTTGTAGCGGTTGTTGTTATCGGCGGCGGTGGTGAATTCCTCGCCGGCGAA
JMFF047I06+ CGCCGGCGAA
JMFF023B09+ GGTGTAGCTGTTGTAGCGGTTGTTGTTATCGGCGGCGGTGGTGAATTCCTCGCCGGCGAA
                      ____________________________________________________________
consensus GGTGTAGCTGTTGTAGCGGTTGTTGTTATCGGCGGCGGTGGTGAATTCCTCGCCGGCGAA
 
. : . : . : . : . : . :
rJMFF023B09- CTTGGAATCCTCGTTGTTCGTGTTGTCC
rJMFF020H01- CTTGGAATCCTCGTTGTTCGTGTTGTCCTCCGGGACAGTCACGTAGGAGACAGGGTTGTA
JMFF020H01+ CTTGGAATCCTCGTTGTTCGTGTTGTCCTCCGGGACAGTCACGTAGGAGACAGGGTTGTA
JMFS063D12+ CTTGGAATCCTCGTTGTTCGTGTTGTCCTCCGGGACAGTCACGTAGGAGACAGGGTTGTA
JMFN005N11+ CTTGGAATCCTCGTTGTTCGTGTTGTCCTCCGGGACAGTCACGTAGGAGACAGGGTTGTA
JMFN003M16+ CTTGGAATCCTCGTTGTTCGTGTTGTCCTCCGGGACAGTCACGTAGGAGACAGGGTTGTA
JMFN004O06+ CTTGGAATCCTCGTTGTTCGTGTTGTCCTCCGGGACAGTCACGTAGGAGACAGGGTTGTA
JMFF043F06+ CTTGGAATCCTCGTTGTTCGTGTTGTCCTCCGGGACAGTCACGTAGGAGACAGGGTTGTA
JMFF047I06+ CTNGGAATCCTCGTTGTTCGTGTTGTCCTCCGGGACAGTCACGTAGGAGACAGGGTTGTA
JMFF023B09+ CTTGGAATCCTCGTTGTTCGTGTTGTCCTCCGGGACAGTCACGTAGGAGACAGGGTTGTA
JMSF006H20+ GGACAGTCACGTAGGAGACAGGGTTGTA
                      ____________________________________________________________
consensus CTTGGAATCCTCGTTGTTCGTGTTGTCCTCCGGGACAGTCACGTAGGAGACAGGGTTGTA
 
. : . : . : . : . : . :
rJMFF020H01- GTTCCTCGGAAGGTATCTCTTGTTGGGAACCTCCTCCTCGGTTTTGTACGGCAGTTTGTT
JMFF020H01+ GTTCCTCGGAAGGTATCTCTTGTTGGGAACCTCCTCCTCGGTTTTGTACGGCAGTTTGTT
JMFS063D12+ GTTCCTCGGAAGGTATCTCTTGTTGGGAACCTCCTCCTCGGTTTTGTACGGCAGTTTGTT
JMFN005N11+ GTTCCTCGGAAGGTATCTCTTGTTGGGAACCTCCTCCTCGGTTTTGTACGGCAGTTTGTT
JMFN003M16+ GTTCCTCGGAAGGTATCTCTTGTTGGGAACCTCCTCCTCGGTTTTGTACGGCAGTTTGTT
JMFN004O06+ GTTCCTCGGAAGGTATCTCTTGTTGGGAACCTCCTCCTCGGTTTTGTACGGCAGTTTGTT
JMFF043F06+ GTTCCTCGGAAGGTATCTCTTGTTGGGAACCTCCTCCTCGGTTTTGTACGGCAGTTTGTT
JMFF047I06+ GTTCCTCGGAAGGTATCTCTTGTTGGGAACCTCCTCCTCGGTTTTGTACGGCAGTTTGTT
JMFF023B09+ GTTCCTCGGAAGGTATCTCTTGTTGGGAACCTCCTCCTCGGTTTTGTACGGCAGTTTGTT
JMSF006H20+ GTTCCTCGGAAGGTATCTCTTGTTGGGAACCTCCTCCTCGGTTTTGTACGGCAGTTTGTT
                      ____________________________________________________________
consensus GTTCCTCGGAAGGTATCTCTTGTTGGGAACCTCCTCCTCGGTTTTGTACGGCAGTTTGTT
 
. : . : . : . : . : . :
rJMFF020H01- GTTGTTGTTG
JMFF020H01+ GTTGTTGTTGTTG
JMFS063D12+ GTTGTTGTTGTTGGTGGTGTACGGTTGGTCTAGGCCGCCGTTTTCGTTCTCCGGGATGAA
JMFN005N11+ GTTGTTGTTGTTGGTGGTGTACGGTTGGTCTAGGCCGCCGTTTTCGTTCTCCGGGATGAA
JMFN003M16+ GTTGTTGTTGTTGGTGGTGTACGGTTGGTCTAGGCCGCCGTTTTCGTTCTCCGGGATGAA
JMFN004O06+ GTTGTTGTTGTTGGTGGTGTACGGTTGGTCTAGGCCGCCGTTTTCGTTCTCCGGGATGAA
JMFF043F06+ GTTGTTGTTGTTGGTGGTGTACGGTTGGTCTAGGCCGCCGTTTTCGTTCTCCGGGATGAA
JMFF047I06+ GTTGTTGTTGTTGGTGGTGTACGGTTGGTCTAGGCCGCCGTTTTCGTTCTCCGGGATGAA
JMFF023B09+ GTTGTTGTTGTTGGTGGTGTACGGTTGGTCTAGGCCGCCGTTTTCGTTCTCCGGGATGAA
JMSF006H20+ GTTGTTGTTGTTGGTGGTGTACGGTTGGTCTAGGCCGCCGTTTTCGTTCTCCGGGATGAA
                      ____________________________________________________________
consensus GTTGTTGTTGTTGGTGGTGTACGGTTGGTCTAGGCCGCCGTTTTCGTTCTCCGGGATGAA
 
. : . : . : . : . : . :
JMFS063D12+ GTTTTGTTCTTGCTGCTGGGGAATCACGGTGGTCTGCTCTGTATTGACGCCATAGTTGTT
JMFN005N11+ GTTTTGTTCTTGCTGCTGGGGAATCACGGTGGTCTGCTCTGTATTGACGCCATAGTTGTT
JMFN003M16+ GTTTTGTTCTTGCTGCTGGGGAATCACGGTGGTCTGCTCTGTATTGACGCCATAGTTGTT
JMFN004O06+ GTTTTGTTCTTGCTGCTGGGGAATCACGGTGGTCTGCTCTGTATTGACGCCATAGTTGTT
JMFF043F06+ GTTTTGTTCTTGCTGCTGGGGAATCACGGTGGTCTGCTCTGTATTGACGCCATAGTTGTT
JMFF047I06+ GTTTTGTTCTTGCTGCTGGGGAATCACGGTGGTCTGCTCTGTATTGACGCCATAGTTGTT
JMFF023B09+ GTTTTGTTCTTGCTGCTGGGGAATCACGGTGGTCTGCTCTGTATTGACGCCATAGTTGTT
JMSF006H20+ GTTTTGTTCTTGCTGCTGGGGAATCACGGTGGTCTGCTCTGTATTGACGCCATAGTTGTT
                      ____________________________________________________________
consensus GTTTTGTTCTTGCTGCTGGGGAATCACGGTGGTCTGCTCTGTATTGACGCCATAGTTGTT
 
. : . : . : . : . : . :
JMFS063D12+ GTTGTTGTTGCCTGGGATTTTGTTGAAGAAATACTGGGTTTCTCTTGCATGAAGAATCTG
JMFN005N11+ GTTGTTGTTGCCTGGGATTTTGTTGAAGAAATACTGGGTTTCTCTTGCATGAAGAATCTG
JMFN003M16+ GTTGTTGTTGCCTGGGATTTTGTTGAAGAAATACTGGGTTTCTCTTGCATGAAGAATCTG
JMFN004O06+ GTTGTTGTTGCCTGGGATTTTGTTGAAGAAATACTGGGTTTCTCTTGCATGAAGAATCTG
JMFF043F06+ GTTGTTGTTGCCTGGGATTTTGTTGAAGAAATACTGGGTTTCTCTTGCATGAAGAATCTG
JMFF047I06+ GTTGTTGTTGCCTGGGATTTTGTTGAAGAAATACTGGGTTTCTCTTGCATGAAGAATCTG
JMFF023B09+ GTTGTTGTTGCCTGGGATTTTGTTGAAGAAATACTGGGTTTCTCTTGCATGAAGAATCTG
JMSF006H20+ GTTGTTGTTGCCTGGGATTTTGTTGAAGAAATACTGGGTTTCTCTTGCATGAAGAATCTG
                      ____________________________________________________________
consensus GTTGTTGTTGCCTGGGATTTTGTTGAAGAAATACTGGGTTTCTCTTGCATGAAGAATCTG
 
. : . : . : . : . : . :
JMFS063D12+ GAGAGAGGATAAAAGTGTGAGGAGGAGGAAGAGAGAGAAACGGCGGGTGGGGACGGCCAT
JMFN005N11+ GAGAGAGGATAAAAGTGTGAGGAGGAGGAAGAGAGAGAAACGGCGGGTGGGGACGGCCAT
JMFN003M16+ GAGAGAGGATAAAAGTGTGAGGAGGAGGAAGAGAGAGAAACGGCGGGTGGGGACGGCCAT
JMFN004O06+ GAGAGAGGATAAAAGTGT-AGGAGGAGGAAGAGA-ANAAACGGCGGGTGGGGACGGC
JMFF043F06+ GAGAGAGGATAAAAGTGTGAGGAGGAGGAAGAGAGAGAAACGGCGGGTGGGGACGGCCAT
JMFF047I06+ GAGAGAGGATAAAAGTGTGAGGAGGAGGAAGAGATAGAAACGGCGGGTGGGGCCGGCCAT
JMFF023B09+ GAGAGAGGATAAAAGTGTGAGGAGGAGGAAGAGAGAGAAACGGCGGGTGGGGACGGCCAT
JMSF006H20+ GAGAGAGGATAAAAGTGTGAGGAGGAGGAAGAGAGAGAAACGGCGGGTGGGGACGGCCAT
                      ____________________________________________________________
consensus GAGAGAGGATAAAAGTGTGAGGAGGAGGAAGAGAGAGAAACGGCGGGTGGGGACGGCCAT
 
. : . : . : . : . : . :
JMFS063D12+ GGNCTACGCCGGAGACGGTGAA
JMFN005N11+ GG-CTACGCCGGAGACGGTGAAGGAGAGAATTGGAAGAGATGA
JMFN003M16+ GG-CTACGCCGGAGACGGTGAAGGAGAGAATTGGAAGAGATGA
JMFF043F06+ GG-CTACGCCGGAGACGGTGAAGGAGAGAATTGGAAGAGATGATGTTGCTTTGTT
JMFF047I06+ GG-CTACGCCGGAGACGGTGAAGGAGAGAATTGGAAGAGATGATGTTGCTTTGTT
JMFF023B09+ GG-CTACGCCGGAGACGGTGAAGGAGAGAATTGGAAGAGATGATGTTGCTTTGTT
JMSF006H20+ GG-CTACGCCGGAGACGGTGAAGGAGAGAATTGGAAGAGATGATGTTGCTTTGTTGTGTC
                      ____________________________________________________________
consensus GG-CTACGCCGGAGACGGTGAAGGAGAGAATTGGAAGAGATGATGTTGCTTTGTTGTGTC