Previous Contig 004808:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF022F04Sequence503004808 (3)gb:CBL458993_16456706e-43Coleus blumei mRNA for tyrosine aminotransferase (tat gene).720010400 (2)gb:CBL458993_16456708e-59Coleus blumei mRNA for tyrosine aminotransferase (tat gene).
JMFF044C21Sequence632004808 (3)gb:CBL458993_16456702e-77Coleus blumei mRNA for tyrosine aminotransferase (tat gene).652010400 (2)gb:CBL458993_16456703e-33Coleus blumei mRNA for tyrosine aminotransferase (tat gene).
JMSF006H14Sequence393004808 (3)

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF044C21+ TGCAATCTCTTGACGATGCTGATAAGTATACACATTCCCACAGGGATTCCCAGGATTTAT
                      ____________________________________________________________
consensus TGCAATCTCTTGACGATGCTGATAAGTATACACATTCCCACAGGGATTCCCAGGATTTAT
 
. : . : . : . : . : . :
JMFF044C21+ AATCACCACTGCAATAGTATTCTGATCTGCAAGAGACTCAACAGCATTGAGATCAACCTC
                      ____________________________________________________________
consensus AATCACCACTGCAATAGTATTCTGATCTGCAAGAGACTCAACAGCATTGAGATCAACCTC
 
. : . : . : . : . : . :
JMFF044C21+ CCAGGCTTTCTCAGGGAGAAGATCATAATATCTAACTTCAAGGTGTCTAAAAGCAGCACA
                      ____________________________________________________________
consensus CCAGGCTTTCTCAGGGAGAAGATCATAATATCTAACTTCAAGGTGTCTAAAAGCAGCACA
 
. : . : . : . : . : . :
JMFF044C21+ GAGTGCATAAATTGGAAACCCTGGTCTTGGCAGCAAGATATTAGCTCCAGGGTAAGCCAG
JMFF022F04+ GCAGCAAGATATTAGCTCCAGGGTAAGCCAG
                      ____________________________________________________________
consensus GAGTGCATAAATTGGAAACCCTGGTCTTGGCAGCAAGATATTAGCTCCAGGGTAAGCCAG
 
. : . : . : . : . : . :
JMFF044C21+ AATTGACAGTGCTGTTTCAATGGCTTGAGTGCAGCCAGCTGTTACATAAACATCATCTGC
JMFF022F04+ AATTGACAGTGCTGTTTCAATGGCTTGAGTGCAGCCAGCTGTTACATAAACATCATCTGC
                      ____________________________________________________________
consensus AATTGACAGTGCTGTTTCAATGGCTTGAGTGCAGCCAGCTGTTACATAAACATCATCTGC
 
. : . : . : . : . : . :
JMFF044C21+ TGATACCTTTTCTGGAAGGTCACGAGACAAATAGTCTGCAATTGCCTTTCGGGTTTGAGG
JMFF022F04+ TGATACCTTTTCTGGAAGGTCACGAGACAAATAGTCTGCAATTGCCTTTCGGGTTTGAGG
                      ____________________________________________________________
consensus TGATACCTTTTCTGGAAGGTCACGAGACAAATAGTCTGCAATTGCCTTTCGGGTTTGAGG
 
. : . : . : . : . : . :
JMFF044C21+ GAGACCAACAGTGGGAGAATAGCCATTGAACTTGTAAGAAGAGAGAGTGTCAGAAACAGC
JMFF022F04+ GAGACCAACAGTGGGAGAATAGCCATTGAACTTGTAAGAAGAGAGAGTGTCAGAAACAGC
                      ____________________________________________________________
consensus GAGACCAACAGTGGGAGAATAGCCATTGAACTTGTAAGAAGAGAGAGTGTCAGAAACAGC
 
. : . : . : . : . : . :
JMFF044C21+ CTGTTGAGCTAGAGCAGGAGAGTGAAAGCAAGAATAAGCAGTGGGGTCACCCATCCCCAA
JMFF022F04+ CTGTTGAGCTAGAGCAGGAGAGTGAAAGCAAGAATAAGCAGTGGGGTCACCCATCCCCAA
                      ____________________________________________________________
consensus CTGTTGAGCTAGAGCAGGAGAGTGAAAGCAAGAATAAGCAGTGGGGTCACCCATCCCCAA
 
. : . : . : . : . : . :
JMFF044C21+ AGATATCACCTTTTTACTGTCATCACCCTCACTGCCTTCAATATTCGCCATTAACAATCC
JMFF022F04+ AGATATCACCTTTTTACTGTCATCACCCTCACTGCCTTCAATATTCGCCATTAACAATCC
                      ____________________________________________________________
consensus AGATATCACCTTTTTACTGTCATCACCCTCACTGCCTTCAATATTCGCCATTAACAATCC
 
. : . : . : . : . : . :
JMFF044C21+ AAGAATGCCTTTGATTGTAATATTGGTTGGCGTTTCAATCTCCCCCCGGGTTTGCTTCTT
JMFF022F04+ AAGAATGCCTTTGATTGTAATATTGGTTGGCGTTTCAATCTCCCCCCGGGTTTGCTTCTT
                      ____________________________________________________________
consensus AAGAATGCCTTTGATTGTAATATTGGTTGGCGTTTCAATCTCCCCCCGGGTTTGCTTCTT
 
. : . : . : . : . : . :
JMFF044C21+ TTCAGTCTCCATTACTATCTTTTGCAGAAAAT
JMFF022F04+ TTCAGTCTCGATTACTATCTTTTGCAGAAAATGAGAGAGATTTAGGGAGTCGAGATTAAG
JMSF006H14+ AAAATGAGAGAGATTTAGGGAGTCGAGATTAAG
                      ____________________________________________________________
consensus TTCAGTCTCGATTACTATCTTTTGCAGAAAATGAGAGAGATTTAGGGAGTCGAGATTAAG
 
. : . : . : . : . : . :
JMFF022F04+ AAGGGCTGTGCAGGCGTGGAAGAGAAAGGCGTTGCTTTGATGGCCACACGTT
JMSF006H14+ AAGGGCTGTGCAGGCGTGGAAGAGAAAGGCGTTGCTTTGATGGCCACACGTTGAGACTTC
                      ____________________________________________________________
consensus AAGGGCTGTGCAGGCGTGGAAGAGAAAGGCGTTGCTTTGATGGCCACACGTTGAGACTTC
 
. : . : . : . : . : . :
JMSF006H14+ CTCCACCTCCACTTCAACAATATATACTACATTTGTTAGCAGGAGCAGAATTTTGTCTGA
                      ____________________________________________________________
consensus CTCCACCTCCACTTCAACAATATATACTACATTTGTTAGCAGGAGCAGAATTTTGTCTGA
 
. : . : . : . : . : . :
JMSF006H14+ TTGCCCTGCCCTGCATGCCAGACAACGACAAAACTTTTTTAAGGCTCCTGTGTTTGTGTT
                      ____________________________________________________________
consensus TTGCCCTGCCCTGCATGCCAGACAACGACAAAACTTTTTTAAGGCTCCTGTGTTTGTGTT
 
. : . : . : . : . : . :
JMSF006H14+ AGCGAAAACCTTCAATTCAAAATACAAAGGTATCAAATCATATAGCCATTGCTGTTTCTA
                      ____________________________________________________________
consensus AGCGAAAACCTTCAATTCAAAATACAAAGGTATCAAATCATATAGCCATTGCTGTTTCTA
 
. : . : . : . : . : . :
JMSF006H14+ ACTACTAAGTTACCCAGTTAGAATGTGATTTGAGAAGAAAATAAGAAGAAATGAAATTCA
                      ____________________________________________________________
consensus ACTACTAAGTTACCCAGTTAGAATGTGATTTGAGAAGAAAATAAGAAGAAATGAAATTCA
 
. : . : . : . : . : . :
JMSF006H14+ TTATTAACCGTATTCAACTAGAGTTTTGGGTATGGAACAACCAATCAGTTGTTCCACTCC
                      ____________________________________________________________
consensus TTATTAACCGTATTCAACTAGAGTTTTGGGTATGGAACAACCAATCAGTTGTTCCACTCC