Previous Contig 004801:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF006B14Sequence288004801 (2)gb:AY080790_15684921e-19Arabidopsis thaliana unknown protein (At1g04190) mRNA, complete cds.>gb:AY114043239011337 (2)
JMSF006G10Sequence431004801 (2)gb:AY080790_15684921e-40Arabidopsis thaliana unknown protein (At1g04190) mRNA, complete cds.>gb:AY114043

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF006G10+ GTGGATTGTGC
                      ____________________________________________________________
consensus GTGGATTGTGC
 
. : . : . : . : . : . :
JMSF006G10+ TTCAATGCAATCTGGAAAGCATCCAGTGCCTCATCATATCGTTCCATTGCCTCCAGTATA
                      ____________________________________________________________
consensus TTCAATGCAATCTGGAAAGCATCCAGTGCCTCATCATATCGTTCCATTGCCTCCAGTATA
 
. : . : . : . : . : . :
JMSF006G10+ CATCCTTTCCTAAAATAACCCTTTTCCCAGTCTGGCTTCAAACTGATTGTCATCTCTGCA
                      ____________________________________________________________
consensus CATCCTTTCCTAAAATAACCCTTTTCCCAGTCTGGCTTCAAACTGATTGTCATCTCTGCA
 
. : . : . : . : . : . :
JMSF006B14+ GGCAAGTGCTTTGTTGAGTTTAACCAGGTGTAGAAATGCTGCAGCACGATTGCTGTAA
JMSF006G10+ TCGGCAAGTGCTTTGTTGAGTTTAACCAGGTGTAGAAATGCTGCAGCACGATTGCTGTAA
                      ____________________________________________________________
consensus TCGGCAAGTGCTTTGTTGAGTTTAACCAGGTGTAGAAATGCTGCAGCACGATTGCTGTAA
 
. : . : . : . : . : . :
JMSF006B14+ AGAGTCGGGTTTGACGGGTCTTTCTTGATGGCCTGAGTGTAGAGAGCAGCGGCTTTGAGA
JMSF006G10+ AGAGTCGGGTTTGACGGGTCTTTCTTGATGGCCTGAGTGTAGAGAGCAGCGGCTTTGAGA
                      ____________________________________________________________
consensus AGAGTCGGGTTTGACGGGTCTTTCTTGATGGCCTGAGTGTAGAGAGCAGCGGCTTTGAGA
 
. : . : . : . : . : . :
JMSF006B14+ TAGTTCCCAGCTTTGAAGAATTCATTGCCTTGATCTTTCAATGAAACTTCCCGTTTGGCA
JMSF006G10+ TAGTTCCCAGCTTTGAAGAATTCATTGCCTTGATCTTTCAATGAAACTTCCCGTTTGGCA
                      ____________________________________________________________
consensus TAGTTCCCAGCTTTGAAGAATTCATTGCCTTGATCTTTCAATGAAACTTCCCGTTTGGCA
 
. : . : . : . : . : . :
JMSF006B14+ TCTGAATCTCCCATTGTCGTCTTCCCTTTCAGAAAATTTGCAGAAATTTGGGTTAGGGTT
JMSF006G10+ TCTGAATCTCCCATTGTCGTCTTCCCTTTCAGAAAATTTGCAGAAATTTGGGTTAGGGTT
                      ____________________________________________________________
consensus TCTGAATCTCCCATTGTCGTCTTCCCTTTCAGAAAATTTGCAGAAATTTGGGTTAGGGTT
 
. : . : . : . : . : . :
JMSF006B14+ TAAGGACTGTTCTTACTTCTTAGGGTTTCTGAGAGCTAAGCTTTCTCCC
JMSF006G10+ TAAGGACTGTTCTTACTTCTTAGGGTTTCTGAGAGCTAAGCTTTCTCCCGGTTCTAGACC
                      ____________________________________________________________
consensus TAAGGACTGTTCTTACTTCTTAGGGTTTCTGAGAGCTAAGCTTTCTCCCGGTTCTAGACC