Previous Contig 004799:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF006G04Sequence335004799 (2)gb:AY080736_15684540.011Arabidopsis thaliana unknown protein (At5g01620) mRNA, complete cds.>gb:AY117243
JMSF006H04Sequence351004799 (2)gb:AY080736_15684547e-04Arabidopsis thaliana unknown protein (At5g01620) mRNA, complete cds.>gb:AY117243

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF006H04+ GTCTACCACCGGACTCTGGCACGGGAGCATCCCAATTGGCTCCCCTGCCGC
JMSF006G04+ TGGCACGGGAGCATCCCAATNGGCTCCCCTGCCGC
                      ____________________________________________________________
consensus GTCTACCACCGGACTCTGGCACGGGAGCATCCCAATTGGCTCCCCTGCCGC
 
. : . : . : . : . : . :
JMSF006H04+ TATACTCTACCGTGTAGTGGCATTTACTAGACTTATCCAATTCCCTAGCTGAGTTCAACT
JMSF006G04+ TATACTCTNCCGTGTAGTGGCATTTACTAGACTTATCCAATTCCCTAGCTGAGTTCAACN
                      ____________________________________________________________
consensus TATACTCTACCGTGTAGTGGCATTTACTAGACTTATCCAATTCCCTAGCTGAGTTCAACT
 
. : . : . : . : . : . :
JMSF006H04+ TTAGGGCTGTGAGATTCTTGGATACGAGAAAAGGGTGTTCCTCGGACGGAGATATTTCTT
JMSF006G04+ TTAGGGCTGTGAGATTCTTGGATACGAGAAAAGGGTGTTCCTCGGACGGAGATATTTCTT
                      ____________________________________________________________
consensus TTAGGGCTGTGAGATTCTTGGATACGAGAAAAGGGTGTTCCTCGGACGGAGATATTTCTT
 
. : . : . : . : . : . :
JMSF006H04+ CAACGTTGCTTCCATTGAAGAACACGGAGAAGACTATGAACGCAAACAAGACAAGCGCAA
JMSF006G04+ CAACGTTGCTTCCATTGAAGAACACGGAGAAGACTATGAACGCAAACAAGACAAGCGCAA
                      ____________________________________________________________
consensus CAACGTTGCTTCCATTGAAGAACACGGAGAAGACTATGAACGCAAACAAGACAAGCGCAA
 
. : . : . : . : . : . :
JMSF006H04+ TCAAAGGGTACTGCCCTCTCTTCTTCTGGCACTTCTGCATTTTTTTGGGTGCGCCCACAC
JMSF006G04+ TCAAAGGGTACTGCCCTCTCTTCTTCTGGCACTTNTGCATTTTTTTGGGTGCGCCCACAC
                      ____________________________________________________________
consensus TCAAAGGGTACTGCCCTCTCTTCTTCTGGCACTTCTGCATTTTTTTGGGTGCGCCCACAC
 
. : . : . : . : . : . :
JMSF006H04+ CGGGAAACAAACAGAAAACAAATTGTGGGAATTGGAATTGATGACTGAGAGAGAATCTTC
JMSF006G04+ CGGGAAACAAACAGAAAACAAATTGTGGGAATTGGAATTGATGACTGAGAGAGAATCTTC
                      ____________________________________________________________
consensus CGGGAAACAAACAGAAAACAAATTGTGGGAATTGGAATTGATGACTGAGAGAGAATCTTC